ID: 1105445792

View in Genome Browser
Species Human (GRCh38)
Location 13:20455995-20456017
Sequence TAGGGTTCAACAAATGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 772
Summary {0: 1, 1: 1, 2: 15, 3: 80, 4: 675}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105445792 Original CRISPR TAGGGTTCAACAAATGGTGC TGG Intronic
900723631 1:4199127-4199149 CTCTGTTCAACAAATGGTGCTGG + Intergenic
902726982 1:18343676-18343698 GTGTGTTCGACAAATGGTGCTGG - Intronic
903692330 1:25183442-25183464 GAGGGTTCACGAAATGGTGCAGG - Intergenic
905101414 1:35526069-35526091 TCTTGTTCAACAAATGGTCCTGG - Intronic
905327254 1:37163147-37163169 TAGTCTTCAACAAATGATGCTGG - Intergenic
905901340 1:41583764-41583786 GAGGGTTCCACAAATGGAGGGGG + Exonic
906111645 1:43327201-43327223 TAGTCTTCAACAAATGGTGCTGG + Intergenic
909397078 1:75182232-75182254 TCCTATTCAACAAATGGTGCTGG - Intergenic
909405489 1:75283730-75283752 TCCTGCTCAACAAATGGTGCTGG - Intronic
909645538 1:77912704-77912726 TTATTTTCAACAAATGGTGCTGG + Intronic
910166437 1:84332962-84332984 TCCTATTCAACAAATGGTGCTGG - Intronic
910384845 1:86670976-86670998 CAGTCTTCAATAAATGGTGCTGG + Intergenic
910846389 1:91608660-91608682 GCCTGTTCAACAAATGGTGCTGG - Intergenic
911133103 1:94410888-94410910 ATTGGTTCAACAAATGATGCTGG + Intergenic
911265508 1:95738419-95738441 TACTATTCAACAAATGGTGCTGG - Intergenic
911267500 1:95760924-95760946 TAGTCTCCAATAAATGGTGCTGG + Intergenic
911324666 1:96456026-96456048 GTTGTTTCAACAAATGGTGCTGG - Intergenic
911384102 1:97153406-97153428 TCCTATTCAACAAATGGTGCTGG + Intronic
911743653 1:101415473-101415495 CTGTCTTCAACAAATGGTGCTGG + Intergenic
911889895 1:103355354-103355376 TAGAATTTAATAAATGGTGCTGG + Intergenic
912000620 1:104830170-104830192 TCCTGTTCAATAAATGGTGCTGG + Intergenic
912408197 1:109460196-109460218 TAGTCTTCAAAAAATGGTGTGGG + Intergenic
913345746 1:117809279-117809301 AAATGTTCAACGAATGGTGCTGG + Intergenic
913465820 1:119141354-119141376 TAGGGTTCAACAAAGTTTACAGG - Intergenic
914346480 1:146803923-146803945 TCCTTTTCAACAAATGGTGCTGG + Intergenic
914972518 1:152323114-152323136 TAGTCTTGAATAAATGGTGCTGG + Intronic
915022627 1:152796183-152796205 TATGGTTTAAAAAATGGTACAGG + Intronic
915659100 1:157387309-157387331 TAGTATTTAATAAATGGTGCTGG - Intergenic
915821221 1:159025904-159025926 TCCTATTCAACAAATGGTGCTGG - Intronic
915938410 1:160102777-160102799 TAGGGTTCAAGAATGGGGGCAGG - Intergenic
917008346 1:170441712-170441734 TACTGTTCAACAACTGGTTCAGG + Intergenic
917542867 1:175932522-175932544 TAGGGTTCTATATATGATGCAGG - Intergenic
917894102 1:179470057-179470079 TAGTCTTCAACAAATGGTGCTGG - Intronic
918182793 1:182099441-182099463 CACTGTTCAATAAATGGTGCTGG - Intergenic
918274103 1:182934892-182934914 TTCTCTTCAACAAATGGTGCTGG - Intronic
918457913 1:184743842-184743864 TTATTTTCAACAAATGGTGCTGG + Intronic
918637151 1:186791252-186791274 TAGTTTTCAACAGATGGTGCTGG + Intergenic
918938820 1:190962636-190962658 TCCGATTCAACAAATGCTGCTGG + Intergenic
920586186 1:207164144-207164166 CAGTCTTCAATAAATGGTGCTGG + Intergenic
920990211 1:210930441-210930463 ACTGATTCAACAAATGGTGCTGG + Intronic
921228235 1:213042126-213042148 TAGTCTTCAACAAATGGTGCTGG - Intergenic
921683092 1:218057482-218057504 TAGTCTTCACCAAATGATGCTGG - Intergenic
921690586 1:218144592-218144614 TCTTATTCAACAAATGGTGCTGG + Intergenic
922284514 1:224157438-224157460 CAGGTTAAAACAAATGGTGCTGG + Exonic
922394896 1:225187963-225187985 TAGACTTTAACAAATGGTGCAGG - Intronic
922403969 1:225292334-225292356 CAGTCTTCAATAAATGGTGCTGG - Intronic
922656026 1:227384287-227384309 ATGTTTTCAACAAATGGTGCTGG + Intergenic
922889650 1:229051476-229051498 TCCTGTTCAACAAATGGTGCTGG + Intergenic
923691455 1:236197619-236197641 CCCTGTTCAACAAATGGTGCTGG - Intronic
923691957 1:236202942-236202964 AAGACTTCAATAAATGGTGCTGG - Intronic
923997671 1:239513866-239513888 ATCGCTTCAACAAATGGTGCTGG - Intronic
924281730 1:242445068-242445090 TAGGGTTCAACAAATGAGTTTGG - Intronic
924321012 1:242850393-242850415 CTGTTTTCAACAAATGGTGCTGG - Intergenic
924647281 1:245889994-245890016 TAGTCTTCAATAAATGGTGCCGG + Intronic
924874866 1:248091515-248091537 TCCTGTTCAATAAATGGTGCTGG - Intronic
924879763 1:248147536-248147558 AGGTATTCAACAAATGGTGCTGG - Intergenic
924891164 1:248281835-248281857 TCCTGTTCAAAAAATGGTGCTGG - Intergenic
1063032655 10:2251213-2251235 CATTTTTCAACAAATGGTGCTGG - Intergenic
1063161093 10:3419329-3419351 TAAAGTTGAACAAACGGTGCTGG - Intergenic
1063201844 10:3791494-3791516 AAGTCTTCAACAAATGATGCTGG + Intergenic
1063357644 10:5416126-5416148 CAGTCTTCAAAAAATGGTGCTGG - Intronic
1063644409 10:7864987-7865009 TGGAATTCAACAAATGGTGCAGG - Intronic
1064643971 10:17441653-17441675 TAGTTTTCAACAAATGGTGCTGG - Intronic
1064724002 10:18258868-18258890 TATGGTTCAGAAAATGGTGAGGG + Intronic
1065070460 10:22018872-22018894 CAGTCTTCAACAAATAGTGCAGG + Intergenic
1065894196 10:30147564-30147586 TCCTATTCAACAAATGGTGCTGG - Intergenic
1066651430 10:37659784-37659806 TCCTATTCAACAAATGGTGCTGG + Intergenic
1066753276 10:38682267-38682289 CCGTATTCAACAAATGGTGCTGG + Intergenic
1067268284 10:44766513-44766535 TAGGAATGAACAAATGCTGCAGG - Intergenic
1067356797 10:45536309-45536331 CTGTTTTCAACAAATGGTGCTGG + Intronic
1067678661 10:48411348-48411370 TAGTCTCTAACAAATGGTGCTGG - Intronic
1067727867 10:48785568-48785590 GACTCTTCAACAAATGGTGCTGG - Intronic
1068073560 10:52225720-52225742 TCCTTTTCAACAAATGGTGCTGG - Intronic
1068114880 10:52725870-52725892 TACTTTTCAACAAATGGTGCTGG + Intergenic
1068269641 10:54704012-54704034 CAGTGTTCAACAAATGGAGCTGG + Intronic
1068456197 10:57256830-57256852 TCCTATTCAACAAATGGTGCCGG - Intergenic
1068522327 10:58091384-58091406 CAGTCTTCAACAAATGATGCTGG + Intergenic
1068618554 10:59150763-59150785 TAGTCTTCAACAAATGGAGCTGG - Intergenic
1068640538 10:59400356-59400378 TATTATTCAATAAATGGTGCAGG - Intergenic
1068653947 10:59555228-59555250 GAGCTTTCAACAAATGGTGCTGG + Intergenic
1068809156 10:61236389-61236411 CCCTGTTCAACAAATGGTGCTGG + Intergenic
1069605199 10:69734371-69734393 TTGGGTGCTACAAAGGGTGCAGG + Intergenic
1070854970 10:79600519-79600541 AAATGTTCAATAAATGGTGCTGG + Intergenic
1071015449 10:80991940-80991962 CCCTGTTCAACAAATGGTGCTGG - Intergenic
1071020735 10:81052230-81052252 CCGTTTTCAACAAATGGTGCTGG + Intergenic
1071021047 10:81057065-81057087 TTTGGTTCCACAAAAGGTGCAGG - Intergenic
1071122202 10:82291714-82291736 CAAGTTTCAACAAATGGTCCTGG + Intronic
1071171582 10:82871155-82871177 AACTTTTCAACAAATGGTGCTGG - Intronic
1071589476 10:86859170-86859192 CAGTCTTCAATAAATGGTGCTGG + Intronic
1072164273 10:92797490-92797512 CTGTTTTCAACAAATGGTGCTGG + Intergenic
1073399551 10:103245499-103245521 TAGGTTTAAAAAAATGGTGAGGG - Intergenic
1073784208 10:106870595-106870617 TTGTATTCAATAAATGGTGCTGG + Intronic
