ID: 1105454251

View in Genome Browser
Species Human (GRCh38)
Location 13:20525806-20525828
Sequence GGACGCGGCGCCGCGGGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 9, 3: 58, 4: 487}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105454234_1105454251 26 Left 1105454234 13:20525757-20525779 CCAACGATCACCACGCAGCCGGC 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG 0: 1
1: 0
2: 9
3: 58
4: 487
1105454246_1105454251 -8 Left 1105454246 13:20525791-20525813 CCATGGTTGGGCCGGGGACGCGG 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG 0: 1
1: 0
2: 9
3: 58
4: 487
1105454232_1105454251 30 Left 1105454232 13:20525753-20525775 CCTGCCAACGATCACCACGCAGC 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG 0: 1
1: 0
2: 9
3: 58
4: 487
1105454241_1105454251 4 Left 1105454241 13:20525779-20525801 CCGCGGAGGACGCCATGGTTGGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG 0: 1
1: 0
2: 9
3: 58
4: 487
1105454237_1105454251 16 Left 1105454237 13:20525767-20525789 CCACGCAGCCGGCCGCGGAGGAC 0: 1
1: 1
2: 0
3: 6
4: 104
Right 1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG 0: 1
1: 0
2: 9
3: 58
4: 487
1105454239_1105454251 8 Left 1105454239 13:20525775-20525797 CCGGCCGCGGAGGACGCCATGGT 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG 0: 1
1: 0
2: 9
3: 58
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105454251 Original CRISPR GGACGCGGCGCCGCGGGCGC TGG Exonic
900096067 1:940569-940591 GGACGCGGCGCCTTAGACGCGGG + Intronic
900100653 1:960757-960779 GGCGGCGGCGCCTCGGGCCCGGG - Exonic
900135630 1:1115853-1115875 GGAGGCGGCGACGAGGACGCGGG + Intronic
900171918 1:1273524-1273546 GGCCGGGGCCCCGCGGGCGGCGG + Intronic
900283912 1:1890496-1890518 GGCCGGGGCCCCGGGGGCGCGGG - Intronic
900307853 1:2019689-2019711 GGACGCGGCGACCCCCGCGCTGG + Intronic
900382498 1:2391813-2391835 GGAGGCGGCGCCGCGGAGGACGG + Exonic
900513204 1:3069871-3069893 CCACCCGGCTCCGCGGGCGCAGG + Intronic
901109562 1:6784708-6784730 GGACGCGGCGCCGAGGGGGCGGG + Intergenic
901109820 1:6785601-6785623 GGGGGCGGCGCGGCGGGCGGCGG + Intronic
901109964 1:6785946-6785968 GGACCCAGCGCCGGGGGTGCGGG - Intronic
901272289 1:7961753-7961775 GGCCGGGGCGCCGCGTCCGCAGG + Intronic
901361305 1:8703222-8703244 GGGCACCGCGGCGCGGGCGCAGG + Intronic
901489417 1:9589092-9589114 GGCCGGGGCGGCGCGGGGGCGGG - Intronic
901791337 1:11654963-11654985 GGAGGGGGCGCGGGGGGCGCTGG + Intronic
902067466 1:13700212-13700234 GGCGGCGCGGCCGCGGGCGCCGG + Intronic
902409996 1:16206911-16206933 GGACCCGGCGGGGCGGGGGCGGG - Intronic
902793384 1:18784417-18784439 GGGCTCGGCGCCGCGGCCGACGG + Intergenic
902916701 1:19644143-19644165 GGAGGGGGCGCCGCGGCGGCAGG - Intronic
