ID: 1105444168

View in Genome Browser
Species Human (GRCh38)
Location 13:20438202-20438224
Sequence CTTAGCACATAAAACCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105444165_1105444168 -7 Left 1105444165 13:20438186-20438208 CCAAGCTGCTGCTCTTCTTAGCA 0: 1
1: 0
2: 0
3: 11
4: 216
Right 1105444168 13:20438202-20438224 CTTAGCACATAAAACCTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1105444161_1105444168 23 Left 1105444161 13:20438156-20438178 CCAGGACCATGCAGCTATGTAAA 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1105444168 13:20438202-20438224 CTTAGCACATAAAACCTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1105444163_1105444168 17 Left 1105444163 13:20438162-20438184 CCATGCAGCTATGTAAATGGTGG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1105444168 13:20438202-20438224 CTTAGCACATAAAACCTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1105444160_1105444168 24 Left 1105444160 13:20438155-20438177 CCCAGGACCATGCAGCTATGTAA 0: 1
1: 0
2: 1
3: 14
4: 107
Right 1105444168 13:20438202-20438224 CTTAGCACATAAAACCTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105444168 Original CRISPR CTTAGCACATAAAACCTGGT GGG Intronic
902950375 1:19877915-19877937 CTTAGCATATAAAACCACCTAGG - Intergenic
904852172 1:33467493-33467515 CTGACCACCCAAAACCTGGTAGG + Intergenic
910120301 1:83781239-83781261 CTTAGCATATAAAACACAGTAGG + Intergenic
912060672 1:105664497-105664519 CTGAGCATATACAACCTTGTGGG - Intergenic
915533217 1:156516411-156516433 CTTAGAAAATAAAACCTGCTGGG + Intergenic
916975837 1:170076693-170076715 CTTAACAGAAAATACCTGGTAGG + Intronic
918111312 1:181457586-181457608 CCTAGCACATGAAATCTGCTAGG - Intronic
919710626 1:200723931-200723953 CTTAAAACATATAACCAGGTTGG - Intergenic
923213109 1:231824056-231824078 CTTAGCACCTAAAAAGTGGCTGG + Intronic
1064554527 10:16535133-16535155 CTTAACACATACAACCAGGTTGG + Intergenic
1071747658 10:88440094-88440116 TTTATCACATAAATCCTGTTAGG - Intronic
1073697103 10:105882028-105882050 CTCAGCACAAAAAACCTGGAAGG - Intergenic
1076944494 10:133636976-133636998 CTTAGCACATACAATATGTTAGG + Intergenic
1078114488 11:8432070-8432092 CCTAGCACCTAGTACCTGGTAGG + Intronic
1078766032 11:14299525-14299547 CATACTACATAAAACCTGGAGGG - Intronic
1083366479 11:62144678-62144700 ATTAGCACATAAATCCTATTTGG + Intronic
1084851948 11:71948937-71948959 GCTAGCTCATGAAACCTGGTAGG - Intronic
1086527930 11:87750859-87750881 ATTAGCACATAATACCTGGAAGG - Intergenic
1088055865 11:105576400-105576422 CTTACTACAAAACACCTGGTAGG - Intergenic
1097819003 12:64108388-64108410 CTTAGTGCTTGAAACCTGGTGGG + Intronic
1099922732 12:88979223-88979245 TTGAGCACATAAAACTGGGTTGG + Intergenic
1100287802 12:93183915-93183937 CTTTTCAAGTAAAACCTGGTAGG - Intergenic
1101223728 12:102666939-102666961 CTTACAATTTAAAACCTGGTGGG - Intergenic
1103256000 12:119541966-119541988 CTTAACACCTAGAACTTGGTTGG - Intergenic
1104874054 12:132020670-132020692 TTTAGCTCAGAAAACCTGGATGG - Intronic
1105444168 13:20438202-20438224 CTTAGCACATAAAACCTGGTGGG + Intronic
1108933138 13:55855970-55855992 TTTAGCACATAAAAACTCCTTGG + Intergenic
1110949509 13:81467203-81467225 CTTATCAAAGAAAACATGGTTGG + Intergenic
1111226448 13:85278754-85278776 CTTAGCATATATAAACTGTTTGG + Intergenic
1111239412 13:85455479-85455501 CTTAGCACATAAAACAAGATTGG - Intergenic
