ID: 1105447202

View in Genome Browser
Species Human (GRCh38)
Location 13:20467953-20467975
Sequence TAAGTGTGAGGTTCACAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105447202 Original CRISPR TAAGTGTGAGGTTCACAACA GGG (reversed) Intronic
900836251 1:5006639-5006661 TACGTGCGCAGTTCACAACAGGG + Intergenic
905300938 1:36985827-36985849 CAAGTGTGATGTGCACAGCAGGG - Intronic
907481127 1:54746223-54746245 TGTGTGTGCAGTTCACAACAGGG - Intergenic
907921465 1:58917728-58917750 GAAGTGTGAAATTCACAACGAGG + Intergenic
911257583 1:95649603-95649625 TAACTGTGAGTTTAACAATAGGG - Intergenic
913565867 1:120071378-120071400 ATTGTGTGAAGTTCACAACAGGG - Intergenic
913632264 1:120722175-120722197 ATTGTGTGAAGTTCACAACAGGG + Intergenic
914286455 1:146230747-146230769 ATTGTGTGAAGTTCACAACAGGG - Intergenic
914547486 1:148681489-148681511 ATTGTGTGAAGTTCACAACAGGG - Intergenic
914619027 1:149388869-149388891 ATTGTGTGAAGTTCACAACAGGG + Intergenic
1065928726 10:30459511-30459533 TAAGTGTGCGGCACACAGCAGGG - Intronic
1066324906 10:34349032-34349054 AGACTGTGAGGTTCACCACAAGG + Intronic
1067361218 10:45581104-45581126 TAAGTCTGTGGTTCTCAACAGGG + Intronic
1068849147 10:61716272-61716294 TAAATGTGAGGGTTGCAACAGGG + Intronic
1069989787 10:72308172-72308194 TAAGTGTGAGCTACAGCACATGG - Intergenic
1070319087 10:75341114-75341136 TAACTGTAACCTTCACAACATGG - Intergenic
1070540107 10:77409589-77409611 CAGGTGTGAGGGTCACGACAAGG + Intronic
1071259863 10:83909893-83909915 TCTGTGTGAGGTTCAGAACTAGG + Intergenic
1071776247 10:88791604-88791626 TAGGTGTGAGTTGCACAGCATGG - Intergenic
1072892371 10:99335336-99335358 AGAGTGTGAGGTTTACAAAAGGG + Intronic
1079075490 11:17383058-17383080 TAAGTGTCACATTCACCACAGGG - Intergenic
1080768234 11:35316654-35316676 TAAGTGAGAGCTGCAGAACAAGG + Intronic
1081462248 11:43282697-43282719 TAAGTTTGAGATTCACAGCCTGG + Intergenic
1084984882 11:72860079-72860101 TACATGTGAAGTTCACAATAGGG + Intronic
1086370616 11:86152099-86152121 TAAGTTTGAGGTTAACCTCAGGG - Intergenic
1087981638 11:104621168-104621190 TCAGTGTGAGGTGCAGAACCAGG + Intergenic
1088390540 11:109309674-109309696 TAGGTGTGATGTTGACATCATGG - Intergenic
1092141084 12:6183787-6183809 TAACTGTGATGATTACAACAAGG - Intergenic
1095207281 12:39453128-39453150 TAAATGTGATGTTAACAATAGGG + Intergenic
1097924868 12:65116371-65116393 TACATGTGCAGTTCACAACAGGG - Intronic
1098134789 12:67390582-67390604 TAAGTGTGAGGATTTCAATATGG + Intergenic
1104417573 12:128607881-128607903 TAAGTGTGAGATTCATACCCAGG + Intronic
1105419603 13:20240483-20240505 TATGTGTGAGGCTGACAAAAAGG + Intergenic
1105447202 13:20467953-20467975 TAAGTGTGAGGTTCACAACAGGG - Intronic
1111425898 13:88081884-88081906 AAAGTGTCAAGTGCACAACAGGG + Intergenic
1112141686 13:96650716-96650738 TGAGTGTGAAGTTCACACAATGG + Intronic
1115776055 14:36716505-36716527 TATATTTGAGGTTTACAACATGG - Intronic
1116249118 14:42458130-42458152 TCAGTGTGAAGTGCACAACCAGG - Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1127656434 15:61060494-61060516 TGACCGTGAGGTTCACAGCAGGG + Intronic