903016786 1:20366680-20366702 GGTCGCGGCGCGGCGTCCGCGGG - Intergenic
903263301 1:22142752-22142774 CGGCGCGGGGCAGCGGGCGCGGG - Intronic
903349828 1:22710938-22710960 GGCCGCGGCGCCGCGGGGCCCGG - Intronic
903724662 1:25431385-25431407 GGGCAGGGCGCGGCGGGCGCTGG + Intronic
903883730 1:26529665-26529687 GAATGCCGCGCCGCGGGGGCTGG + Intergenic
904190307 1:28737721-28737743 GGACGCGGGGCGGTGGGGGCGGG + Intronic
904215400 1:28914781-28914803 GGCGGCGGCGGCGCGGGAGCCGG + Intronic
904940762 1:34164054-34164076 GGCAGCGGCGGCGCGGGCGGCGG - Intronic
905137104 1:35808279-35808301 CGCCGCGGAGACGCGGGCGCTGG - Exonic
905414220 1:37793784-37793806 AGAGGCGGCGCGGCGGGGGCGGG - Exonic
905684803 1:39900995-39901017 GGACAGGGGGCGGCGGGCGCCGG + Exonic
905862645 1:41361513-41361535 GGCGGCGGCGGCGCGGGCTCCGG + Intergenic
905995874 1:42380528-42380550 GGACGTGGCGCTGCGGGCTGGGG - Intergenic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
906525247 1:46489848-46489870 GGAGGCGGCGGCGCGGGCCGGGG + Intergenic
906556562 1:46718864-46718886 GGACACGGTGCCGCGGGCGACGG + Exonic
906961314 1:50420986-50421008 GGAGGCGGAGCAGCTGGCGCAGG - Exonic
907278087 1:53327950-53327972 AGACGCGGCGGCGGCGGCGCGGG - Exonic
907341544 1:53739185-53739207 GGACGCGGCGGCGGCGGCGGCGG - Intergenic
910221474 1:84893173-84893195 GGACGCGTCGCAGGGGTCGCTGG - Intronic
910963354 1:92784735-92784757 GGCCGAGGCGCGGCGGGCGGGGG - Intronic
910963394 1:92784885-92784907 AGACGCGGCGGCGCGGCTGCCGG - Intronic
910981303 1:92961762-92961784 GGAGGGGGCGCCGCGGCAGCGGG + Intergenic
911133825 1:94418426-94418448 GGACGCGGCGGCGGCGGCGGCGG - Intergenic
912401559 1:109397750-109397772 GGCAGCGGCGCAGCGGGCGGCGG + Exonic
912576365 1:110675326-110675348 CGCCGCGGCCCCGCGGGCGCCGG + Intergenic
912993487 1:114511115-114511137 GGCGGCGGCGACGCGGGCGGCGG - Exonic
913519502 1:119631718-119631740 GGAAGCGGCCCGGCGGGCGGCGG + Intronic
914703024 1:150150616-150150638 GGACGGGGCGGCGGGGGCGCAGG + Intronic
914869097 1:151458721-151458743 GGAGTGGGCGGCGCGGGCGCGGG - Intronic
914869121 1:151458817-151458839 GCGCGCGCCGCGGCGGGCGCCGG + Intronic
914937523 1:151993755-151993777 GGCCGAGGCGCGGCGGACGCTGG + Exonic
915165676 1:153946576-153946598 GTCCCCGGCGCCGCGGGAGCTGG - Exonic
916651770 1:166839902-166839924 GGGCGCGGCGGCGGTGGCGCAGG + Intronic
920171529 1:204074929-204074951 GGACGCCTCGGCGCTGGCGCTGG + Intronic
920418414 1:205813469-205813491 CGACGCGGCGCAGCGGGCCCGGG - Intronic
922440657 1:225653055-225653077 GGCGGCGGCGCGGCGAGCGCGGG - Exonic
922851157 1:228735308-228735330 CGCGGCGGCGCCTCGGGCGCGGG + Exonic
923126530 1:231039415-231039437 GGACGCGCGGCCTGGGGCGCCGG + Intronic
924763117 1:247007621-247007643 AGACGCGGCGCTGCGGGCGCGGG + Intronic
924778405 1:247126827-247126849 AGCCGCGGGGCTGCGGGCGCGGG - Intronic