1074283089 10:112071543-112071565 GAGGGTTCACCAGATGGTACAGG - Intergenic
1074985403 10:118654262-118654284 TCCTTTTCAACAAATGGTGCTGG - Intergenic
1075720473 10:124583379-124583401 TAGCCTTCAACAAATGCTGCTGG - Intronic
1075770010 10:124925788-124925810 TGTGTTTCAACAAATGATGCAGG - Intergenic
1076716620 10:132368568-132368590 TAGTCTTCAACAGATGGTACTGG + Intronic
1077127697 11:950132-950154 TAGTCTTAAACAAATGGTGCTGG + Intronic
1077985236 11:7344644-7344666 GACTTTTCAACAAATGGTGCTGG - Intronic
1078289045 11:9988170-9988192 TCCTTTTCAACAAATGGTGCTGG + Intronic
1078962559 11:16295333-16295355 TAGGGTTCAACAAATACTTTAGG + Intronic
1079179879 11:18182193-18182215 TACTTTTCAACAAATGATGCTGG + Intronic
1080092412 11:28363914-28363936 TACCATTCAATAAATGGTGCTGG - Intergenic
1080590304 11:33717635-33717657 CAGGGTCCAAAAAATGTTGCTGG - Intronic
1080612994 11:33921161-33921183 TAGGGTTCCACTCTTGGTGCTGG + Intergenic
1080812575 11:35719783-35719805 TAGTTGTGAACAAATGGTGCTGG - Intronic
1081544958 11:44065226-44065248 CAGAGTTCAACAAATATTGCAGG + Intergenic
1082654172 11:55832972-55832994 CCCTGTTCAACAAATGGTGCTGG - Intergenic
1082668187 11:56001551-56001573 CTGTGTTCAATAAATGGTGCTGG - Intergenic
1082677822 11:56130202-56130224 CAGTATTCAATAAATGGTGCTGG + Intergenic
1082732079 11:56811283-56811305 GACTGTTCAATAAATGGTGCTGG - Intergenic
1083086236 11:60148919-60148941 TCTTTTTCAACAAATGGTGCTGG + Intergenic
1083483828 11:62969716-62969738 AATCTTTCAACAAATGGTGCTGG + Intronic
1083530044 11:63412173-63412195 TCCTGTTCAATAAATGGTGCAGG + Intergenic
1084353491 11:68621032-68621054 GTGTTTTCAACAAATGGTGCTGG + Intergenic
1084886714 11:72214570-72214592 TAGTCTTCAACAAATGGTGCTGG + Intergenic
1086389714 11:86350507-86350529 AACGGTTCAACAAATGATGTTGG - Intergenic
1086522871 11:87690519-87690541 CAGGATTTAATAAATGGTGCTGG + Intergenic
1086758732 11:90600297-90600319 AAGTTTTCAACAAATGGTGCTGG + Intergenic
1086824879 11:91484428-91484450 TCCTTTTCAACAAATGGTGCTGG - Intergenic
1086986361 11:93254177-93254199 CCCTGTTCAACAAATGGTGCTGG + Intergenic
1087405700 11:97727333-97727355 CCAGGTTCAATAAATGGTGCTGG + Intergenic
1087631805 11:100658942-100658964 TGCTGTTCAACAAATGGTGCTGG + Intergenic
1087745134 11:101935560-101935582 TATTTTCCAACAAATGGTGCTGG - Intronic
1088306547 11:108415864-108415886 TAGTCTTCAACAAATGGTGCTGG + Intronic
1088418440 11:109616076-109616098 CCCTGTTCAACAAATGGTGCAGG + Intergenic
1088942238 11:114471362-114471384 TGTTTTTCAACAAATGGTGCTGG - Intergenic
1088951540 11:114576108-114576130 CCCTGTTCAACAAATGGTGCTGG + Intronic
1089162351 11:116448490-116448512 TAGTCTTCAACAAATGGTACTGG + Intergenic
1089719201 11:120396598-120396620 TCAGTTTCAACAAACGGTGCTGG + Intronic
1089799303 11:121011738-121011760 TAGTCTTCAACAAATGGTGCTGG + Intergenic
1090142649 11:124281167-124281189 TCCTTTTCAACAAATGGTGCTGG + Intergenic
1090559102 11:127910761-127910783 CCCGTTTCAACAAATGGTGCTGG - Intergenic
1091314752 11:134606278-134606300 GCGTTTTCAACAAATGGTGCTGG - Intergenic
1092110802 12:5962899-5962921 CATCTTTCAACAAATGGTGCTGG + Intronic
1092743977 12:11656077-11656099 TAGCATTCAATAAATGATGCCGG - Intronic
1092996331 12:13954277-13954299 CATGATTCAACAAAGGGTGCTGG + Intronic
1093262303 12:16953872-16953894 GATTTTTCAACAAATGGTGCTGG + Intergenic
1093681178 12:22005455-22005477 TCGTCTTCAATAAATGGTGCTGG - Intergenic
1093691017 12:22108914-22108936 CTGTATTCAACAAATGGTGCTGG + Intronic
1093948842 12:25140969-25140991 CCCGATTCAACAAATGGTGCTGG + Intronic
1093951976 12:25172860-25172882 TCCTTTTCAACAAATGGTGCTGG + Intronic
1094314622 12:29125119-29125141 TTTTTTTCAACAAATGGTGCTGG - Intergenic
1094591356 12:31824311-31824333 TCCTATTCAACAAATGGTGCTGG - Intergenic
1094775904 12:33727334-33727356 TCCTGTTCAGCAAATGGTGCTGG - Intergenic
1095400255 12:41806346-41806368 TCCCGTTCAATAAATGGTGCTGG - Intergenic
1095725641 12:45449103-45449125 CACTATTCAACAAATGGTGCTGG + Intergenic
1095733107 12:45526799-45526821 CACTTTTCAACAAATGGTGCTGG + Intergenic
1095743993 12:45636994-45637016 TGGTTTTCAACAGATGGTGCTGG + Intergenic
1095853605 12:46836981-46837003 CAGTCTTCAAGAAATGGTGCTGG - Intergenic
1095893378 12:47255926-47255948 CCCTGTTCAACAAATGGTGCTGG + Intergenic
1096735487 12:53650495-53650517 TAAACTTCAACAAATGGTTCTGG - Intronic
1099164076 12:79280408-79280430 TCCTATTCAACAAATGGTGCTGG + Intronic
1099248624 12:80224161-80224183 TCCTATTCAACAAATGGTGCTGG - Intronic
1099265909 12:80447633-80447655 TTCTGTTCAATAAATGGTGCTGG - Intronic
1099476758 12:83117160-83117182 CCCTGTTCAACAAATGGTGCTGG - Intronic
1099715565 12:86289140-86289162 TACTGTTCAATAAATGGTGCTGG - Intronic
1100344810 12:93717910-93717932 GTCCGTTCAACAAATGGTGCTGG - Intronic
1100413289 12:94345032-94345054 TAGTCTTCAAAAAATGGTGCTGG + Intronic
1100451326 12:94709661-94709683 TCTGTTTCAATAAATGGTGCTGG + Intergenic
1100938415 12:99696485-99696507 AGCGTTTCAACAAATGGTGCTGG + Intronic
1100946791 12:99793578-99793600 CAGTCTTCAATAAATGGTGCTGG + Intronic
1100970823 12:100068255-100068277 CACTTTTCAACAAATGGTGCTGG + Intronic
1101055301 12:100906344-100906366 GAGGGTTCAAAAAATTGTGGGGG + Intronic
1103116331 12:118336358-118336380 TCCTTTTCAACAAATGGTGCTGG + Intronic
1103729241 12:123015453-123015475 TAGTCTTTAAAAAATGGTGCTGG + Intronic
1105314989 13:19250040-19250062 CCGTATTCAACAAATGGTGCTGG + Intergenic
1105445792 13:20455995-20456017 TAGGGTTCAACAAATGGTGCTGG + Intronic
1105661517 13:22500853-22500875 TATAGTTCGACAAATGGAGCTGG - Intergenic
1107005839 13:35610437-35610459 TGGCATTCAACAAATGGTGCTGG + Intronic
1107131586 13:36902213-36902235 ATGTCTTCAACAAATGGTGCTGG - Intronic
1107379313 13:39838998-39839020 TAGTCTTCAATAAATGGTGCTGG + Intergenic
1107764296 13:43717299-43717321 TCCTGTTCAATAAATGGTGCTGG + Intronic
1107847361 13:44530302-44530324 CAGTCTTCAACAAATGGTGCTGG + Intronic
1107960933 13:45557664-45557686 TCTTATTCAACAAATGGTGCTGG - Intronic
1108644293 13:52410779-52410801 TAATGGTCAACTAATGGTGCTGG + Intergenic
1109047484 13:57432025-57432047 TGGGGATTAATAAATGGTGCTGG + Intergenic
1109346629 13:61122867-61122889 GACTTTTCAACAAATGGTGCTGG + Intergenic
1109568405 13:64151397-64151419 TAGTCTTCAATAAATGGTGTTGG - Intergenic
1109585749 13:64400870-64400892 TTTTTTTCAACAAATGGTGCTGG - Intergenic
1109608807 13:64735973-64735995 TCCTGTTCAATAAATGGTGCTGG - Intergenic
1110380717 13:74847377-74847399 TAGTCTTCAATAAATGATGCTGG + Intergenic
1110498377 13:76196274-76196296 CAGTATTCAATAAATGGTGCTGG + Intergenic
1111065944 13:83091399-83091421 TCCGATTCAATAAATGGTGCTGG - Intergenic
1111478318 13:88784400-88784422 TCCTGTTCAATAAATGGTGCTGG - Intergenic
1111851913 13:93586521-93586543 TCCTGTTCAAAAAATGGTGCTGG + Intronic
1113546939 13:111160087-111160109 CAGTCTTCAACATATGGTGCTGG - Intronic
1113761150 13:112847493-112847515 GAGTCTTCACCAAATGGTGCTGG - Intronic
1114907565 14:27149939-27149961 TACTCTTCAATAAATGGTGCTGG - Intergenic
