ID: 1105446937

View in Genome Browser
Species Human (GRCh38)
Location 13:20465692-20465714
Sequence AGGGCCAGGTCTTTGCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105446937_1105446942 6 Left 1105446937 13:20465692-20465714 CCTCTTGGCAAAGACCTGGCCCT 0: 1
1: 0
2: 3
3: 16
4: 173
Right 1105446942 13:20465721-20465743 TAGAGAGTTTACCAGAATGCTGG 0: 1
1: 0
2: 1
3: 15
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105446937 Original CRISPR AGGGCCAGGTCTTTGCCAAG AGG (reversed) Intronic
901207922 1:7507940-7507962 AGCCCCAGGGCTTTGCCACGTGG + Intronic
902859927 1:19237930-19237952 AGGGCCAGGTCTTAGCCATGGGG - Intronic
905407160 1:37741770-37741792 AAAGCCAAGTCTTTGTCAAGTGG + Intronic
907426765 1:54384655-54384677 AGGGCCAGCTCTCTGCCTTGGGG - Intronic
908488790 1:64622084-64622106 AGCACCAGGCCTTTTCCAAGTGG + Intronic
912717890 1:111994780-111994802 AAGGCCAGGGCTTTGCCTACCGG + Intergenic
913171035 1:116232434-116232456 GGGTGCAGGTCTATGCCAAGTGG + Intergenic
915609356 1:156978712-156978734 AGTGCCTGGTCTGTGCCATGTGG - Intronic
917510334 1:175664195-175664217 AGGTCCAGGTTTTTGCCCAGAGG - Intronic
918084853 1:181236947-181236969 AGGCCCAGGTCTTTCCACAGAGG + Intergenic
918311835 1:183290683-183290705 TGAGCCAGGCCTTTGTCAAGTGG + Intronic
918381828 1:183963703-183963725 ATGACAAGGTCTTTGCCATGTGG - Intronic
920351937 1:205343494-205343516 GGGGCCAGGTCTATGCCATCGGG - Exonic
921718752 1:218447716-218447738 AGGGCCAGGTTATGGGCAAGGGG - Intergenic
923087533 1:230712885-230712907 AGGGGCAGGTGCTGGCCAAGAGG - Intronic
924907848 1:248475302-248475324 AAGGTCAGGGCTGTGCCAAGGGG - Intergenic
924916261 1:248572780-248572802 ATGGTCAGGGCTGTGCCAAGGGG + Intergenic
1062986262 10:1772116-1772138 AGGGCCAGGTCTCAGTGAAGAGG + Intergenic
1063535280 10:6876899-6876921 AGGACCAGGTATCTGACAAGGGG - Intergenic
1065586357 10:27221726-27221748 AGAGCCAGGGTTTTGCCATGTGG - Intronic
1067165466 10:43863460-43863482 AGGCCCAGATCAGTGCCAAGCGG - Intergenic
1067689308 10:48491153-48491175 ACTGCGAGGCCTTTGCCAAGAGG - Intronic
1070975231 10:80601071-80601093 AGGGCCTTGTGTCTGCCAAGTGG - Intronic
1070975354 10:80602128-80602150 AGGGCCCTGTCTCAGCCAAGTGG - Intronic
1071189809 10:83085767-83085789 AGGTTAAAGTCTTTGCCAAGCGG - Intergenic
1072008908 10:91286555-91286577 AGGAGCAGGTCTTTGTGAAGAGG - Intergenic
1073163221 10:101419547-101419569 ACCGCCAGGTCTGTGCCATGGGG + Intronic
1073302309 10:102478476-102478498 ATTGCCAGGTCTTTGCCAAATGG - Intergenic
1073627778 10:105117481-105117503 AGTGCCAGGTCCTTGAGAAGAGG - Intronic
1073690107 10:105799078-105799100 AGGGGCAGGTCCTTGCCCTGAGG - Intergenic
1077094262 11:792678-792700 AGGGCCAGCTCTCGGCCCAGGGG - Exonic
1077145716 11:1043374-1043396 AGGGCCACGTCTGTGCCACCTGG - Intergenic
1078143731 11:8709358-8709380 TGGGCTGGGTCTCTGCCAAGGGG - Intronic