1115907707 14:38219487-38219509 CCCAGCACATAAAAGCTGATAGG + Intergenic
1118955145 14:70474451-70474473 CTGAGCACACAAAACCAGATAGG + Intergenic
1202917894 14_KI270723v1_random:2307-2329 CTTAGCACATAAAATATGTTAGG + Intergenic
1202926731 14_KI270724v1_random:32277-32299 CTTAGCACATAAAATATGTTAGG - Intergenic
1125331799 15:38589805-38589827 CTTTTCACATAATACCTGCTAGG - Intergenic
1127817246 15:62621911-62621933 CTCAGGACATAAAACCAGTTTGG + Intronic
1132294352 15:100724679-100724701 TTTAAAACATAAAACCTGGCCGG + Intergenic
1137013046 16:35343654-35343676 CTTAGCACATACAATATGTTAGG + Intergenic
1144630547 17:16869991-16870013 GTGAGCACAAAAAACATGGTGGG + Intergenic
1144969133 17:19096158-19096180 CTTAGCCCCTGAAACCGGGTTGG - Intronic
1144978783 17:19155908-19155930 CTTAGCCCCTGAAACCGGGTTGG + Intronic
1144989439 17:19222324-19222346 CTTAGCCCCTGAAACCGGGTTGG - Intronic
1146619117 17:34382840-34382862 CTGAGCCCACAGAACCTGGTAGG + Intergenic
1148874830 17:50680769-50680791 CTGAGCACTTAAAACCTTGCAGG + Intronic
1150836598 17:68569605-68569627 CTTAGCAATTAAAATGTGGTGGG - Intronic
1152096703 17:78276809-78276831 CTTAGCCCATCAATCCTGGCAGG - Intergenic
1153116963 18:1669789-1669811 CTTAGAGCATAAAATCTAGTGGG + Intergenic
1153672128 18:7421552-7421574 CTGAAGACATAAAACATGGTTGG - Intergenic
1155984918 18:32219663-32219685 CTTAGCAAGTAAAAACTGGAAGG + Intronic
1157145742 18:45160517-45160539 CTAATAACATAAAACCTGTTTGG - Intergenic
1157518847 18:48330870-48330892 CTGAGCACATAAACCTTGTTTGG - Intronic
1159459956 18:68712259-68712281 CTCAGCAGATAGAACATGGTGGG - Intronic
1162263955 19:9554743-9554765 CTTAAAAAAAAAAACCTGGTTGG - Intergenic
1165989784 19:39803758-39803780 CTTAGCACACAACTCCTGGGGGG + Intergenic
926793803 2:16602133-16602155 GTTAGAAAATAAACCCTGGTAGG - Intronic
929542179 2:42830927-42830949 CATAACACATAAAACATGGGGGG + Intergenic
930421476 2:51158192-51158214 CACAGCACATCCAACCTGGTAGG - Intergenic
931357689 2:61551682-61551704 CACAGCACATAAAACATCGTGGG - Intergenic
931894165 2:66710767-66710789 CTTAACACATATTACCTTGTGGG - Intergenic
936487307 2:112937245-112937267 CTGAGCACATAATACATGTTAGG + Intergenic
941508256 2:166375234-166375256 CTTAGCAGATACAACCTGTGGGG - Intronic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
1169955749 20:11100798-11100820 CTTAGCACAGGATGCCTGGTTGG + Intergenic
1171781856 20:29426967-29426989 CTTAGCACATAGAATATGTTAGG + Intergenic
1172747106 20:37219831-37219853 CTTGGCACATACATCCTTGTAGG + Intronic
1175696189 20:61105012-61105034 CTTAGCACATCATACGTAGTTGG + Intergenic
949368947 3:3313787-3313809 CTTAGCAAATAGAAATTGGTTGG - Intergenic
949855060 3:8453678-8453700 CTTAGCACTTAAAATGTGCTGGG + Intergenic
950185264 3:10941059-10941081 CTTAGAACATAGATCCTGGCTGG - Intergenic
952655730 3:35783123-35783145 CTGAGAAAATAAAACCTGGATGG - Intronic
953942836 3:47116394-47116416 CCAAGCACTTAAAACATGGTGGG + Intronic
955146121 3:56321777-56321799 CTTAGCAAACAAAACCAGTTAGG - Intronic
955213923 3:56968825-56968847 CTGAGCACTTAAAACATGGCTGG - Intronic
964943946 3:162195400-162195422 CTTAGCCCACAAATCTTGGTTGG + Intergenic
965157641 3:165085217-165085239 CTTCACACATAAAACCTAATTGG + Intergenic
972223262 4:36980725-36980747 CCAAGGACATAAAACTTGGTTGG - Intergenic
978780444 4:112547616-112547638 CCCTGCACATAAAACCTAGTAGG + Intronic
979942735 4:126782740-126782762 ATGAGAACATAAAACCTGGCTGG + Intergenic