1115350273 14:32386839-32386861 CCGTTTTCAACAAATGGTGCTGG - Intronic
1115708881 14:36028253-36028275 TAGGCTTCAACATATGGGGGTGG - Intergenic
1116109611 14:40560744-40560766 CCCTGTTCAACAAATGGTGCTGG - Intergenic
1116653253 14:47621199-47621221 TAGGGTTCAAGAATTTGTGAAGG - Intronic
1116784649 14:49274134-49274156 TTCTGTTCAATAAATGGTGCTGG - Intergenic
1117047463 14:51827809-51827831 TAGGCTTCAACAAATGGTGATGG + Intronic
1117768932 14:59112594-59112616 CCGTTTTCAACAAATGGTGCTGG + Intergenic
1118145957 14:63137097-63137119 ATGTTTTCAACAAATGGTGCTGG + Intergenic
1118361144 14:65057787-65057809 TAGACTTCAGTAAATGGTGCTGG - Intronic
1118537717 14:66787729-66787751 TAGACTTCAACAAATGGTGCTGG + Intronic
1118622356 14:67625115-67625137 TAGTCTTCAGTAAATGGTGCTGG + Intronic
1118934752 14:70277303-70277325 AATCCTTCAACAAATGGTGCTGG + Intergenic
1118958007 14:70500903-70500925 AAGGATTTAATAAATGGTGCTGG + Intergenic
1118969965 14:70627516-70627538 CAGTCTTCAACAAATGGTGATGG + Intergenic
1119057346 14:71436485-71436507 AATTGTTCAATAAATGGTGCTGG - Intronic
1119092083 14:71792814-71792836 TAGTCTTCAATAAATGGTACTGG - Intergenic
1119108724 14:71950330-71950352 AAGGATTTAATAAATGGTGCTGG + Intronic
1120087480 14:80290539-80290561 TACTCTTCAAGAAATGGTGCTGG - Intronic
1120288936 14:82541916-82541938 CACTTTTCAACAAATGGTGCTGG - Intergenic
1120582252 14:86267178-86267200 TCCTGTTTAACAAATGGTGCTGG + Intergenic
1121061897 14:90918749-90918771 TAGTTTTGAATAAATGGTGCTGG - Intronic
1121257497 14:92541562-92541584 CATCTTTCAACAAATGGTGCTGG + Intronic
1121460278 14:94070767-94070789 TTGTTTTCAACAAATGGTGCCGG + Intronic
1121588750 14:95082980-95083002 GAGGGTTCAACAAATGGTGCTGG + Intergenic
1121848073 14:97192005-97192027 CCCTGTTCAACAAATGGTGCTGG - Intergenic
1123099754 14:105789110-105789132 TCCTATTCAACAAATGGTGCTGG + Intergenic
1123554389 15:21412659-21412681 CATTATTCAACAAATGGTGCTGG + Intronic
1123686890 15:22804679-22804701 AAGTCTCCAACAAATGGTGCTGG - Intronic
1124398413 15:29326969-29326991 GATTTTTCAACAAATGGTGCTGG + Intronic
1124435213 15:29642919-29642941 TTCTTTTCAACAAATGGTGCTGG + Intergenic
1125443487 15:39728545-39728567 TCCTGTTCAATAAATGGTGCTGG + Intronic
1125495736 15:40191706-40191728 TAGTCTTCAACAAGTGGTGCTGG - Intronic
1125925690 15:43560960-43560982 TAGGGTTCATCCAATGATGAGGG - Intronic
1125938834 15:43660511-43660533 TAGGGTTCATCCAATGATGAGGG - Intronic
1126028587 15:44473721-44473743 GTGTCTTCAACAAATGGTGCTGG - Intronic
1126313722 15:47345463-47345485 TTTTTTTCAACAAATGGTGCTGG + Intronic
1126880229 15:53086581-53086603 AAGGACTCAATAAATGGTGCTGG - Intergenic
1127145715 15:56021239-56021261 TACTATTCAATAAATGGTGCTGG - Intergenic
1127202025 15:56664653-56664675 AAGGATTAAACAAATGTTGCAGG + Intronic
1127628958 15:60807833-60807855 CCCTGTTCAACAAATGGTGCTGG + Intronic
1127740909 15:61903887-61903909 GTGTCTTCAACAAATGGTGCTGG + Intronic
1129602212 15:77006679-77006701 CAGACTTCAACAAATGGCGCTGG - Intronic
1129632298 15:77274033-77274055 AACTATTCAACAAATGGTGCTGG + Intronic
1129954175 15:79619213-79619235 TTGTATTCAATAAATGGTGCTGG - Intergenic
1130181718 15:81636423-81636445 CACTCTTCAACAAATGGTGCTGG - Intergenic
1130571606 15:85050547-85050569 GTGTTTTCAACAAATGGTGCTGG - Intronic
1131295593 15:91146216-91146238 ATGGATTCAATAAATGGTGCTGG - Intronic
1131474243 15:92722774-92722796 CCCTGTTCAACAAATGGTGCTGG - Intronic
1131818609 15:96248387-96248409 GAGTGTTCAATAAATGGTGCTGG - Intergenic
1132256450 15:100380882-100380904 TAAAGTTCAACAAATGGTGCTGG - Intergenic
1132752101 16:1462822-1462844 GTGTTTTCAACAAATGGTGCTGG + Intronic
1133951624 16:10399420-10399442 TACTTTTCAATAAATGGTGCTGG - Intronic
1134295962 16:12946074-12946096 TACTATTCAATAAATGGTGCTGG - Intronic
1134407954 16:13978897-13978919 TACTTTTCAACAAATGGTGTTGG - Intergenic
1134568681 16:15273315-15273337 TAGGGCTCAGCCAATGCTGCTGG - Intergenic
1134733752 16:16483047-16483069 TAGGGCTCAGCCAATGCTGCTGG + Intergenic
1134933748 16:18229235-18229257 TAGGGCTCAGCCAATGCTGCTGG - Intergenic
1135167660 16:20154997-20155019 ATGCCTTCAACAAATGGTGCTGG - Intergenic
1136277922 16:29190425-29190447 TAGTCTTCAACAAACAGTGCCGG - Intergenic
1137337110 16:47560667-47560689 TAGTTTTCAACAAATAGTGCTGG + Intronic
1138035034 16:53595665-53595687 CACTATTCAACAAATGGTGCTGG - Intergenic
1138632072 16:58305069-58305091 TCCTATTCAACAAATGGTGCTGG - Intronic
1138756079 16:59487206-59487228 CTGTGTTCAATAAATGGTGCTGG - Intergenic
1138782082 16:59800824-59800846 TCCTATTCAACAAATGGTGCTGG + Intergenic
1138924318 16:61572220-61572242 TCCTTTTCAACAAATGGTGCTGG - Intergenic
1139183931 16:64781033-64781055 TAGGTTTTAACAAATTGTGATGG - Intergenic
1140454964 16:75099654-75099676 AGAGGTTCAACAAATGCTGCCGG - Intronic
1142082294 16:88156465-88156487 TAGTCTTCAACAAACAGTGCCGG - Intergenic
1142384581 16:89755136-89755158 GTGTTTTCAACAAATGGTGCTGG + Intronic
1142943506 17:3403879-3403901 TAGTCTTCCACAAATGGCGCTGG - Intergenic
1143127224 17:4650699-4650721 GAGGAATCAAGAAATGGTGCTGG - Intergenic
1143991698 17:10969275-10969297 AATGATTCAATAAATGGTGCTGG + Intergenic
1145232078 17:21180489-21180511 CAGTCTTCAACAAATGGTGCTGG - Intronic
1146114602 17:30123794-30123816 CAGTCTTCAACAAAAGGTGCTGG - Intronic
1146416836 17:32642164-32642186 CCCTGTTCAACAAATGGTGCTGG - Intronic
1147354177 17:39879756-39879778 GTCTGTTCAACAAATGGTGCTGG - Intergenic
1147912902 17:43867724-43867746 GACTTTTCAACAAATGGTGCTGG - Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148283593 17:46368622-46368644 TAGGGTTAAACAAGTGGCACTGG - Intergenic
1148305811 17:46586539-46586561 TAGGGTTAAACAAGTGGCACTGG - Intergenic
1148501537 17:48095259-48095281 TAGGGTTCAACAACTTGTTCAGG - Intronic
1149245834 17:54706658-54706680 ACTGGTTCAATAAATGGTGCTGG - Intergenic
1149820100 17:59768297-59768319 CAGTCTTCAACAAATGGTGCTGG + Intronic
1149853592 17:60057869-60057891 TACTTTTCAACAATTGGTGCTGG - Intronic
1150024286 17:61655762-61655784 AATAGTTCAACAAATGGTACTGG - Intergenic
1150312784 17:64142977-64142999 TCCTCTTCAACAAATGGTGCTGG + Intergenic
1150664389 17:67118263-67118285 GAGTTTTCAACAAATAGTGCTGG + Intronic
1150900014 17:69263462-69263484 CTGTGTTCAATAAATGGTGCTGG - Intronic
1151281713 17:73080392-73080414 TCCTATTCAACAAATGGTGCTGG + Intronic
1151779509 17:76234893-76234915 GTGGTTTCAACAAATGATGCTGG - Intronic
1152972876 18:181953-181975 TAGCCTTCAACAAATGATACTGG - Intronic
1153065855 18:1044266-1044288 CACTTTTCAACAAATGGTGCTGG + Intergenic
1153094766 18:1388214-1388236 TAGGATTAACCAAAGGGTGCTGG + Intergenic
1153206602 18:2710131-2710153 TAGTCTTTGACAAATGGTGCTGG - Intronic
1153450976 18:5228373-5228395 CCGTATTCAACAAATGGTGCTGG - Intergenic
1153548010 18:6229709-6229731 GAGTCTTCAACAAGTGGTGCTGG - Intronic
1153553997 18:6291606-6291628 TTCGCTTCAATAAATGGTGCTGG + Intronic