1078684422 11:13514941-13514963 ATGAGCAGGTATTTGCCAAGTGG - Intergenic
1080824155 11:35833758-35833780 AGGCCAAGCTCTGTGCCAAGAGG + Intergenic
1081547017 11:44078763-44078785 AGTACCTGGTATTTGCCAAGAGG + Exonic
1084401690 11:68947641-68947663 AGAGACAGGTTTTTGCCATGTGG + Intergenic
1085050770 11:73379082-73379104 AGTTCCAGTTCTTGGCCAAGTGG - Intronic
1085184816 11:74566587-74566609 AGGGCCTGGCCTTTGCCATCTGG - Intronic
1089125629 11:116174613-116174635 AGGACCAAGTCTTTACCCAGGGG - Intergenic
1090924779 11:131239847-131239869 AGGGGCAGGTTTTTCCCATGTGG + Intergenic
1091665355 12:2414909-2414931 AAGGCCAGTTCTTTTCCCAGGGG + Intronic
1096863367 12:54546389-54546411 AGGTCCAGGGCCTGGCCAAGGGG + Exonic
1098925261 12:76342269-76342291 AGGGCCAGGACTATGCCATGGGG + Intergenic
1099816398 12:87654310-87654332 AGGGCTAGGTCTGTGCCATCAGG - Intergenic
1102476606 12:113192698-113192720 ATGGCTAGGACTTTGCCAAGTGG + Intergenic
1102573851 12:113843802-113843824 AGGGCCTCGTCTTCTCCAAGAGG - Intronic
1104841803 12:131829187-131829209 AGGGCCAGGTCCTTGTCCAGTGG - Intronic
1105446937 13:20465692-20465714 AGGGCCAGGTCTTTGCCAAGAGG - Intronic
1115500175 14:34042653-34042675 AAGGGTAGGACTTTGCCAAGGGG + Intronic
1120209330 14:81619428-81619450 CGACTCAGGTCTTTGCCAAGTGG + Intergenic
1121495850 14:94390941-94390963 GGTGCCAGGTCTGTGCCAGGAGG - Intergenic
1121625330 14:95381352-95381374 TGGGCCAGGTCTTGTGCAAGGGG + Intergenic
1122632090 14:103111776-103111798 AGGGGCATGTCTTTTCCCAGGGG + Intergenic
1124516141 15:30368659-30368681 AGGGCAAGGTATTTGGGAAGGGG - Intronic
1124726779 15:32162072-32162094 AGGGCAAGGTATTTGGGAAGGGG + Intronic
1127752476 15:62060011-62060033 AGGGCCAGGGCTTGGCCTCGGGG + Intronic
1130994824 15:88897857-88897879 GGGGCCGGGGCTCTGCCAAGTGG - Intergenic
1131051042 15:89348116-89348138 AGGGCCAGGTATTTGCCAGGCGG - Intergenic
1131760585 15:95618393-95618415 AGGGCCACAGCATTGCCAAGTGG + Intergenic
1133065986 16:3207373-3207395 AGAGCCAGGTCTTTGACATCAGG + Intergenic
1133162376 16:3920565-3920587 ACGGCCGGGTCTTTGGCCAGTGG - Intergenic
1133768729 16:8855451-8855473 AGGGGCAGTTCTTTGGAAAGAGG - Intronic
1134441296 16:14301289-14301311 GAGGCCAGATCTTTGCCAGGTGG + Intergenic
1136091490 16:27923353-27923375 AGGGACAGGACTTTGACAAAAGG - Intronic
1139309931 16:66019630-66019652 GGGGGCAGGTCTTTCCCATGTGG + Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139851962 16:69956058-69956080 AGAGGCAGGTTTTTGCCATGTGG - Intronic
1141425041 16:83939410-83939432 AAGGCCAGGTGTTTGCAAAGAGG + Intronic
1141736811 16:85859630-85859652 AGGAGCAGGGCTTGGCCAAGGGG - Intergenic
1148615438 17:48997160-48997182 GGGGCCAGGTTCTTGCAAAGGGG + Intergenic
1153939707 18:9967592-9967614 TGGGCCAGGTCTCTGGCAACTGG + Intergenic
1154324497 18:13380175-13380197 AGGGTCAGGGCTTGGCCCAGGGG - Intronic