981143547 4:141299338-141299360 TTTAGCACATAAAGCCAAGTTGG + Intergenic
982400443 4:154961263-154961285 CATAGCACATAAAAACATGTTGG + Intergenic
982519824 4:156401295-156401317 ATTAGCACAGAACAACTGGTAGG + Intergenic
985447880 4:190037487-190037509 CTTAGCACATACAATATGTTAGG + Intergenic
986109015 5:4692719-4692741 CTGAGCACATAAAGCCAGTTAGG - Intergenic
987274545 5:16348119-16348141 GTTAGCAAATTAAACCTGGAGGG + Intergenic
987592773 5:19952560-19952582 ATTAGCACATAAAATCTCTTTGG + Intronic
989207402 5:38824609-38824631 TTAAGCACTTGAAACCTGGTGGG + Intergenic
993685299 5:90929654-90929676 CTTAGAACAAATAACCTGGGGGG - Intronic
995086577 5:108118022-108118044 ATTACCACATAATACCTGGCAGG + Intronic
996307722 5:122068991-122069013 CACAGCACAGAAAACCTGGCAGG - Intronic
1000285855 5:159825770-159825792 CAAAACAAATAAAACCTGGTGGG - Intergenic
1001725239 5:173890795-173890817 CTTTGCACCTAAATCCTGGATGG + Exonic
1006644812 6:35508897-35508919 CCTGGCACAGAAAACATGGTGGG + Intronic
1007352673 6:41285300-41285322 CTTAGCACATAATACTTAATAGG - Intronic
1007573702 6:42911332-42911354 CTTAGCCGGTAACACCTGGTGGG + Intergenic
1011469653 6:87695880-87695902 CTTAGCAGAAAAAACCTGCCGGG + Intronic
1013637423 6:112042174-112042196 CTTTGGACATAAAACCTGAGGGG + Intergenic
1020645801 7:10812568-10812590 CTTGGCACCAAAAACATGGTGGG - Intergenic
1021136866 7:16975752-16975774 CTTACTCCATAAAAGCTGGTTGG - Intergenic
1022960403 7:35420447-35420469 CTTGGCACATAGAACCTGTAAGG - Intergenic
1022966083 7:35473662-35473684 CATAGCTCATAAAACCTGCAGGG + Intergenic
1023895394 7:44428906-44428928 ATTAGCAGACAAAACCTGGCAGG + Intronic
1024967297 7:55035086-55035108 CTTAACACATAAGACTTGGGAGG + Intronic
1027967870 7:85037131-85037153 CTTAGCACATTAAATTTGATGGG + Intronic
1038084627 8:24180942-24180964 CTTAGCATATTAATCCTTGTTGG - Intergenic
1038173519 8:25160444-25160466 CTTAGCTCAGGAAATCTGGTTGG + Intergenic
1041902190 8:62994524-62994546 CTTTCCTCATAAAACCTGTTTGG + Intronic
1044742078 8:95337644-95337666 CATAGCACTTAAAAAGTGGTTGG - Intergenic
1046017520 8:108622901-108622923 CTTAGCACATAAAATATGCCTGG - Intronic
1047641015 8:126821537-126821559 CTCACCGCATAACACCTGGTAGG + Intergenic
1048151361 8:131898107-131898129 CTGAGCAGATAAAACCAGTTAGG - Intergenic
1053443051 9:38131454-38131476 CTGAGCACCTAACACCTGGCTGG + Intergenic
1058412984 9:104754569-104754591 CTTTTCAGATGAAACCTGGTGGG + Exonic
1060514916 9:124259480-124259502 TTTAGCAAACAAAACCTGGAAGG + Intronic
1061327528 9:129873378-129873400 CTTAAGAAATAAAACCTGGCTGG - Intronic
1203441647 Un_GL000219v1:15206-15228 CTTAGCACATACAATATGTTAGG + Intergenic
1203512456 Un_KI270741v1:134114-134136 CTTAGCACATACAATATGTTAGG + Intergenic
1187325010 X:18278506-18278528 CCCAGCACATAAAACCTCCTGGG - Intronic
1189648337 X:43158863-43158885 CTTGGCACATAACATCTGTTTGG + Intergenic
1192687653 X:73323887-73323909 CTTAGAATTTAAAACTTGGTGGG - Intergenic
1198419466 X:136455389-136455411 CTTAGCACATAAAAATTGACTGG - Intergenic
1199192776 X:144990845-144990867 ATTAGCACATAAACCCTTTTGGG + Intergenic
1200241011 X:154493860-154493882 CTTATTACATAATACCTGGCAGG - Intergenic
1200692028 Y:6315842-6315864 CATAGCCCATAAATCCTGTTTGG + Intergenic
1200978500 Y:9239280-9239302 CTTACCATTTAAAACTTGGTGGG + Intergenic
1201043244 Y:9858885-9858907 CATAGCCCATAAATCCTGTTTGG - Intergenic
1201049697 Y:9920038-9920060 CATAGCCCATAAATCCTGTTTGG + Intergenic