1153921587 18:9795148-9795170 TCCTATTCAACAAATGGTGCTGG + Intronic
1154397996 18:14009666-14009688 TACTGTTCAATAAATGGTGCTGG - Intergenic
1155416962 18:25608896-25608918 TAGTCTTCAACAAATGATGCTGG + Intergenic
1155976560 18:32138362-32138384 GTGTTTTCAACAAATGGTGCTGG - Intronic
1156856886 18:41792374-41792396 TAGGGTTTAGCACATGGAGCAGG - Intergenic
1158143879 18:54288451-54288473 TAGTCTTCAACAAATGATGCAGG - Intronic
1159694057 18:71530970-71530992 TCGTATTCAATAAATGGTGCTGG + Intergenic
1159878701 18:73837440-73837462 CAGTCTTCAACAAATGGTACTGG - Intergenic
1160009270 18:75091396-75091418 TGTTTTTCAACAAATGGTGCTGG - Intergenic
1160361641 18:78287503-78287525 GTGTTTTCAACAAATGGTGCTGG - Intergenic
1160485994 18:79293107-79293129 GTGTTTTCAACAAATGGTGCTGG + Intronic
1163056451 19:14723157-14723179 CAGTCTTCAACAAATGGTGCTGG - Intronic
1164962773 19:32449678-32449700 GTGTTTTCAACAAATGGTGCAGG + Intronic
1166630852 19:44405961-44405983 CCGTATTCAACAAATGGTGCTGG + Intergenic
1166910449 19:46151331-46151353 GATTTTTCAACAAATGGTGCTGG - Intronic
1167386143 19:49165282-49165304 TCGGGCTCAAAAAATGGAGCTGG - Intronic
1167397208 19:49238418-49238440 CACTATTCAACAAATGGTGCTGG - Intergenic
1167814687 19:51869507-51869529 TAGTGATCAACAAATGCTGAGGG + Intronic
1167880092 19:52450401-52450423 CAGTCTTCAATAAATGGTGCTGG - Intronic
925677361 2:6378147-6378169 TCCTATTCAACAAATGGTGCTGG + Intergenic
926560571 2:14412923-14412945 TCCTTTTCAACAAATGGTGCTGG + Intergenic
928799711 2:35072707-35072729 TTCTATTCAACAAATGGTGCTGG + Intergenic
929100439 2:38306920-38306942 GTGGCTTCAATAAATGGTGCTGG + Intronic
929633351 2:43489611-43489633 TAGCCTTCAACAAATGGTACGGG - Intronic
930159624 2:48141386-48141408 CACTATTCAACAAATGGTGCTGG - Intergenic
930474647 2:51865965-51865987 CCGTGTTCAACAAATGGTGCTGG - Intergenic
930539300 2:52684609-52684631 TGGTCTTCAATAAATGGTGCTGG + Intergenic
930573939 2:53122920-53122942 TCCTATTCAACAAATGGTGCCGG - Intergenic
930657959 2:54025484-54025506 TCCTATTCAACAAATGGTGCTGG + Intronic
931519127 2:63075968-63075990 TCTTTTTCAACAAATGGTGCTGG - Intergenic
931828899 2:66030148-66030170 CCCTGTTCAACAAATGGTGCTGG - Intergenic
932270770 2:70407423-70407445 TCCTTTTCAACAAATGGTGCTGG + Intergenic
932754763 2:74399623-74399645 TACCATTCAAAAAATGGTGCTGG + Intergenic
933080914 2:77984428-77984450 GTGTGTTCAATAAATGGTGCTGG + Intergenic
933120959 2:78537638-78537660 TTTTTTTCAACAAATGGTGCTGG + Intergenic
933231725 2:79815494-79815516 TTCTTTTCAACAAATGGTGCTGG - Intronic
933867232 2:86531699-86531721 CAGTTTTCAGCAAATGGTGCTGG - Intronic
934185729 2:89672784-89672806 TCATATTCAACAAATGGTGCTGG - Intergenic
934569072 2:95357285-95357307 TAGGGTTCCACAGAAGGTCCAGG - Intronic
934689121 2:96344746-96344768 TCGGCTTAAACAAATGGTACTGG + Intronic
935001094 2:99016403-99016425 TCTTATTCAACAAATGGTGCTGG + Intronic
935895186 2:107729091-107729113 GACAGTTCAACAAATGGTGCTGG + Intergenic
935928551 2:108097579-108097601 AAGTCTTCAACAAATGGTGCTGG + Intergenic
936590682 2:113800965-113800987 TCCGTTTTAACAAATGGTGCTGG - Intergenic
936910777 2:117590666-117590688 TCCTATTCAACAAATGGTGCGGG - Intergenic
936958059 2:118043212-118043234 CATTTTTCAACAAATGGTGCTGG - Intergenic
937559373 2:123202756-123202778 CAGTCTTCAATAAATGGTGCTGG - Intergenic
937793559 2:125989229-125989251 TCCTATTCAACAAATGGTGCTGG - Intergenic
939376174 2:141370878-141370900 CAGTTTTCAATAAATGGTGCTGG - Intronic
939770502 2:146309720-146309742 TAGGTTTCAACATATGATCCTGG + Intergenic
939806764 2:146783556-146783578 CCCTGTTCAACAAATGGTGCTGG - Intergenic
939822280 2:146971780-146971802 TCCTGTTCAATAAATGGTGCTGG - Intergenic
940218006 2:151320882-151320904 CACCATTCAACAAATGGTGCTGG + Intergenic
940519494 2:154725867-154725889 TTCTATTCAACAAATGGTGCTGG + Intronic
940625592 2:156171546-156171568 TTGTGTTCCATAAATGGTGCTGG - Intergenic
940762807 2:157756072-157756094 TCCTATTCAACAAATGGTGCTGG + Intronic
940886806 2:158997230-158997252 AAGGGTTAAACAAATAGTGAAGG + Intronic
941927540 2:170911214-170911236 TAGTCTTCAACAAATTGTGCTGG - Intergenic
942333395 2:174852861-174852883 AAGGATTCAATAAATAGTGCTGG + Intronic
942405762 2:175652812-175652834 TCCTATTCAACAAATGGTGCTGG + Intergenic
942623100 2:177869433-177869455 CAGGATTCAACAAATGTTGCTGG - Intronic
942806567 2:179937896-179937918 TTTTGTTCAATAAATGGTGCTGG - Intergenic
942842996 2:180386676-180386698 GACTTTTCAACAAATGGTGCTGG - Intergenic
943351411 2:186800948-186800970 TCCTATTCAACAAATGGTGCTGG - Intergenic
943875713 2:193065066-193065088 TCCTGTTCAATAAATGGTGCTGG - Intergenic
944020596 2:195098818-195098840 TAATCTTCAATAAATGGTGCTGG + Intergenic
944519544 2:200550594-200550616 TAGTGGTCAATAAATAGTGCGGG + Intronic
944602513 2:201318003-201318025 TCTTATTCAACAAATGGTGCTGG + Intronic
945388175 2:209229154-209229176 TCCTGTTCAATAAATGGTGCTGG - Intergenic
947809316 2:232991984-232992006 TTGCCTTCAACAAATAGTGCTGG + Intronic
948634322 2:239324999-239325021 TCCTCTTCAACAAATGGTGCTGG + Intronic
1169561627 20:6807516-6807538 GAGTTTTCAACAAATGGTACTGG + Intergenic
1170259732 20:14390649-14390671 CCATGTTCAACAAATGGTGCTGG + Intronic
1170520988 20:17185171-17185193 TTCTATTCAACAAATGGTGCTGG + Intergenic
1170563880 20:17582610-17582632 GTGTTTTCAACAAATGGTGCTGG + Intronic
1170992545 20:21316522-21316544 CAGTCTTCAACAAATGGTGTAGG - Intronic
1171315357 20:24186625-24186647 TCCTGTTCAATAAATGGTGCTGG - Intergenic
1173300958 20:41802528-41802550 TCCTATTCAACAAATGGTGCTGG - Intergenic
1173812030 20:45961942-45961964 TAGTGTGCAGCAAATGGGGCTGG + Intronic
1175292610 20:57887307-57887329 TCCTATTCAACAAATGGTGCTGG - Intergenic
1175791151 20:61740636-61740658 TACGGTTACGCAAATGGTGCTGG - Intronic
1176525505 21:7864037-7864059 CCCTGTTCAACAAATGGTGCTGG - Intergenic
1177291307 21:19116606-19116628 ATGTTTTCAACAAATGGTGCAGG - Intergenic
1177636124 21:23788919-23788941 TACAGTTCAACAAATGGTTTTGG - Intergenic
1177688316 21:24469028-24469050 TCAATTTCAACAAATGGTGCTGG + Intergenic
1177750044 21:25269946-25269968 CCCAGTTCAACAAATGGTGCTGG + Intergenic
1177813109 21:25945989-25946011 TCTTTTTCAACAAATGGTGCTGG + Intronic
1178659525 21:34494050-34494072 CCCTGTTCAACAAATGGTGCTGG - Intergenic
1178788632 21:35677410-35677432 TACGGGTAAACAAATGCTGCAGG - Intronic
1178968045 21:37143003-37143025 CACTATTCAACAAATGGTGCTGG + Intronic
1180072913 21:45446162-45446184 CAGCCTTCAACAAACGGTGCTGG - Intronic
1180977685 22:19858475-19858497 TAGTCTTCAACAAATCATGCTGG - Intergenic
1181794667 22:25297285-25297307 CCCTGTTCAACAAATGGTGCTGG - Intergenic
1182047271 22:27285050-27285072 GAGGATTCAACAAAAGGTGAGGG - Intergenic
1182980304 22:34664122-34664144 TATCATTTAACAAATGGTGCTGG + Intergenic
1185121104 22:48971171-48971193 CCTTGTTCAACAAATGGTGCTGG + Intergenic
1185321707 22:50203624-50203646 GACTTTTCAACAAATGGTGCTGG + Intronic