1156484548 18:37456566-37456588 AGGGCCACATCTTTCCCAAAAGG + Intronic
1157775221 18:50389261-50389283 AGAGCCAGGTATTTTTCAAGTGG - Intronic
1159089595 18:63832904-63832926 AGGGCAATCTCTTTCCCAAGTGG + Intergenic
1160546171 18:79657419-79657441 AGGGCGAGGTCTGGGCCAGGAGG - Intergenic
1160841335 19:1148151-1148173 AGGTCCAGGTCTCTGCCCAGTGG + Intronic
1163669307 19:18618107-18618129 ACCACCAGGTCTTTGCTAAGAGG - Intronic
1164044756 19:21527293-21527315 AGGGGCAATGCTTTGCCAAGTGG + Intronic
1164302187 19:23972230-23972252 GGGGCCAGGGCCTTGCCATGGGG - Intergenic
1164778042 19:30869618-30869640 AAGGGCAGGACTTTGCCCAGAGG - Intergenic
1165595630 19:37009607-37009629 AGCCCCAGGACTTTGGCAAGCGG + Intronic
1167427978 19:49439367-49439389 AGAGCCAGGTCTTGGGCAGGGGG - Intronic
928004620 2:27553106-27553128 AGCCCCAGGACTTTGCCAGGTGG + Intronic
928256845 2:29730113-29730135 AATGGCAGGTCCTTGCCAAGGGG - Intronic
928387760 2:30884478-30884500 AGGGCCAGGCCTGTGCCCAAAGG - Intergenic
933624369 2:84582229-84582251 AGAGCCAGGTCTTTACAAAAAGG + Intronic
936286057 2:111182274-111182296 AGGGTTGGGACTTTGCCAAGGGG - Intergenic
939166615 2:138647426-138647448 TTGGCCTGGACTTTGCCAAGGGG + Intergenic
939390396 2:141561546-141561568 ATGGCCAGGTCATTGTAAAGAGG - Intronic
940115727 2:150206062-150206084 AAGGCCATGTTTTTGCCATGAGG + Intergenic
942128224 2:172848573-172848595 AGGGGATGGTCTTTGCTAAGGGG + Intronic
942869110 2:180713568-180713590 GGGGGCAGGTCTTTCCCATGCGG + Intergenic
946148637 2:217749323-217749345 AGGGCCAGGCCTTTGCCCTGTGG - Intronic
946802681 2:223437067-223437089 ACAGCCGGATCTTTGCCAAGAGG + Intergenic
947768006 2:232649738-232649760 GGGGCCAAGTCTCTCCCAAGAGG + Intronic
948016101 2:234692081-234692103 AGAGACAGGGCTTTGCCATGTGG - Intergenic
948440094 2:237981202-237981224 AGGGCCACTGCTTTGCCCAGAGG + Intronic
1169045313 20:2530258-2530280 TGGTCCAGGTTTTTCCCAAGAGG + Intergenic
1170783593 20:19448811-19448833 GGGGCCAGGACTGTGCTAAGTGG - Intronic
1171938760 20:31303450-31303472 ATGGCCATGTCTTTCCCAGGTGG - Exonic
1172107000 20:32522878-32522900 AGGGCCAGGTCCCTACCATGAGG + Intronic
1172848737 20:37945259-37945281 AGGCCGAGGGCTTTGCCTAGGGG + Exonic
1174104214 20:48150726-48150748 AGGGCCAGGTCTGGGTCACGTGG - Intergenic
1174369983 20:50079963-50079985 AGGGCCAGGTTCTTCCCAACAGG - Intergenic
1175222207 20:57423725-57423747 TGGGGCAGGTCTTTGCCCTGGGG + Intergenic
1176096287 20:63345932-63345954 AGGGCCAGGGCTCTGGCAGGTGG - Exonic
1177404980 21:20654901-20654923 AGGTTCAGGTCTTAGCAAAGTGG - Intergenic
1179341001 21:40509401-40509423 ACGGCTAGATCCTTGCCAAGTGG + Intronic
1179960447 21:44764621-44764643 AGGGCCAGGTCCCTACCAGGCGG - Intergenic
1180904664 22:19400992-19401014 AGGACCAGGTGGTTGGCAAGTGG - Intronic
1182037015 22:27206851-27206873 AGACCCAGGTGTTTTCCAAGAGG - Intergenic