924783253 1:247171593-247171615 AGCCGCGGGGCTGCGGGCGCGGG + Intronic
924801420 1:247331712-247331734 GGAGGCGGCGCCGCGGAGGCCGG + Exonic
1062843779 10:689671-689693 GGAGGCGGCGGCGCGGGCGCGGG + Intronic
1063636465 10:7787733-7787755 GGACGCGGGGCTGAGGGCGCGGG - Intronic
1064712318 10:18140400-18140422 GGGATCGGAGCCGCGGGCGCCGG - Intergenic
1065099919 10:22321928-22321950 GGTCCCGGCGCCGCGGGAGTCGG - Intronic
1065100380 10:22325599-22325621 GGGCGGCGCGCCGCGGGGGCGGG - Intronic
1066022769 10:31319572-31319594 GGATGCGGCGGCGTCGGCGCCGG - Intronic
1068544937 10:58334929-58334951 GGGCGCGGCGGGGAGGGCGCAGG + Intergenic
1068955567 10:62816744-62816766 GGAGGCGGAGCCGCCGGCACCGG - Intronic
1069486646 10:68827896-68827918 GGAAGCCGCGCGGCGGCCGCAGG - Exonic
1069486733 10:68828232-68828254 GGAAGCCGCGCGGCGGCCGCAGG - Intronic
1069761758 10:70816129-70816151 GGAGGGGCCGCCGCGGGCTCCGG + Intronic
1070032617 10:72692200-72692222 GGCGGCGGCGGCGGGGGCGCCGG + Exonic
1070162249 10:73873758-73873780 GGGCTCGGCGCCGCGGGTGGGGG + Intronic
1070768402 10:79069216-79069238 GGACGCGCCGCCGCCACCGCCGG - Exonic
1071579489 10:86756587-86756609 GGAGGGGGCGGCGCGGGTGCGGG - Intergenic
1071966588 10:90858087-90858109 GGACGCGGCGCGGCTGCCGCAGG - Intergenic
1072021727 10:91409878-91409900 GGACTCGGCGCCGCAGGCCAGGG + Intergenic
1074843227 10:117375258-117375280 GAAAGCGGCGCTGTGGGCGCGGG - Exonic
1075334487 10:121598451-121598473 GGCGGCGGCGGCGCGGGCGGCGG - Intronic
1075999825 10:126905684-126905706 CGGGGCGGCGGCGCGGGCGCGGG - Intronic
1076149255 10:128149797-128149819 GGCCGCTGCGCAGGGGGCGCGGG - Intergenic
1077008522 11:369989-370011 GGGGGCGGCGCGGGGGGCGCGGG + Intronic
1077194444 11:1272285-1272307 GGCCGGGGCGCCGCGGGTGCCGG - Intergenic
1077253753 11:1571806-1571828 GGGCGCCGCGTCGGGGGCGCTGG - Intronic
1077285535 11:1763732-1763754 GGTCGCGGCGCCGAGGTCCCGGG - Intronic
1078168482 11:8910978-8911000 GGAGGCGGGGCGCCGGGCGCTGG - Intergenic
1078771741 11:14358547-14358569 GGGCGCGGCGTCGCGGGAGTAGG - Intronic
1079035143 11:17014274-17014296 GGACGCGGGGACGCGGGTGGGGG - Intronic
1079090445 11:17476771-17476793 GGGCATGGCGGCGCGGGCGCGGG + Exonic
1080406875 11:31987512-31987534 GGACTCGGCGCGCGGGGCGCGGG - Intronic
1080406908 11:31987583-31987605 GGGCGCGGGGCTGGGGGCGCTGG + Intronic
1080458462 11:32435033-32435055 CGGCGCGGCGCAGTGGGCGCCGG - Exonic
1080551505 11:33376701-33376723 CGACGCGGGGGCGCGGGGGCCGG + Intergenic
1081969187 11:47186414-47186436 GGAGGCCGCGGCGCGGGCCCAGG - Intronic
1082003684 11:47408489-47408511 GCACGCGGCGCCTCGGGTTCCGG + Intronic
1082789261 11:57335837-57335859 GGACGCGGGGCCGCGCACGCGGG - Exonic
1083457134 11:62786808-62786830 GGCCGCGGAGCCGTGGGTGCAGG - Exonic