1131583637 15:93670544-93670566 GCAGTGTGAGGTTCACATCGGGG + Intergenic
1135757815 16:25112397-25112419 TGAGTTTCAGGTGCACAACAGGG - Intronic
1138019645 16:53466587-53466609 TATGTGTGCAGTTCACAATAGGG + Intronic
1138404612 16:56779849-56779871 TACATCTGAGGTTCACTACAGGG - Intronic
1138478757 16:57287663-57287685 TAAGGGTGAGATTGGCAACACGG + Intergenic
1139722278 16:68866010-68866032 TAAGAGGGTAGTTCACAACAGGG - Intronic
1140136628 16:72211471-72211493 TAAATGTGAGATTCTAAACAGGG - Intergenic
1142808715 17:2385364-2385386 TCAGTGTGAGCTTCACATCCAGG + Exonic
1147641373 17:42003107-42003129 GCAGTGTGAGGTTAAAAACATGG - Intronic
1150366360 17:64589628-64589650 TGTGTGTGCGGTTCACAATAGGG - Intronic
1151263641 17:72936839-72936861 CACGTGTGCCGTTCACAACAGGG + Intronic
1152907929 17:82980042-82980064 TTAGTGTGAGGTTTAAATCAAGG - Intronic
1152931977 17:83114609-83114631 TATGTGTGTGATTCACAACAGGG + Intergenic
1154263197 18:12855778-12855800 TAAGTTGGAGCTTCACAAAATGG + Intronic
1155589992 18:27416464-27416486 TAAGTATGATGTTCACTGCAGGG - Intergenic
1156363811 18:36407457-36407479 TGAGTGTGAGGGTCATAACAAGG - Intronic
1159348520 18:67238948-67238970 TATATGTGAGGCTTACAACATGG + Intergenic
1159557281 18:69958551-69958573 GATGTGTGAGGTTCACTTCAGGG - Intronic
1165605780 19:37102402-37102424 CAACTGTGAGGTTCACTACCAGG + Intronic
1167889036 19:52525382-52525404 CAAGTTTGAGTTTTACAACATGG - Intergenic
1167894289 19:52568831-52568853 CAAGTGTGAGTTTTACAGCATGG - Intronic
1167898324 19:52599839-52599861 CAAGTGTGAGTTTTACAACATGG - Intronic
1167909768 19:52691984-52692006 CAAGTGTGAGTTTCACAACATGG + Intergenic
1167915586 19:52737464-52737486 CAAGTGTGAGTTTTACAACATGG + Intergenic
1167926183 19:52822767-52822789 CAAGTGTGAGTTTTACAACATGG + Intronic
1167930490 19:52859390-52859412 CAAGTGTGAGTTTTACGACATGG + Intergenic
1167938375 19:52925729-52925751 CAAGTGTGAGTTTTACAACATGG + Intergenic
1167994787 19:53393659-53393681 CAAGTGTGAGTTTTACAACATGG - Intronic
1168003278 19:53466260-53466282 CAAGTGTGAGTTTTACAACATGG - Intergenic
927200301 2:20574067-20574089 GAAGTGTCATGTTCACAGCAGGG + Intronic
928520723 2:32085807-32085829 GAGGTGGGAGGATCACAACAAGG + Intronic
928800558 2:35085410-35085432 AAAATGTTAGGTTCACAATAAGG + Intergenic
929016447 2:37501905-37501927 AAAGTGTGAGGCTAACACCAGGG - Intergenic
935452671 2:103228146-103228168 TAAATGTAAGGTGTACAACATGG - Intergenic
937611722 2:123869626-123869648 TAAGTGAGAAGATCAAAACATGG - Intergenic
939593953 2:144101975-144101997 TAAGTGTGAGGTACTAATCAAGG - Intronic
941638921 2:167966724-167966746 GAGGTGTGAGATTCACAACTGGG - Intronic
942610554 2:177738033-177738055 TAAGTGTGAGGTAATCACCAGGG - Intronic
943502234 2:188706398-188706420 TATGTGTGCAGTTCACAATAGGG - Intergenic
944512803 2:200481375-200481397 CAAGTTTGAGGTTCAAATCAAGG - Exonic
945751254 2:213786474-213786496 AAACTGTGAGGTTAAAAACATGG + Intronic
946522610 2:220482928-220482950 TAATTGTGAGGTTATCATCATGG - Intergenic
946952135 2:224887679-224887701 TATGCTTGAGGTTTACAACATGG + Intronic
1170523663 20:17214996-17215018 TAAATCTGAAGTTCACAAGATGG - Intergenic