1182325659 22:29510917-29510939 AGTGCCAGGTCTGAGCCAAGAGG - Intronic
1182774320 22:32819627-32819649 AAGGGCAGATCTATGCCAAGAGG - Intronic
1184729937 22:46366494-46366516 AGGGGCTGGTCACTGCCAAGTGG + Intronic
949561361 3:5205663-5205685 GGGCTCAGTTCTTTGCCAAGGGG + Intronic
949851029 3:8420675-8420697 AGCGCCAGATCTGTGCCAAGTGG + Intergenic
950459990 3:13115454-13115476 AGCACCAGGACTTTGCTAAGAGG - Intergenic
950631530 3:14285186-14285208 GTGGCCAGGGCTTTGCCAGGGGG + Intergenic
950884150 3:16348173-16348195 AGGAGCAGGGCTTTGCTAAGAGG + Intronic
952306602 3:32152477-32152499 AGGGCACGGTCTGTTCCAAGTGG + Intronic
952636304 3:35536947-35536969 ATGGCCAGCTCCTTGCAAAGAGG + Intergenic
953664071 3:44913457-44913479 ATGGCCAGGACTTTTCAAAGAGG + Intronic
954377353 3:50202171-50202193 GGGGCCAGGCCTTAGCCACGAGG + Intergenic
954630901 3:52047191-52047213 AGGGCCAGGTCATGGCTGAGAGG - Intergenic
955314519 3:57925138-57925160 AGGGACAGGGTTTTGCCATGTGG + Intronic
955953622 3:64266648-64266670 AGGCCCAGATCTTCCCCAAGTGG + Intronic
966201142 3:177360222-177360244 AGAGCCAGGCCTTTCCCTAGTGG + Intergenic
966299634 3:178463418-178463440 AAGGCCAAGTCTCAGCCAAGTGG + Intronic
967124875 3:186414315-186414337 AGGGCCAGGTGCATGCCTAGTGG + Intergenic
967336535 3:188350640-188350662 AGTGCCAGGATTTTGCTAAGTGG - Intronic
970525915 4:16931989-16932011 AGAGCCTGGATTTTGCCAAGGGG - Intergenic
972580549 4:40392026-40392048 GTGGCCAAGTCTTTGCAAAGAGG - Intergenic
974357099 4:60826442-60826464 AGGGCAGAGTCATTGCCAAGAGG + Intergenic
978824190 4:113001143-113001165 AGAGCCAGGGTTTTGCCAATTGG - Intronic
980678781 4:136126977-136126999 AGGGGCAGGTTTTTCCCATGCGG + Intergenic
985218855 4:187681639-187681661 AGGGTCAGGTCTTTGACATGTGG - Intergenic
985787219 5:1903315-1903337 AGGGACAGGTCCTTGGCAAGTGG + Intergenic
988980922 5:36568404-36568426 AGTGGCAGGTGTTTGCCAACAGG - Intergenic
989404777 5:41048289-41048311 GGGGCCAGGTCTTTACCCAGGGG - Intronic
995689074 5:114803249-114803271 CTGCTCAGGTCTTTGCCAAGGGG + Intergenic
999259924 5:150231979-150232001 AGGGCCAGGTCTCAGCAAATGGG - Intronic
999529653 5:152448762-152448784 ATCTCCAGGTCTTTGGCAAGGGG - Intergenic
1005328049 6:24721044-24721066 AGGGACAGGTCTTTTAAAAGTGG + Intergenic
1006595509 6:35190369-35190391 AGGACCAGGTACTTCCCAAGAGG - Intergenic
1006956554 6:37878525-37878547 AGGGGCAGGGCTATGCCAAGCGG - Intronic
1006967262 6:38000604-38000626 GGGGGCAGGTCTTTCCCAGGCGG - Intronic
1009591049 6:65671745-65671767 AAGGGCAGGGCTTTGGCAAGTGG - Intronic
1011583033 6:88892795-88892817 ATTGCCAGGTCTTTGCCAGAAGG - Intronic
1015733065 6:136367827-136367849 ATGCCCAGGTCTTTTCCCAGGGG + Intronic
1015924575 6:138296123-138296145 TGGGCTACTTCTTTGCCAAGAGG - Intronic
1021934369 7:25615284-25615306 AGGGCCAGGGCTGGGCAAAGGGG + Intergenic
