ID: 1105443794

View in Genome Browser
Species Human (GRCh38)
Location 13:20435849-20435871
Sequence GCCTCCCGCGAGGGCGCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105443794_1105443803 8 Left 1105443794 13:20435849-20435871 CCGACAGCGCCCTCGCGGGAGGC 0: 1
1: 0
2: 1
3: 1
4: 81
Right 1105443803 13:20435880-20435902 TGGGGCCTCTTGCCAGCCCTCGG 0: 1
1: 0
2: 5
3: 37
4: 259
1105443794_1105443801 -10 Left 1105443794 13:20435849-20435871 CCGACAGCGCCCTCGCGGGAGGC 0: 1
1: 0
2: 1
3: 1
4: 81
Right 1105443801 13:20435862-20435884 CGCGGGAGGCAGCCGGGCTGGGG 0: 1
1: 0
2: 3
3: 52
4: 390
1105443794_1105443809 26 Left 1105443794 13:20435849-20435871 CCGACAGCGCCCTCGCGGGAGGC 0: 1
1: 0
2: 1
3: 1
4: 81
Right 1105443809 13:20435898-20435920 CTCGGTGTTCGATGCTTCATGGG 0: 1
1: 0
2: 0
3: 2
4: 31
1105443794_1105443808 25 Left 1105443794 13:20435849-20435871 CCGACAGCGCCCTCGCGGGAGGC 0: 1
1: 0
2: 1
3: 1
4: 81
Right 1105443808 13:20435897-20435919 CCTCGGTGTTCGATGCTTCATGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105443794 Original CRISPR GCCTCCCGCGAGGGCGCTGT CGG (reversed) Intronic
901689032 1:10960624-10960646 GCCTCCCGCTCGGGGCCTGTGGG + Intronic
903185005 1:21623815-21623837 GCCTCCCCCGGGGGCAGTGTGGG - Intronic
903822064 1:26110989-26111011 GCCTCGCGGGGGGGCGCCGTGGG + Intergenic
907283148 1:53363634-53363656 GCTTCCTGCCAGGGCCCTGTGGG + Intergenic
910237006 1:85047434-85047456 GCCTCCCGCGCCGGCGCTCCGGG - Intronic
910647126 1:89525468-89525490 GCCCCCTGCGCTGGCGCTGTTGG + Intronic
918356105 1:183707640-183707662 GCCTCAGGAGAGGGCGCTGGGGG + Intronic
1069664508 10:70145758-70145780 GCGGCCCGCGGGGGCGCTGGTGG - Exonic
1071694987 10:87862113-87862135 GCCTCCCGAAGGAGCGCTGTCGG - Exonic
1074291249 10:112139427-112139449 GCCTACCACGAGGGCAGTGTGGG - Intergenic
1077059273 11:610601-610623 GCCTGCCGCTAGTGGGCTGTGGG + Exonic
1078377494 11:10808361-10808383 GCCTCCCGCCACGGCGCTAGCGG + Intronic
1084102319 11:66957954-66957976 GCCTCGCGCGAGGTCCCTGAGGG - Intronic
1091209302 11:133842962-133842984 GCCTACAGCGAGGAAGCTGTGGG + Intronic
1093736416 12:22625318-22625340 CCCTCCCGCGAGGGCGCCCCGGG + Exonic
1099300215 12:80883873-80883895 GCCTCCCAAGAGGGCTATGTGGG - Intronic
1101326085 12:103717093-103717115 GCCTCCTGGGAGGGCACAGTGGG + Intronic
1105411822 13:20177394-20177416 GCCTCCCGCAGGGGCGCAGACGG + Intergenic
1105443794 13:20435849-20435871 GCCTCCCGCGAGGGCGCTGTCGG - Intronic
1105485512 13:20827104-20827126 GTCTCCCGCCAGGACTCTGTTGG + Exonic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1114266302 14:21074544-21074566 CCCACCCGCAAGGGCGCTGGAGG + Exonic
1118331344 14:64818262-64818284 GCCTCCTGCGAAGGGCCTGTGGG - Intronic
1118776700 14:68978324-68978346 GGCTCCCCCGCGGGCCCTGTGGG - Intronic
1124370687 15:29103344-29103366 GCCTCCTGCAAGTGGGCTGTGGG - Intronic
1130655549 15:85789830-85789852 GCCTCCTGCGAAGGGGCTGGTGG - Intronic
1131515156 15:93072443-93072465 GTCTCCGGGGAGGGGGCTGTCGG + Intronic
1132204093 15:99974705-99974727 GCCTCCTGCCAGGGCACTGGGGG + Intronic
1132951859 16:2567331-2567353 GCCTCCATAGAGGGCTCTGTGGG + Intronic
1132962491 16:2632839-2632861 GCCTCCATAGAGGGCTCTGTGGG - Intergenic
1137328106 16:47461480-47461502 GCCTCCCGCCAAGGCGCTTGAGG - Intronic
1137454782 16:48609983-48610005 GCCTCCCGCGGCGGCGCCGGGGG + Exonic
1139570107 16:67806463-67806485 TCCTCCGGCGGGGGCGCTGGGGG - Exonic
1139954363 16:70686143-70686165 GCCGCGCGGGAGGGGGCTGTGGG + Intergenic