1174166303 20:48585988-48586010 TAACTGTGTGGTTCAAAGCATGG - Intergenic
1175728689 20:61337016-61337038 TCACTGTGAGGTTCACAGCAAGG + Intronic
1177290558 21:19105742-19105764 TAAGTGTGAGGTTAAAAAAGAGG + Intergenic
1177618256 21:23554398-23554420 GAAGTGTGAAGTTCAAATCAAGG - Intergenic
1183734892 22:39638887-39638909 TGAGTGTGAAGTTCACAATAGGG + Intronic
949104256 3:184330-184352 AAAGTCTGAGGTTCACAAAATGG + Intergenic
956145069 3:66183883-66183905 TAAGTGTCAGGTTCAAATTAAGG - Intronic
958053594 3:88381594-88381616 TAAGTGAGTGGTTCTCAAGAGGG + Intergenic
958133321 3:89457441-89457463 CGTGTGTGCGGTTCACAACAGGG - Intronic
958271828 3:91509253-91509275 GAAGAGTGAGGTTTACATCAGGG - Intergenic
962685086 3:137839938-137839960 TGAGTGTGCAGTTCACAATAGGG + Intergenic
965708837 3:171536397-171536419 TGAGTGTGCAGTTAACAACAGGG + Intergenic
965731856 3:171780197-171780219 TAAGTCTGAGATTCAGAACTGGG + Intronic
966373099 3:179268739-179268761 TAACTGTCAAGTTCACAACGTGG + Intergenic
970780797 4:19735233-19735255 TAAGTCTGAGAATTACAACAGGG - Intergenic
974128436 4:57723965-57723987 TAAGTGAGAGGCTCAGATCAGGG - Intergenic
975543918 4:75542246-75542268 GTATTGTGAGGTTCTCAACAAGG - Intronic
976644565 4:87373966-87373988 CAATGGTGAGGTTCACAATAAGG + Intronic
976768617 4:88625763-88625785 TAAGTGTGATGTTAACAGTAGGG + Intronic
978476043 4:109131687-109131709 GGAGTGTGACGTTCACAAAAAGG + Intronic
978980668 4:114941060-114941082 GAAGAGGGAGGTTCCCAACAGGG - Intronic
980974600 4:139598710-139598732 CACGTGTGTGGTTCACAATAGGG - Intronic
985119202 4:186622958-186622980 TCAGTGTGAGCTGCACACCAGGG + Intronic
988527686 5:32001004-32001026 TGCGTGTGCGGTTCACAATAGGG - Intronic
989597467 5:43170356-43170378 TAAGCGTGAGGCTCACATCTAGG + Intronic
993332764 5:86620136-86620158 AAAGTTTGAGTTTCCCAACATGG - Exonic
994181307 5:96769482-96769504 TATATTTGAGGTTTACAACATGG + Intronic
994242000 5:97434013-97434035 TATATTTGAGGTTTACAACATGG - Intergenic
994339483 5:98609564-98609586 TCAGTGTGAGGTTGACAAGTTGG + Intergenic
995689539 5:114809009-114809031 TAAGTGGGAGTTTAACTACATGG - Intergenic
999925234 5:156368708-156368730 CATGTGTGCAGTTCACAACAGGG - Intronic
1000467551 5:161598734-161598756 TATATTTGAGGTTTACAACATGG - Intronic
1002465524 5:179406409-179406431 TAAGTGGGGGGTTACCAACAGGG - Intergenic
1003516144 6:6820778-6820800 TGATTGTGTGGTTCACAGCAGGG + Intergenic
1008983287 6:57511881-57511903 GAAGAGTGAGGTTTACATCAGGG + Intronic
1009171344 6:60404748-60404770 GAAGAGTGAGGTTTACATCAGGG + Intergenic
1010024983 6:71204611-71204633 TAAGTGTAAGGTGAACAAGATGG + Intergenic
1012144370 6:95663330-95663352 TGAGTGGGAGGTTGAAAACAGGG - Intergenic
1012723090 6:102772912-102772934 TCAGTGTGTGGTTCACATGATGG + Intergenic
1014350785 6:120342586-120342608 TCACTGTGCTGTTCACAACAGGG - Intergenic
1017524345 6:155229645-155229667 TAAGTGTGAAACTCACACCAAGG - Intronic
1018554287 6:165034227-165034249 GACGTGAGAGGTTCAAAACAGGG + Intergenic
1021917987 7:25454926-25454948 TAAGGCTGTGGTTCACAACTAGG - Intergenic
1022426348 7:30272263-30272285 TAAGGGAGTGGTTCACAACCTGG - Intergenic