949119492 3:368827-368849 TCCTATTCAACAAATGGTGCTGG - Intronic
949189945 3:1239931-1239953 TCCTATTCAACAAATGGTGCTGG + Intronic
949229903 3:1738432-1738454 TCCCGTTCAATAAATGGTGCTGG - Intergenic
949899920 3:8803590-8803612 AGTTGTTCAACAAATGGTGCTGG + Intronic
951260275 3:20499466-20499488 CACTTTTCAACAAATGGTGCTGG - Intergenic
951302317 3:21013106-21013128 TCTTATTCAACAAATGGTGCTGG - Intergenic
951306885 3:21074698-21074720 TTTGGTTCAAAAAATAGTGCTGG - Intergenic
951766930 3:26210148-26210170 CCCTGTTCAACAAATGGTGCTGG - Intergenic
952026232 3:29086109-29086131 CCGTGTTCAATAAATGGTGCTGG - Intergenic
952192937 3:31042994-31043016 TTGGGTGCCACAAATGTTGCAGG - Intergenic
952243280 3:31557118-31557140 TAGTCTTCAATACATGGTGCTGG - Intronic
952303213 3:32122801-32122823 TAGGGTTAAACACATCATGCAGG + Intronic
952714535 3:36466131-36466153 TCCTATTCAACAAATGGTGCTGG - Intronic
952973106 3:38668321-38668343 GACTTTTCAACAAATGGTGCTGG - Intergenic
953185734 3:40636546-40636568 CCCTGTTCAACAAATGGTGCTGG + Intergenic
953914951 3:46912828-46912850 CAGTCTTCAACAAATGGTGCTGG - Intergenic
954485049 3:50840449-50840471 AAGTTTTCAACAAATGGTGCTGG - Intronic
955169969 3:56553946-56553968 TATCTTTCAACAAATGGTGCTGG - Intergenic
955283994 3:57621238-57621260 AACCTTTCAACAAATGGTGCTGG + Intergenic
955450389 3:59060082-59060104 TCCGATTCAACAAATGGTGCTGG - Intergenic
955526261 3:59823033-59823055 TCCTATTCAACAAATGGTGCTGG - Intronic
955831681 3:63011289-63011311 TCCTATTCAACAAATGGTGCTGG - Intergenic
956377005 3:68624274-68624296 TCCTATTCAACAAATGGTGCTGG - Intergenic
956419093 3:69066828-69066850 TAGTCTTCAACAAATCGTACTGG - Intronic
956548416 3:70433879-70433901 AGAGCTTCAACAAATGGTGCTGG - Intergenic
957418987 3:79944128-79944150 ACCGTTTCAACAAATGGTGCTGG + Intergenic
957428029 3:80065074-80065096 TCCTTTTCAACAAATGGTGCTGG + Intergenic
957722763 3:84025409-84025431 CTGCTTTCAACAAATGGTGCTGG - Intergenic
958176847 3:90006505-90006527 CTGGGTTCACCAAATGGTGCTGG + Intergenic
958772450 3:98442057-98442079 TGGCTTTCAACAAATGGTGCTGG - Intergenic
959009346 3:101056803-101056825 TCCTATTCAACAAATGGTGCTGG - Intergenic
959078179 3:101773147-101773169 TCTTTTTCAACAAATGGTGCTGG - Intergenic
959274923 3:104266512-104266534 TCCTTTTCAACAAATGGTGCTGG - Intergenic
959433716 3:106286767-106286789 CCGGATTCAATAAATGGTGCTGG + Intergenic
959745455 3:109771244-109771266 CCCTGTTCAACAAATGGTGCTGG + Intergenic
959844459 3:111017429-111017451 TACCATTTAACAAATGGTGCTGG + Intergenic
960296470 3:115951032-115951054 TCCTGTTCAACAAATGGTGCTGG + Intronic
960544517 3:118898016-118898038 CAGGCTTCAACAAATGTTACTGG + Intergenic
960711970 3:120539492-120539514 TCCTATTCAACAAATGGTGCTGG - Intergenic
961350503 3:126298699-126298721 CCCTGTTCAACAAATGGTGCTGG - Intergenic
961985595 3:131129681-131129703 GTCGTTTCAACAAATGGTGCTGG - Intronic
962035421 3:131646503-131646525 TAAGGTCCAACACATGTTGCAGG + Intronic
962062653 3:131946935-131946957 GACTCTTCAACAAATGGTGCTGG - Intronic
963634946 3:147782817-147782839 CCCTGTTCAACAAATGGTGCTGG - Intergenic
963687984 3:148462169-148462191 TGATCTTCAACAAATGGTGCTGG + Intergenic
963832913 3:150027818-150027840 CCCTGTTCAACAAATGGTGCTGG + Intronic
964055888 3:152456649-152456671 TTGGTTTCAACCAATCGTGCAGG + Intronic
964128801 3:153264914-153264936 AAGGATTTAATAAATGGTGCTGG + Intergenic
964224307 3:154379677-154379699 GACTTTTCAACAAATGGTGCTGG - Intronic
964264917 3:154884463-154884485 TACTCTTCAACAAATGATGCTGG + Intergenic
964930011 3:162007199-162007221 TAGCCTTCAGCAAATGCTGCTGG + Intergenic
965183228 3:165431476-165431498 TCCTATTCAACAAATGGTGCTGG - Intergenic
965200680 3:165654114-165654136 TCCTTTTCAACAAATGGTGCTGG - Intergenic
965227722 3:166010956-166010978 TCCTGTTCAATAAATGGTGCTGG - Intergenic
965269345 3:166592946-166592968 GATTCTTCAACAAATGGTGCTGG - Intergenic
965873984 3:173295010-173295032 TCCTATTCAACAAATGGTGCTGG - Intergenic
966020694 3:175205353-175205375 CTGTTTTCAACAAATGGTGCTGG + Intronic
966037694 3:175440119-175440141 CCGTATTCAACAAATGGTGCTGG - Intronic
966578254 3:181528279-181528301 CACTATTCAACAAATGGTGCTGG - Intergenic
966981443 3:185139737-185139759 AATCTTTCAACAAATGGTGCTGG + Intronic
966991741 3:185239019-185239041 TGCTGTTCAATAAATGGTGCTGG - Intronic
967376150 3:188803547-188803569 TAAATTACAACAAATGGTGCTGG - Intronic
967741176 3:193003966-193003988 TCCTTTTCAACAAATGGTGCTGG - Intergenic
968211480 3:196852384-196852406 GTGTTTTCAACAAATGGTGCTGG + Intergenic
968580336 4:1387675-1387697 ATGTTTTCAACAAATGGTGCTGG - Exonic
969096826 4:4739032-4739054 TCAGTTTCATCAAATGGTGCTGG + Intergenic
970411382 4:15811503-15811525 CACTTTTCAACAAATGGTGCAGG - Intronic
970818363 4:20184914-20184936 CTGAATTCAACAAATGGTGCTGG + Intergenic
971276295 4:25200665-25200687 TCCTTTTCAACAAATGGTGCTGG + Intronic
971807996 4:31385217-31385239 TAGGGTCCAACAATAGATGCTGG - Intergenic
971853486 4:32013650-32013672 AAGGATTCAGTAAATGGTGCTGG + Intergenic
972372832 4:38442110-38442132 TTTTTTTCAACAAATGGTGCTGG - Intergenic
972582734 4:40409217-40409239 TGGTCTTCAACAAATTGTGCTGG + Intergenic
972761428 4:42109002-42109024 TAGTCTTCAACAAATGGTACTGG - Intergenic
972827211 4:42772882-42772904 CCCTGTTCAACAAATGGTGCTGG + Intergenic
973022712 4:45223703-45223725 TCAGATTCAATAAATGGTGCTGG - Intergenic
973230317 4:47833305-47833327 ATGTCTTCAACAAATGGTGCTGG + Intronic
973904393 4:55512791-55512813 TAGTTTTCAACAAATGGTACCGG - Intronic
974008890 4:56588857-56588879 CCCTGTTCAACAAATGGTGCTGG - Intronic
974184263 4:58426217-58426239 CGCTGTTCAACAAATGGTGCTGG - Intergenic
974234645 4:59165673-59165695 TTCTGTTCAATAAATGGTGCTGG + Intergenic
974254130 4:59427909-59427931 ATGTCTTCAACAAATGGTGCTGG - Intergenic
974879904 4:67742285-67742307 TCCTATTCAACAAATGGTGCTGG - Intronic
974926631 4:68307072-68307094 TAGTCTCCAATAAATGGTGCTGG - Intergenic
976240563 4:82951880-82951902 TACTTTTCAACAAATGGTGCTGG + Intronic
976240817 4:82954774-82954796 TCTTTTTCAACAAATGGTGCTGG + Intronic
977484328 4:97623026-97623048 CCGTATTCAACAAATGGTGCTGG + Intronic
977717871 4:100203360-100203382 TGGTTTTTAACAAATGGTGCTGG - Intergenic
978033281 4:103962840-103962862 TAGTATTCAATAAATAGTGCTGG - Intergenic
978204718 4:106067726-106067748 GATTATTCAACAAATGGTGCTGG - Intronic
978549227 4:109906903-109906925 TCCTATTCAACAAATGGTGCTGG + Intergenic
978571816 4:110146245-110146267 TAATCTTCAATAAATGGTGCTGG + Intronic
978832089 4:113099879-113099901 GTGTTTTCAACAAATGGTGCTGG + Intronic
978969449 4:114785076-114785098 AAGCCTTCAACAAATGGTACTGG + Intergenic
979196726 4:117928231-117928253 TTCTGTTCAATAAATGGTGCTGG + Intergenic
979498004 4:121406592-121406614 TCCTTTTCAACAAATGGTGCTGG - Intergenic
979769920 4:124510675-124510697 TATCTTTCAACAAATGGTGCTGG + Intergenic
979875021 4:125878272-125878294 TACTGTTCAATAAATGGGGCTGG + Intergenic
980019607 4:127692819-127692841 TCCTATTCAACAAATGGTGCTGG - Intronic