1023740641 7:43277988-43278010 AGGGCCAGGTCTGAGCCCAGGGG - Intronic
1023931473 7:44708908-44708930 GGGGCCAGGCCATGGCCAAGGGG + Exonic
1025993822 7:66515477-66515499 AGGGCCTGCTCTATGCCAGGAGG + Intergenic
1026034600 7:66821960-66821982 AGGGCCTGCTCTATGCCAGGAGG - Intergenic
1026927568 7:74204567-74204589 AGGGCCAGCTCTTAACCAAAGGG + Intronic
1026985027 7:74549470-74549492 AGGGCCTGCTCTGTGCCAGGAGG + Intronic
1029287569 7:99476427-99476449 ACGGCCTGGTCTTTTGCAAGGGG - Exonic
1029535639 7:101155674-101155696 AGTGCCAGGCCTATGCCCAGGGG - Intronic
1030606272 7:111642219-111642241 TGGGCCACCTCTTGGCCAAGGGG + Intergenic
1030661994 7:112229865-112229887 AGGCAGAGGTCTTTGCCAGGTGG + Intronic
1034107681 7:148504489-148504511 CGGGTCAGGTTTTTGCCATGAGG + Intergenic
1037051272 8:14377331-14377353 AGGGCAAGGTATGTGGCAAGGGG - Intronic
1037474705 8:19245551-19245573 ATAGCCAAGTCTTTGCCAATAGG + Intergenic
1038110611 8:24492880-24492902 AGGGCCAAGACTTTGCTCAGTGG + Intronic
1039919071 8:41880588-41880610 AGGGCCAGTTCTTTGCAGGGGGG + Intronic
1041982306 8:63876416-63876438 AGGTCCAGGACTTGGACAAGGGG - Intergenic
1042027376 8:64438514-64438536 AGGGACAGGTGTTTGCGAAAGGG - Intergenic
1042549121 8:69977785-69977807 TGGGCCAGGTCTTTCCTAAAGGG + Intergenic
1045869174 8:106905868-106905890 AGAGACAGGTTTTTGCCATGTGG - Intergenic
1049246851 8:141567437-141567459 TGGCACAGGTCTTGGCCAAGGGG - Intergenic
1049558125 8:143293780-143293802 AGGGCTGGGCCTCTGCCAAGGGG + Intronic
1049867631 8:144949212-144949234 TGGGCCAGTTCTTCCCCAAGGGG - Intronic
1051638797 9:19205158-19205180 AGGGCCAGGGCTGGGCCCAGTGG - Intergenic
1052837489 9:33262758-33262780 TGGGCCAGGTCTTGGACAACTGG + Exonic
1052866704 9:33468473-33468495 AGGGCCAGGTCTATGCCAGGAGG - Intronic
1053428915 9:38028963-38028985 AGGGCCAGGGCATGGACAAGTGG + Intronic
1055256449 9:74377152-74377174 TGGACCATTTCTTTGCCAAGGGG - Intergenic
1055942571 9:81664364-81664386 AGGAAGAGTTCTTTGCCAAGAGG + Intronic
1056063624 9:82910513-82910535 GGGGCCAGGGCTGTGCAAAGAGG - Intergenic
1059400612 9:114067886-114067908 AGTGCCATTTCTTTGCCAGGTGG - Intronic
1061241808 9:129378765-129378787 AGGGGCTGCTCTTTGCCTAGAGG + Intergenic
1061495159 9:130969550-130969572 AGAGACAGGTTTTTGCCATGTGG - Intergenic
1186571981 X:10724571-10724593 AGGGCAAGATCTTTCCCAACCGG + Intronic
1187410173 X:19044331-19044353 AGGGCCAGGTCTTTCTCAGGTGG + Intronic
1189520656 X:41763738-41763760 ATGACCAGGAGTTTGCCAAGTGG - Intronic
1192259458 X:69495814-69495836 AGGGCAAGGCCTTGGCCAAAAGG - Intergenic
1199811512 X:151354510-151354532 GGAGCCAGGTATTTGCTAAGGGG - Intergenic
1200008885 X:153106973-153106995 AGAGCCTGGCCTTTGCCTAGGGG - Intergenic
1200030715 X:153292949-153292971 AGAGCCTGGCCTTTGCCTAGGGG + Intergenic
1201492758 Y:14560421-14560443 ATGGCAATGTGTTTGCCAAGGGG + Intronic