1083554463 11:63614549-63614571 AGAGGCGGTGCCGGGGGCGCGGG - Intronic
1083658316 11:64240957-64240979 GGCAGCGGCGTCGCGGGGGCGGG + Intergenic
1083672355 11:64306306-64306328 GGACGCGGCGCCCCGGGAGGTGG + Exonic
1083901771 11:65646789-65646811 GCGCGCGGCGCCCGGGGCGCGGG + Exonic
1083939982 11:65890612-65890634 GCACGCGGCGGGGCGCGCGCCGG - Exonic
1083999582 11:66288914-66288936 GGGCGCGGCGCGGCCGGCGGGGG - Intronic
1084171230 11:67401887-67401909 GGAGGCGGGGCCGCGGGCCGGGG - Intronic
1084192196 11:67504358-67504380 GGCCCCGGCGGCGCGGGCGGCGG - Intronic
1085266550 11:75241010-75241032 GAGCGCGGCGGCCCGGGCGCTGG + Exonic
1085641578 11:78196323-78196345 GGAGGCGGCGCGGCAGCCGCTGG + Exonic
1085726845 11:78961990-78962012 TGACGTGGCTCCGCGGGCTCAGG - Intronic
1086590481 11:88509178-88509200 GAGCGCGGCCGCGCGGGCGCCGG + Exonic
1088522141 11:110711936-110711958 GGAGGCGGCGGCGCTGCCGCTGG + Intronic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1090699313 11:129279631-129279653 AGGCGCGCCGCCGCGGCCGCGGG + Intergenic
1091616147 12:2052753-2052775 GGCGGCGCTGCCGCGGGCGCCGG + Intronic
1092462340 12:8697842-8697864 CGCCGCGGCGCGGCGGGCGGGGG - Intronic
1092743164 12:11649548-11649570 GGCCGCGGGGGCGCGGGCGGAGG - Intergenic
1094470278 12:30796235-30796257 GGCCGCGGGGCGGCGGGGGCGGG - Intergenic
1096191539 12:49623360-49623382 GGACGCGGCGGCGCGGGGGCGGG + Intronic
1096460907 12:51821129-51821151 GGACGGTCCGCGGCGGGCGCAGG + Intergenic
1096738874 12:53677199-53677221 GGCCGGGGCGCCGCGGGGCCCGG - Intronic
1097155085 12:57006484-57006506 GGAGGCGGCGCCGCCGGCCGCGG + Intergenic
1097245356 12:57604929-57604951 GGAGGGGGCGCCGGGGGAGCGGG - Intronic
1097267800 12:57755766-57755788 GGCAGCGGCGGCGCGGGCGGCGG - Exonic
1100611530 12:96194901-96194923 GGTGGCAGCGACGCGGGCGCAGG - Intronic
1100611551 12:96194965-96194987 GGGAGGGGAGCCGCGGGCGCAGG - Intronic
1101365193 12:104064443-104064465 GGTCACGTGGCCGCGGGCGCCGG - Exonic
1101466800 12:104957971-104957993 GGACCCGGCGGCGGGGGCGCGGG - Intronic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1103120043 12:118372676-118372698 GGAAGCGGCGGCGGCGGCGCCGG - Exonic
1103488228 12:121296858-121296880 GGGCGGTGCGCGGCGGGCGCGGG - Intronic
1103649636 12:122422629-122422651 TGACGCGCCGCCGCCGCCGCGGG + Intronic
1103779406 12:123389129-123389151 GGTGGCGGCGGCGAGGGCGCGGG + Intronic
1104841539 12:131828269-131828291 GGACACGGCGGGGCGGGCGGGGG + Intergenic
1104854298 12:131894888-131894910 GGGCGCGGGGCCGGGGGCGCGGG - Exonic
1105344656 13:19561390-19561412 GGGCGCGGCGCCCCGGGAGGTGG - Intergenic
1105411858 13:20177527-20177549 GGAGGCGGCGCGGTGGCCGCGGG - Intergenic
1105414052 13:20193551-20193573 GGAGGGGGCGCCGCTGGTGCCGG + Intergenic