980034438 4:127867360-127867382 AACCATTCAACAAATGGTGCTGG + Intergenic
980536624 4:134131971-134131993 TTCTGTTCATCAAATGGTGCTGG + Intergenic
980544340 4:134238621-134238643 TCCTATTCAACAAATGGTGCTGG - Intergenic
980572816 4:134643214-134643236 TCCTATTCAACAAATGGTGCTGG - Intergenic
980684383 4:136207275-136207297 TTTTGTTCAACAAATAGTGCAGG + Intergenic
980690162 4:136285546-136285568 GTGTTTTCAACAAATGGTGCTGG + Intergenic
980746898 4:137029819-137029841 TCCTGTTCAATAAATGGTGCTGG - Intergenic
980860843 4:138497785-138497807 TCCTATTCAACAAATGGTGCTGG - Intergenic
981300476 4:143180521-143180543 GTGTTTTCAACAAATGGTGCTGG - Intergenic
981442864 4:144802999-144803021 TCCTATTCAACAAATGGTGCTGG - Intergenic
981522962 4:145683653-145683675 TTCTTTTCAACAAATGGTGCTGG + Intronic
981613404 4:146620781-146620803 GAGAGTTTAATAAATGGTGCTGG + Intergenic
981680686 4:147394285-147394307 TCTTATTCAACAAATGGTGCTGG + Intergenic
981760353 4:148187953-148187975 GACATTTCAACAAATGGTGCTGG - Intronic
981880859 4:149610626-149610648 CAGTCTTCAATAAATGGTGCTGG + Intergenic
982084673 4:151822083-151822105 CATTATTCAACAAATGGTGCTGG - Intergenic
982451454 4:155557187-155557209 TCCTATTCAACAAATGGTGCTGG + Intergenic
982628597 4:157801935-157801957 CACTATTCAACAAATGGTGCAGG - Intergenic
982757027 4:159233386-159233408 GAGTCTTCAACAAATGGTGGTGG - Intronic
983429634 4:167632070-167632092 TCCTGTTCAATAAATGGTGCTGG + Intergenic
983887841 4:173000814-173000836 GTCTGTTCAACAAATGGTGCTGG + Intronic
984010337 4:174363555-174363577 TTCTTTTCAACAAATGGTGCTGG + Intergenic
984377523 4:178952111-178952133 TCTTCTTCAACAAATGGTGCTGG + Intergenic
985151483 4:186951655-186951677 TTCTGTCCAACAAATGGTGCTGG - Intergenic
985197258 4:187444551-187444573 TAGTGTTCACCAAATGGTTCTGG + Intergenic
985906063 5:2837792-2837814 TTTCTTTCAACAAATGGTGCTGG + Intergenic
986089105 5:4485800-4485822 AATCTTTCAACAAATGGTGCTGG + Intergenic
986498264 5:8369792-8369814 TAGGGTTCTACAAGTGGTAAAGG + Intergenic
986590938 5:9369574-9369596 TAGTCTTCAACAAGTGGTACTGG - Intronic
986893235 5:12334494-12334516 TACTATTCAACAAATGGTGCTGG - Intergenic
987176559 5:15317022-15317044 CCCTGTTCAACAAATGGTGCTGG + Intergenic
987909712 5:24125530-24125552 TTGTATTCAATAAATGGTGCTGG - Intronic
988091778 5:26551489-26551511 TAGTTTTCAATAAATGCTGCTGG + Intergenic
988204833 5:28120853-28120875 TTGTATTCAATAAATGGTGCTGG + Intergenic
988902632 5:35750111-35750133 CCCTGTTCAACAAATGGTGCTGG + Intronic
989412110 5:41132017-41132039 TTCTATTCAACAAATGGTGCTGG - Intergenic
989650960 5:43689625-43689647 CCCTGTTCAACAAATGGTGCTGG - Intronic
989689689 5:44126233-44126255 TCCTATTCAACAAATGGTGCTGG + Intergenic
991155222 5:63426554-63426576 TTCTATTCAACAAATGGTGCTGG - Intergenic
991466083 5:66913869-66913891 GCCTGTTCAACAAATGGTGCGGG - Intronic
992191867 5:74300429-74300451 TAGTCTTCAGCAAATAGTGCTGG + Intergenic
992593406 5:78320046-78320068 TAGGGTTAAACAAATTATTCTGG + Intergenic
993753221 5:91696225-91696247 CCCTGTTCAACAAATGGTGCTGG - Intergenic
993801500 5:92348696-92348718 TTCTGTTCAATAAATGGTGCTGG - Intergenic
993883487 5:93390340-93390362 CACTTTTCAACAAATGGTGCTGG - Intergenic
993917454 5:93760659-93760681 TCCTTTTCAACAAATGGTGCTGG + Intronic
994511963 5:100715464-100715486 CACTATTCAACAAATGGTGCTGG - Intergenic
994593389 5:101801067-101801089 TTGTTTTCAACGAATGGTGCTGG - Intergenic
994654431 5:102572532-102572554 CAGGCTTCAATAAATGGTGGTGG + Intergenic
994887715 5:105586239-105586261 TACTTTTCAACAAATTGTGCTGG + Intergenic
995095341 5:108229474-108229496 CCCTGTTCAACAAATGGTGCTGG + Intronic
995431358 5:112081936-112081958 AAGTTTTCAACAAATGGTGCTGG + Intergenic
995974357 5:118013687-118013709 TTTTTTTCAACAAATGGTGCTGG - Intergenic
996269776 5:121589292-121589314 CAGTCTTCAACAAATGGTACTGG + Intergenic
996288550 5:121824685-121824707 CTGTTTTCAACAAATGGTGCTGG - Intergenic
996325813 5:122271973-122271995 TCTTTTTCAACAAATGGTGCAGG + Intergenic
996456427 5:123688608-123688630 GAATGTTCAACAAATGATGCTGG + Intergenic
996616318 5:125445359-125445381 CCCTGTTCAACAAATGGTGCTGG + Intergenic
996651854 5:125887647-125887669 AATCTTTCAACAAATGGTGCTGG - Intergenic
996678739 5:126206955-126206977 CCCTGTTCAACAAATGGTGCTGG + Intergenic
996778911 5:127161597-127161619 TATTTTTCCACAAATGGTGCTGG - Intergenic
997340436 5:133140625-133140647 TAAGGTTTAACTAATGGTCCTGG + Intergenic
997709186 5:135989455-135989477 TTCAGTTCAATAAATGGTGCTGG - Intergenic
997797953 5:136829728-136829750 TCCTTTTCAACAAATGGTGCTGG - Intergenic
997876647 5:137554775-137554797 TCCTATTCAACAAATGGTGCTGG + Intronic
997901456 5:137769447-137769469 GAGTATTCAACAAATGGTGCTGG + Intergenic
998259547 5:140618730-140618752 TTTTTTTCAACAAATGGTGCTGG + Intergenic
998603535 5:143609652-143609674 CCGTTTTCAACAAATGGTGCTGG + Intergenic
998776928 5:145614052-145614074 TCCTTTTCAACAAATGGTGCTGG - Intronic
1000465133 5:161566519-161566541 CAGACTTCAACAAATGGTTCTGG + Intronic
1000482843 5:161801284-161801306 TAAGATTCACCAAATGGGGCTGG - Intergenic
1000497913 5:162009030-162009052 TACTATTCAATAAATGGTGCTGG - Intergenic
1000818615 5:165955861-165955883 TAGGATTCAACCCGTGGTGCTGG - Intergenic
1001351953 5:170976769-170976791 TAGTTTTCAACAAATGATGCTGG + Intronic
1001733320 5:173976699-173976721 TCCTATTCAACAAATGGTGCTGG - Intronic
1002610075 5:180411812-180411834 TAGCCTTCATCAAATGGTGATGG + Intergenic
1002880738 6:1250049-1250071 CACTATTCAACAAATGGTGCAGG - Intergenic
1003240565 6:4341951-4341973 GTGTTTTCAACAAATGGTGCTGG + Intergenic
1003929909 6:10914256-10914278 TCCTTTTCAACAAATGGTGCTGG - Intronic
1004963034 6:20813680-20813702 TATCTTTCAACAAATGGTGCTGG - Intronic
1005372461 6:25149626-25149648 CTGTATTCAACAAATGGTGCTGG + Intergenic
1005518760 6:26579696-26579718 CTGTGTTCAATAAATGGTGCTGG - Intergenic
1005625070 6:27654628-27654650 GACTTTTCAACAAATGGTGCTGG + Intergenic
1005792793 6:29323490-29323512 CCCTGTTCAACAAATGGTGCTGG - Intergenic
1005930417 6:30480053-30480075 GTGTTTTCAACAAATGGTGCTGG + Intergenic
1006420226 6:33928755-33928777 TAGACTTTAACAAATGGTGCTGG + Intergenic
1007891311 6:45295248-45295270 CACTTTTCAACAAATGGTGCTGG + Intronic
1008231887 6:48993020-48993042 CCCTGTTCAACAAATGGTGCTGG + Intergenic
1008735935 6:54544067-54544089 TCCTATTCAACAAATGGTGCTGG - Intergenic
1008788720 6:55202746-55202768 TAGGTTTCAACAAATGAAGCCGG + Intronic
1009783881 6:68305862-68305884 TTGTCTTCAATAAATGGTGCTGG + Intergenic
1010916056 6:81620591-81620613 CAGTCTTCAACAAATGGTGCAGG - Intronic
1011320756 6:86090184-86090206 AACTCTTCAACAAATGGTGCTGG - Intergenic
1011671669 6:89689306-89689328 TAGGTATAAACAAATGGTGTAGG + Intronic
1011832384 6:91389031-91389053 CCCGATTCAACAAATGGTGCTGG + Intergenic
1012794203 6:103739142-103739164 CCGTTTTCAACAAATGGTGCTGG + Intergenic
1013286256 6:108684797-108684819 TAGGGTTCAAGAAAGGGGGAGGG - Intergenic