1022539205 7:31120902-31120924 TGAGTGTCAGGTTCCAAACAGGG - Intergenic
1023806100 7:43874156-43874178 TAAGGCTGAGGTTCAAAACCAGG + Intronic
1024126647 7:46304844-46304866 TTTGTGTGAGGTTAAAAACATGG - Intergenic
1024921154 7:54556319-54556341 TAACAGTCAGGTTCACATCATGG - Intronic
1027494727 7:78873442-78873464 TACATGTGGGGTTCACAACAGGG - Intronic
1028108261 7:86906115-86906137 TAATTGTTAGGTTCACAATATGG + Intronic
1028924152 7:96339594-96339616 CATGTGTGTGGTTCACAATAGGG - Intergenic
1029180051 7:98693852-98693874 CAAGTGTGCAGTTCACAATAGGG - Intergenic
1030537557 7:110788256-110788278 TGGGTTTGAGCTTCACAACAAGG + Intronic
1030781291 7:113603505-113603527 TAAGTGGGAGTTGAACAACAAGG + Intergenic
1031950722 7:127889120-127889142 TAAGAATGAGGTCCTCAACAGGG - Intronic
1032964718 7:137082786-137082808 TAAGTGTCAAGTTCACCACCTGG - Intergenic
1033065276 7:138147504-138147526 TGAATGTGCAGTTCACAACAGGG + Intergenic
1033717669 7:144019543-144019565 TACATGTGAGTTACACAACAGGG + Intergenic
1035059222 7:156056754-156056776 TAAGTGTGAGTCTCAGCACAGGG - Intergenic
1036105547 8:5834162-5834184 GAAGTGAGAGCTTCACTACATGG + Intergenic
1039339645 8:36633484-36633506 TCAGTGTGAAGCTAACAACATGG - Intergenic
1041727250 8:61029812-61029834 AAAATGGGAGGTACACAACAAGG + Intergenic
1042560380 8:70069415-70069437 AAAGTGTCAGGTCCACAACACGG + Exonic
1044012717 8:87014771-87014793 TAAGTGTTAGGTTTAAAACAAGG + Intronic
1044365154 8:91336405-91336427 CACGTGTGAAGTTCACAACAGGG - Intronic
1045906339 8:107349727-107349749 TAGGTTAGAGGTTAACAACATGG - Intronic
1046053885 8:109056838-109056860 TAAGTGTTACGTTCACAAATGGG + Intergenic
1051399450 9:16663936-16663958 TAAATGTGTGGTCCAAAACAAGG + Intronic
1052250538 9:26392486-26392508 TAAGTGTGATTTTTACAATACGG + Intergenic
1053258572 9:36640944-36640966 CAAGTGTGATGTTCAAAACAAGG + Intronic
1059576125 9:115490648-115490670 TGAGTGTGAGGGTTAGAACAAGG - Intergenic
1185638717 X:1573986-1574008 TATGTCTGAGGATTACAACAAGG + Intergenic
1186608560 X:11115958-11115980 TAGGTGAGTGGTTCAGAACATGG + Intronic
1186655723 X:11609771-11609793 GAAGTGTCTGGTTCATAACAGGG + Intronic
1186754358 X:12654565-12654587 TATGTGTCAGATTCACAAAATGG - Intronic
1188823451 X:34801864-34801886 CAAATGTGAAGTTCTCAACAAGG + Intergenic
1193099226 X:77589621-77589643 TATATTTGAGGTTTACAACATGG - Intronic
1195699401 X:107691188-107691210 GAAGTTTCAGGTTCACAGCAAGG + Intergenic
1196930640 X:120678246-120678268 TAAGTTTAAGGTGTACAACATGG + Intergenic
1197899206 X:131351484-131351506 TAAGTGTGAGGTTAAAGTCAAGG - Intronic
1199928827 X:152497085-152497107 TAAGTTTGAGGTTCACATTAAGG - Intergenic
1200184620 X:154174251-154174273 TAAGTGTGATTTTCACAAAAGGG + Intergenic
1200190273 X:154211389-154211411 TAAGTGTGATTTTCACAAAAGGG + Intergenic
1200196024 X:154249191-154249213 TAAGTGTGATTTTCACAAAAGGG + Intergenic
1200201679 X:154286309-154286331 TAAGTGTGATTTTCACAAAAGGG + Intronic
1200751024 Y:6944174-6944196 TGAGTCTGAGGCTCAAAACAAGG - Intronic
1201398652 Y:13577916-13577938 TGTGTGTGTAGTTCACAACAGGG - Intergenic
1201428456 Y:13880835-13880857 TAATTGTGAGGTTCATAAGGAGG + Intergenic