1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG + Exonic
1105535382 13:21260177-21260199 GGGCGCGGCGCCCCGGGAGGTGG + Intergenic
1107468026 13:40666651-40666673 GCGCGCGCCGCCGCGGGCGGGGG - Intergenic
1107468030 13:40666656-40666678 GCCCGCGGCGGCGCGCGCGCCGG + Intergenic
1110630153 13:77698106-77698128 GGGGGCGGCGCGGCGGGCGGCGG - Intronic
1110706025 13:78602503-78602525 GGACGAGACGCTGCTGGCGCGGG - Exonic
1112507104 13:99981812-99981834 GGAGGCGGCGGCGCGGGAGGAGG - Exonic
1113254805 13:108495582-108495604 AGGCGCGGCGCCCCGGGAGCTGG + Intergenic
1113653880 13:112056336-112056358 GAACGCGGGGGCGGGGGCGCGGG + Intergenic
1113655769 13:112067158-112067180 GGGCGGCGCGCCGCGTGCGCTGG - Intergenic
1113937319 13:114001366-114001388 GGACCCGCGGCCGCGGGCTCGGG + Intronic
1113981842 13:114282436-114282458 GGACGGGGCGCTGCGGGGCCGGG + Intronic
1115028312 14:28767175-28767197 GAACGGGGCGCGGGGGGCGCGGG - Exonic
1115028333 14:28767235-28767257 GGCGGCGGCGGCGCGGGAGCGGG - Exonic
1115851790 14:37595151-37595173 GGCGGCGGCGCGGCGGGCGGGGG + Intronic
1116426606 14:44798932-44798954 GGAGGCGGCGGCGGGGGAGCGGG - Intergenic
1116835798 14:49768212-49768234 GGCGGCGGCGGCGCGGGCCCGGG - Exonic
1116928608 14:50668046-50668068 GGAGGCGGCGGCGCCGGCGGAGG - Exonic
1116950153 14:50872083-50872105 GGGCGCGGTGCCGCCGGGGCGGG + Intronic
1117680680 14:58200076-58200098 GGCCGCGGCGCGCCGGGCCCGGG - Intronic
1118137579 14:63045908-63045930 GGACGCGGCTCCCGGGGCGGAGG + Intronic
1118206496 14:63728091-63728113 GGGCGGGGCGCGGCGCGCGCGGG - Intergenic
1118285259 14:64465367-64465389 GCGCGGGGCGGCGCGGGCGCCGG - Intronic
1119326085 14:73760249-73760271 CGCCGCGGTGCCGCGCGCGCCGG - Exonic
1119330137 14:73787302-73787324 GCGCGCGGAGCCGGGGGCGCGGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119539299 14:75428212-75428234 GGAGGCGGCGCCCCCGGGGCCGG - Intronic
1119743524 14:77028519-77028541 AGCCGCGGCGGCCCGGGCGCCGG - Exonic
1120881281 14:89416983-89417005 GGGCGCGGCGCGGCGAGCCCGGG + Intronic
1121352529 14:93184887-93184909 GGAAGCTGCGCGGCGGGCGGGGG + Exonic
1122065995 14:99174893-99174915 GGCTGCGGGGACGCGGGCGCGGG - Exonic
1122418215 14:101560494-101560516 GGGCGCGGGGCAGCGGGCGCGGG - Intergenic
1122517663 14:102319954-102319976 GGACGCGGCGCGGCGGCTGCGGG + Exonic
1122840769 14:104461612-104461634 GGACGGGGCGGGGCGGGGGCGGG + Intergenic
1122904476 14:104795533-104795555 GGATGCGGAGCGGCGGGCGCCGG - Intronic
1122993300 14:105248982-105249004 GGCGGCGGCGGCGCTGGCGCGGG - Exonic
1125589325 15:40844577-40844599 GGCCGGGGCGAGGCGGGCGCGGG - Exonic
1125677860 15:41512075-41512097 GGATGGGGCGGCGCCGGCGCCGG - Intronic
1126113198 15:45187494-45187516 GCAGGCGGCGCCGGGGGCCCCGG + Intronic
1126823680 15:52528956-52528978 GGGCGGGGCGCCTCAGGCGCTGG + Exonic