1014226878 6:118859168-118859190 ATCTGTTCAACAAATGGTGCTGG + Intronic
1014516646 6:122387168-122387190 TGGGGTTCAAGAAAGGGTGTAGG - Intergenic
1015277241 6:131396449-131396471 TTTTTTTCAACAAATGGTGCCGG + Intergenic
1015314391 6:131801827-131801849 GAGTCTTCAACAATTGGTGCTGG + Intergenic
1015348239 6:132185047-132185069 CCCTGTTCAACAAATGGTGCTGG + Intergenic
1015643885 6:135365054-135365076 CCCTGTTCAACAAATGGTGCTGG - Intronic
1015794000 6:136992629-136992651 GAGCATTCACCAAATGGTGCTGG - Intergenic
1015807748 6:137128773-137128795 TGCTATTCAACAAATGGTGCTGG - Intergenic
1015809869 6:137151318-137151340 TAATTTTCAACAAATGGTGCTGG + Intronic
1015940111 6:138441194-138441216 TAGGGTTCAACCAAGCGGGCTGG + Intronic
1016103714 6:140135553-140135575 CAGTCTTCAACAAATGGTGTTGG + Intergenic
1016678216 6:146796621-146796643 CACTTTTCAACAAATGGTGCTGG + Intronic
1017280851 6:152623257-152623279 TACTATTCAATAAATGGTGCTGG + Intronic
1017408551 6:154145887-154145909 GTGTTTTCAACAAATGGTGCTGG + Intronic
1018053840 6:160035146-160035168 TGGGGGTCAACAGATGGGGCAGG - Intronic
1018353355 6:162986468-162986490 CCCTGTTCAACAAATGGTGCTGG + Intronic
1018597839 6:165502046-165502068 TCTTTTTCAACAAATGGTGCTGG + Intronic
1019754134 7:2756205-2756227 AAGTTTTCAACAAATGGTGCTGG + Intronic
1021080673 7:16360633-16360655 CACTCTTCAACAAATGGTGCCGG + Intronic
1021427888 7:20523615-20523637 CCCTGTTCAACAAATGGTGCTGG + Intergenic
1022223200 7:28334937-28334959 CAGTCTTCAATAAATGGTGCTGG - Intronic
1022396726 7:29994251-29994273 TGGGGGAAAACAAATGGTGCTGG - Intergenic
1023236058 7:38089238-38089260 TGTTCTTCAACAAATGGTGCTGG + Intergenic
1023693409 7:42818330-42818352 TCCATTTCAACAAATGGTGCTGG + Intergenic
1023701676 7:42898008-42898030 TCCTTTTCAACAAATGGTGCCGG + Intergenic
1024546233 7:50522658-50522680 TAGTATTCAACAAAAGGTGCTGG + Intronic
1025618139 7:63142278-63142300 TTCTTTTCAACAAATGGTGCTGG + Intergenic
1026106596 7:67425865-67425887 TTCTCTTCAACAAATGGTGCTGG - Intergenic
1026208944 7:68285612-68285634 TGGTCTTCAATAAATGGTGCTGG + Intergenic
1026670286 7:72384340-72384362 TTGATTTCAACAAATGCTGCTGG + Intronic
1027589763 7:80103188-80103210 TTCTTTTCAACAAATGGTGCTGG - Intergenic
1027650573 7:80862850-80862872 TCCTTTTCAACAAATGGTGCTGG + Intronic
1027900817 7:84112271-84112293 TTGGTTTCAGCATATGGTGCTGG - Intronic
1028008665 7:85612566-85612588 CACTATTCAACAAATGGTGCTGG + Intergenic
1028059016 7:86286236-86286258 ACCTGTTCAACAAATGGTGCTGG - Intergenic
1028123144 7:87080023-87080045 TAGACTTCAATAGATGGTGCTGG + Intergenic
1028313984 7:89376679-89376701 TCCTGTTCAACAAATGGGGCTGG - Intergenic
1028640277 7:93034673-93034695 CACTGTTCAAAAAATGGTGCTGG + Intergenic
1028870418 7:95765537-95765559 TATGTTTCAACAAATGATGATGG - Intergenic
1028949316 7:96616781-96616803 TACTATTCAATAAATGGTGCTGG - Intronic
1029265404 7:99335312-99335334 TAGTTTTCAACAAAAGGTGCAGG - Intronic
1031153927 7:118086684-118086706 TAGAGATCAACAAATAGTGGTGG - Intergenic
1031182338 7:118434152-118434174 AAGGATTCAATAAATGATGCAGG - Intergenic
1031189008 7:118522450-118522472 TAGTCTTCAACAAATTGTTCTGG + Intergenic
1031782144 7:125981686-125981708 TTCTATTCAACAAATGGTGCTGG - Intergenic
1031842118 7:126756164-126756186 ATGGGTTCAACAAATAGTGCTGG + Intronic
1031876605 7:127148845-127148867 GAGTCTTCAACAAATGGTGCAGG + Intronic
1031904926 7:127450088-127450110 CCCTGTTCAACAAATGGTGCTGG + Intergenic
1032160750 7:129508235-129508257 TCTTGTTCAACATATGGTGCTGG - Intronic
1032777868 7:135133679-135133701 GACTTTTCAACAAATGGTGCTGG + Intronic
1032920307 7:136538032-136538054 CACTCTTCAACAAATGGTGCTGG + Intergenic
1033886507 7:145954653-145954675 TTTTCTTCAACAAATGGTGCTGG - Intergenic
1036109381 8:5880445-5880467 CACTTTTCAACAAATGGTGCTGG + Intergenic
1036188419 8:6646513-6646535 TTCTTTTCAACAAATGGTGCTGG + Intergenic
1036837424 8:12085876-12085898 TAGTCTTCAACAAATGGTGCTGG + Intergenic
1036859216 8:12332120-12332142 TAGTCTTCAACAAATGGTGCTGG + Intergenic
1038225087 8:25648571-25648593 TCATGTTCAATAAATGGTGCTGG - Intergenic
1038237467 8:25773941-25773963 TCCGTTTCAACAAATGGTGCTGG + Intergenic
1038786736 8:30624245-30624267 CCCTGTTCAACAAATGGTGCTGG - Intronic
1040053607 8:43038709-43038731 CACTTTTCAACAAATGGTGCTGG - Intronic
1040474873 8:47766935-47766957 CAGTTTTCAATAAATGGTGCTGG + Intergenic
1040885428 8:52258011-52258033 TACTTTTCAACAAATGTTGCTGG - Intronic
1041229405 8:55733701-55733723 GTGTTTTCAACAAATGGTGCTGG + Intronic
1041339597 8:56829958-56829980 TAGTCCTCAACAAATGGTGCTGG + Intergenic
1041462494 8:58127134-58127156 GACTTTTCAACAAATGGTGCTGG - Intronic
1041523238 8:58777328-58777350 TCCTATTCAACAAATGGTGCTGG + Intergenic
1041768265 8:61443478-61443500 TAGTTTTCAACAAATGGTGCTGG - Intronic
1041892282 8:62882785-62882807 TAGTCTTCAACAAATGATCCTGG - Intronic
1042488624 8:69374409-69374431 GTCGTTTCAACAAATGGTGCTGG + Intergenic
1042897221 8:73684367-73684389 TCCTATTCAACAAATGGTGCTGG + Intronic
1043177257 8:77037447-77037469 CCGTATTCAACAAATGGTGCTGG + Intergenic
1043188452 8:77185596-77185618 TCCTATTCAACAAATGGTGCTGG + Intergenic
1043568428 8:81573182-81573204 TCCTTTTCAACAAATGGTGCTGG - Intergenic
1043569525 8:81587026-81587048 CCCTGTTCAACAAATGGTGCTGG - Intergenic
1044010399 8:86986746-86986768 TCCTGTTCAACATATGGTGCTGG - Intronic
1044219830 8:89656916-89656938 TACTCTTCAAAAAATGGTGCTGG + Intergenic
1044366802 8:91357517-91357539 TACTATTTAACAAATGGTGCTGG + Intronic
1045070318 8:98497206-98497228 TAATCTTCAACAAATGGTGTTGG + Intronic
1045605756 8:103772858-103772880 GTGTTTTCAACAAATGGTGCTGG + Intronic
1045725775 8:105171430-105171452 TAGTCTTCAACTAATGGTGCTGG - Intronic
1045881345 8:107044496-107044518 TACTTTTCAACAAATGGTGCTGG + Intergenic
1045882648 8:107059485-107059507 GAGGGCACAATAAATGGTGCTGG + Intergenic
1045922364 8:107546254-107546276 TCGTGTTTAATAAATGGTGCTGG + Intergenic
1046235750 8:111422192-111422214 CCGTTTTCAACAAATGGTGCTGG - Intergenic
1046417423 8:113936091-113936113 CCCGTTTCAACAAATGGTGCTGG + Intergenic
1046498034 8:115039741-115039763 TTTTTTTCAACAAATGGTGCAGG - Intergenic
1046653586 8:116868861-116868883 CATTTTTCAACAAATGGTGCTGG + Intronic
1047266387 8:123313474-123313496 TACTTTTTAACAAATGGTGCTGG - Intergenic
1047593138 8:126348382-126348404 CACTATTCAACAAATGGTGCTGG + Intergenic
1047835933 8:128691072-128691094 GCCGTTTCAACAAATGGTGCAGG - Intergenic
1048650653 8:136472634-136472656 AGGGGTACAACAAAGGGTGCCGG + Intergenic
1049111477 8:140647177-140647199 TTTTTTTCAACAAATGGTGCTGG + Intergenic
1049793878 8:144487280-144487302 AAGCCTTCAATAAATGGTGCTGG - Intronic
1049984371 9:934724-934746 GAGTGTTTAACAAATAGTGCCGG - Intronic
1050484322 9:6117288-6117310 TAGTCTTCAATAAATGGTGCTGG - Intergenic
1050698242 9:8303816-8303838 TAGTCTTCAACAAATGGTGCTGG - Intergenic
1050988157 9:12109307-12109329 TCCTGTTCAACAAAAGGTGCTGG + Intergenic