1141748798 16:85944629-85944651 GCCTCCCCCGAGAACTCTGTTGG + Intergenic
1142716657 17:1750790-1750812 CCCTCCTGGGAGGGGGCTGTGGG + Intronic
1146958216 17:36949346-36949368 GCCTCCCGCGAGGGTGGTCCCGG + Intronic
1152917977 17:83051810-83051832 GCCGCCCGCGCAGGCGCCGTAGG - Exonic
1152925852 17:83087452-83087474 GCCTCTCGTGAGGGCCCTGGAGG - Intronic
1158634952 18:59148239-59148261 GCCTCCCTGGAGGGCGGTGCTGG + Intronic
1160242462 18:77133102-77133124 CCCTCCCGCGAGGTCGAGGTCGG - Intronic
1160452203 18:78973678-78973700 TCCTCCCGAGAGGGCGCCGCGGG + Intergenic
1160539797 18:79614312-79614334 GCCTCCCCCAGGGGCGATGTGGG - Intergenic
1160680090 19:408476-408498 GCCTCCCGGCAGGGCCCTGCCGG + Intronic
1160837978 19:1133386-1133408 GACTCCCGCCAGGGCTCTGAGGG + Intronic
1163282339 19:16325388-16325410 GCCACCCGCGGGGGCGCTGTAGG - Exonic
1163418561 19:17201633-17201655 GCCTCAGGGGAGGGCGCTGTTGG + Intronic
1165345964 19:35249013-35249035 GACGGCCGCGATGGCGCTGTTGG + Exonic
1166268600 19:41700236-41700258 GCCTCCAGGGAGGGGGCTGCAGG + Intronic
1167271049 19:48506505-48506527 GCCTCCCGCCAGGCCCCAGTAGG - Intronic
928158169 2:28895093-28895115 GCCTGCCGCGAGGGCAGTGAGGG + Intronic
936171998 2:110184962-110184984 GCCTCCCAAGAGGACGATGTTGG - Intronic
936985725 2:118310184-118310206 GCCGCCCGCGATGGCGCCGATGG + Intergenic
1171419348 20:25007616-25007638 GCTTCACGTGAGGGCGGTGTGGG + Exonic
1173576559 20:44116002-44116024 GGCTCCCGCGACGGCGCAGGCGG + Exonic
1174500500 20:50980875-50980897 GTCTCCCTCGAGGGTCCTGTTGG - Intergenic
1175358644 20:58389618-58389640 GCCCCCCGCGACAGCGCCGTCGG - Intronic
1178724093 21:35035972-35035994 GCCTCCCCAGAGGCTGCTGTGGG + Intronic
1179922256 21:44513640-44513662 CCCGCCCTCGAGGGAGCTGTTGG - Intronic
1183298623 22:37046932-37046954 ACCTGCCGCAAGGGTGCTGTGGG + Intergenic
1184534283 22:45076221-45076243 GCCTCCCTGAAGGGTGCTGTAGG + Intergenic
1185229199 22:49670642-49670664 GCATCCCGCCACCGCGCTGTGGG - Intergenic
950377407 3:12582987-12583009 GCCTCCAGCCAGGGCCCTCTAGG + Exonic
961315956 3:126035828-126035850 GCCACCCACGAGGGGGCTCTCGG + Intronic
964519022 3:157543422-157543444 GCCTCCTGCGTGCGTGCTGTGGG + Exonic
969858609 4:10019027-10019049 GCCTCCCTCGCGGGCGCCTTCGG - Exonic
979674980 4:123399676-123399698 GGCTCCCGCGTGGACGCTGAAGG + Intronic
993651601 5:90529369-90529391 GCCTCCCGTGAGGACGCAGCTGG + Intronic
993901725 5:93588524-93588546 GCCTCCCGCGCGGCCGGTGCGGG + Intronic
1002487735 5:179550929-179550951 GCCGCCGGCGCGGGCGCGGTGGG + Intronic
1002797864 6:489935-489957 TGCTCCCGGGAGGGCGCGGTGGG + Intronic
1017815323 6:158012086-158012108 ACCTCCCAGGAGGGCCCTGTAGG + Intronic
1018906990 6:168081229-168081251 ACCTCCCGCCAGGGCACTGAGGG + Intronic
1019355987 7:579224-579246 GCTTCCCACGTGGGCGCTCTGGG - Intronic
1025145289 7:56496278-56496300 GCCTCCAGGTAGGGCCCTGTTGG + Intergenic
1030059650 7:105612581-105612603 GCCTCCAGGGAGAGCCCTGTGGG + Intronic
1035224358 7:157425302-157425324 GCCTCCCTCAAGGGTGCTGCAGG + Intergenic
1049613791 8:143567707-143567729 GCCTCCCCCTGGGGGGCTGTGGG - Intronic
1061518794 9:131105113-131105135 GCCTGCAGGGAGGGAGCTGTGGG + Intronic
1062031377 9:134363559-134363581 GCCTCCCTGGAGGGCAGTGTAGG - Intronic
1062638791 9:137506184-137506206 GACTCCCTCGAGGGAGCTGCCGG - Intronic
1189913898 X:45838079-45838101 ACCTCCCGGGAGGGCAATGTGGG - Intergenic
1191952013 X:66602740-66602762 GCCTCCTGAGGGGGCACTGTGGG + Exonic
1196645890 X:118116913-118116935 GCCTCCCGCGCAGGCGCCGCCGG - Intronic