1051317222 9:15852809-15852831 TCCTTTTCAACAAATGGTGCTGG - Intronic
1051914318 9:22189883-22189905 TCCTGTTCAACAAATGGTGCTGG + Intergenic
1052142770 9:25007620-25007642 AAGAGTTCAACAAATGATGTAGG + Intergenic
1052416272 9:28182221-28182243 TCCTGTTCAATAAATGGTGCTGG + Intronic
1053108062 9:35430638-35430660 TAGTCTTCAATAAATGGTGCTGG + Intergenic
1055448461 9:76407350-76407372 GAGTGTTCAAGAAATGCTGCTGG - Intergenic
1055556513 9:77479256-77479278 TCCTGTTTAACAAATGGTGCTGG - Intronic
1055610269 9:78016015-78016037 TTTTTTTCAACAAATGGTGCTGG + Intronic
1056309812 9:85328916-85328938 TCCTGTTCAACAAATTGTGCTGG + Intergenic
1056360527 9:85853208-85853230 ACCTGTTCAACAAATGGTGCTGG + Intergenic
1056818560 9:89819739-89819761 TAGTTTTCAACAAATGGTGCTGG - Intergenic
1057296788 9:93850324-93850346 AATCTTTCAACAAATGGTGCTGG - Intergenic
1057636092 9:96769058-96769080 TAGTTTTCAACAGATGATGCTGG + Intronic
1058089901 9:100793610-100793632 GACTTTTCAACAAATGGTGCTGG - Intergenic
1058106482 9:100977399-100977421 TACTATTCAATAAATGGTGCTGG - Intergenic
1058177008 9:101747852-101747874 AAGGTTTCAACAGAAGGTGCAGG - Intergenic
1058264379 9:102879711-102879733 AATGATTCAACAAATGGTACTGG - Intergenic
1058616430 9:106833633-106833655 TGCTGTTCAATAAATGGTGCTGG + Intergenic
1059132441 9:111767424-111767446 TAGTCTTCAATAAATGGTGCTGG - Intronic
1059594969 9:115709929-115709951 TCCCATTCAACAAATGGTGCTGG - Intergenic
1059923348 9:119182077-119182099 AAGAATTCAACAAATGCTGCTGG + Intronic
1060596278 9:124851039-124851061 TAGGGTATAAGAAATGGGGCAGG + Intergenic
1186647367 X:11521391-11521413 CACTATTCAACAAATGGTGCTGG - Intronic
1186822918 X:13309874-13309896 TAGGTTTCCACAAAGAGTGCAGG + Intergenic
1187421900 X:19142447-19142469 TCTATTTCAACAAATGGTGCTGG + Intergenic
1187636425 X:21234064-21234086 TCCTTTTCAACAAATGGTGCTGG - Intergenic
1187760914 X:22583602-22583624 TCCTTTTCAACAAATGGTGCTGG - Intergenic
1188040059 X:25361470-25361492 TCCTTTTCAACAAATGGTGCTGG - Intergenic
1188045484 X:25421591-25421613 TGCTTTTCAACAAATGGTGCTGG - Intergenic
1188082605 X:25862058-25862080 CCCTGTTCAACAAATGGTGCTGG - Intergenic
1188233984 X:27703626-27703648 TTATTTTCAACAAATGGTGCTGG + Intronic
1188500418 X:30819767-30819789 TGCTATTCAACAAATGGTGCTGG - Intergenic
1188694310 X:33170905-33170927 GTGTTTTCAACAAATGGTGCTGG - Intronic
1188715461 X:33455044-33455066 TCCTGTTCAACAAATGATGCTGG + Intergenic
1189457336 X:41204550-41204572 TACTCTTCCACAAATGGTGCTGG - Intronic
1189574215 X:42333496-42333518 CAGTCTTCAACAAATGATGCTGG - Intergenic
1189806268 X:44738535-44738557 TATGGTTCAACAAATTGGGAGGG - Intergenic
1190231611 X:48586657-48586679 CAGTCTTCAATAAATGGTGCTGG - Intergenic
1190374060 X:49771705-49771727 CAGTCTTCAATAAATGGTGCTGG - Intergenic
1190704350 X:53014050-53014072 TTCTTTTCAACAAATGGTGCTGG + Intergenic
1190989674 X:55533756-55533778 CTGGGTTCAATAAATGGTGCCGG - Intergenic
1191148585 X:57195835-57195857 ATGCTTTCAACAAATGGTGCTGG - Intergenic
1191804144 X:65116281-65116303 TCCTATTCAACAAATGGTGCTGG - Intergenic
1191871975 X:65754022-65754044 TACTATTCAACAAATGGTGTTGG + Intergenic
1192070353 X:67933285-67933307 GAGTCTTCAATAAATGGTGCTGG + Intergenic
1192281304 X:69688985-69689007 CAGTCTTCAACAAATGGTGCTGG - Intronic
1192310300 X:70006985-70007007 TTTTTTTCAACAAATGGTGCTGG - Intronic
1192311451 X:70018592-70018614 TACTATTCAATAAATGGTGCTGG + Intronic
1192753668 X:74022304-74022326 TCCTGTTCAATAAATGGTGCTGG + Intergenic
1192813217 X:74567603-74567625 AACTTTTCAACAAATGGTGCTGG + Intergenic
1192901205 X:75499041-75499063 CCCGATTCAACAAATGGTGCTGG + Intronic
1193047971 X:77072458-77072480 TACTATTCAATAAATGGTGCTGG - Intergenic
1193069000 X:77287714-77287736 TCCTGTTCAACAAATGGTGCTGG + Intergenic
1193167358 X:78296131-78296153 CACTCTTCAACAAATGGTGCTGG - Intronic
1193173353 X:78362464-78362486 TACTATTCAATAAATGGTGCTGG + Intergenic
1193196760 X:78640810-78640832 AAGTCTTCAACAAATGGTACTGG - Intergenic
1193383031 X:80838855-80838877 TCCTATTCAACAAATGGTGCTGG + Intergenic
1193390757 X:80925905-80925927 TCCTATTCAACAAATGGTGCTGG + Intergenic
1193408392 X:81132603-81132625 CCGTGTTCAATAAATGGTGCTGG + Intronic
1193637109 X:83964885-83964907 TACTTTTCAATAAATGGTGCTGG + Intergenic
1193690786 X:84639753-84639775 TATTATTCAACAAATGGCGCTGG + Intergenic
1193938059 X:87646652-87646674 CTGTATTCAACAAATGGTGCTGG + Intronic
1193986473 X:88247294-88247316 TTCTTTTCAACAAATGGTGCTGG - Intergenic
1194225762 X:91255131-91255153 CTCTGTTCAACAAATGGTGCTGG - Intergenic
1194404138 X:93473460-93473482 TTCTGTTCAATAAATGGTGCTGG + Intergenic
1194454171 X:94081550-94081572 CCCTGTTCAACAAATGGTGCTGG - Intergenic
1194630645 X:96279025-96279047 CCCTGTTCAACAAATGGTGCTGG + Intergenic
1194989471 X:100530751-100530773 AAAGATTCAACAAATGGTGCTGG - Intergenic
1195253635 X:103072790-103072812 CAGTCTTCAACAAATGTTGCTGG + Intergenic
1195266631 X:103187377-103187399 TTCTTTTCAACAAATGGTGCTGG - Intergenic
1195300201 X:103522239-103522261 ATTGTTTCAACAAATGGTGCTGG + Intergenic
1195589305 X:106605654-106605676 TGGTCTTCAGCAAATGGTGCTGG + Intergenic
1195743896 X:108094856-108094878 CAGGGTTCAAAAACTGCTGCTGG + Intronic
1195780511 X:108458282-108458304 GTCTGTTCAACAAATGGTGCTGG - Intronic
1195785139 X:108511714-108511736 TATTCTTCAACAAATGGTGCTGG + Intronic
1195828999 X:109034914-109034936 TAGAATTTAATAAATGGTGCTGG + Intergenic
1195838643 X:109148182-109148204 TTCTATTCAACAAATGGTGCTGG + Intergenic
1196204844 X:112927749-112927771 TCTTATTCAACAAATGGTGCTGG + Intergenic
1196313291 X:114194457-114194479 AGTGTTTCAACAAATGGTGCCGG + Intergenic
1196465231 X:115965553-115965575 CACTTTTCAACAAATGGTGCTGG + Intergenic
1196477306 X:116103363-116103385 CACTATTCAACAAATGGTGCTGG - Intergenic
1196702985 X:118691979-118692001 TTCTTTTCAACAAATGGTGCAGG - Intergenic
1196716506 X:118816425-118816447 GTCTGTTCAACAAATGGTGCAGG - Intergenic
1197508364 X:127337637-127337659 GTTGTTTCAACAAATGGTGCTGG - Intergenic
1197570389 X:128143665-128143687 TACTATTCAATAAATGGTGCTGG + Intergenic
1197683794 X:129416288-129416310 GAGCATTCAATAAATGGTGCTGG + Intergenic
1197988347 X:132290889-132290911 TCCTGTTCAATAAATGGTGCTGG - Intergenic
1198313338 X:135441664-135441686 TTCTTTTCAACAAATGGTGCTGG + Intergenic
1198444874 X:136703000-136703022 TAGAAATCAACAAATGGTGCTGG + Intronic
1198759166 X:140012820-140012842 CAGTCTTCAATAAATGGTGCTGG - Intergenic
1198945906 X:142013536-142013558 GTGTTTTCAACAAATGGTGCTGG - Intergenic
1198987209 X:142468754-142468776 CCGTATTCAACAAATGGTGCTGG + Intergenic
1199300747 X:146211010-146211032 TAGCATTCAATAAATGGTGCTGG - Intergenic
1200336711 X:155358625-155358647 CCCGGTTCAATAAATGGTGCTGG + Intergenic
1200349759 X:155482602-155482624 CCCGGTTCAATAAATGGTGCTGG - Intergenic
1200946358 Y:8844025-8844047 AAGGATTTAATAAATGGTGCTGG + Intergenic