1126827803 15:52568979-52569001 GGAGGCGGCCCGGCGGGCCCTGG - Intronic
1128161038 15:65422957-65422979 AGGCGCGGCGCCGCGGGCGGGGG + Exonic
1128264264 15:66253557-66253579 GGACGCGGAGTCTCGGACGCCGG - Intronic
1128344128 15:66842820-66842842 GGCGGCGGCGGCGCCGGCGCGGG + Intergenic
1128455187 15:67827976-67827998 CGAGGCGGCGCCGGGGGCGGGGG - Intronic
1128622477 15:69161540-69161562 GGGCGCGGCTCCGCAGGCGCTGG + Intronic
1129189235 15:73927743-73927765 GTACGGGCCGCCGCGCGCGCTGG + Exonic
1129199875 15:73992335-73992357 ACCCGCGGCGGCGCGGGCGCAGG + Exonic
1129334273 15:74843114-74843136 GGAAGCGCCCGCGCGGGCGCAGG - Exonic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1131133071 15:89912568-89912590 GGGCGCGGCGGCAGGGGCGCCGG + Intronic
1131466043 15:92655567-92655589 GGACTCGGCTCTGCTGGCGCGGG + Exonic
1132326386 15:100973633-100973655 GGTCGCGGGGCGGCGAGCGCAGG + Intronic
1132591169 16:727080-727102 GGAGGCGGGGCCTCGGCCGCCGG - Intronic
1132662040 16:1065942-1065964 GGACCCGCCGCCGCGGCCGCAGG - Intergenic
1132885067 16:2178939-2178961 GGCCGCGGCGCTGCAGGCGGTGG - Exonic
1133097686 16:3458324-3458346 GGACCGTGCGCCGGGGGCGCGGG - Intronic
1134554646 16:15154817-15154839 GGACGGGGCGCGGTGGGGGCGGG + Intergenic
1135115332 16:19718595-19718617 GGCAGCGGCTCCGCGGGCCCGGG + Intronic
1135976149 16:27109951-27109973 GGGCGCGGCGGGGCGGGAGCGGG - Intergenic
1136454024 16:30370285-30370307 GGGCGCGGCTCGGCGCGCGCCGG + Intergenic
1136536386 16:30902302-30902324 GGACGCGGCGCGCCAGGCCCGGG + Exonic
1137267973 16:46884353-46884375 GGGCCGGGCGGCGCGGGCGCCGG + Intergenic
1137655226 16:50153425-50153447 GGGAGCGACGCCGCCGGCGCCGG + Intronic
1137788532 16:51155367-51155389 GGCAGCGGCGCCCCGGGGGCGGG + Intergenic
1137926602 16:52546987-52547009 GGGCCGGGCGCCGGGGGCGCGGG + Exonic
1138016688 16:53434730-53434752 GGACGAGGCGGCGCGGGCCGAGG + Exonic
1138328066 16:56191747-56191769 GGAGGCGGCGGCGGCGGCGCGGG - Intronic
1138386435 16:56638572-56638594 GGACTCAGCGGGGCGGGCGCAGG + Intergenic
1138450726 16:57092408-57092430 TGCCGCGGCGCGCCGGGCGCGGG + Intergenic
1138591126 16:58000338-58000360 GGAAGGGGTGCGGCGGGCGCGGG + Intronic
1138619110 16:58197796-58197818 GGACGCGGGGCGTCGGGCGGAGG + Exonic
1139403008 16:66696860-66696882 GGCGGCGGCGCCGCGGGCCTCGG + Intergenic
1139496933 16:67326766-67326788 GGTCGCGGCGGCGCGCGCGCGGG + Intergenic
1140404012 16:74695652-74695674 GGACGCGGTGGCCCAGGCGCCGG + Exonic
1140927619 16:79599291-79599313 GCCCGCGGCGCCGGGCGCGCCGG + Exonic
1141086083 16:81096387-81096409 GGAGGCGGTGCCGCGGGGGCGGG + Exonic
1141184795 16:81779486-81779508 GGACGCAGCGCCCTGGGAGCCGG - Intronic
1142120248 16:88383407-88383429 GGGCCGGGCGCCGCGAGCGCTGG - Intergenic
1142120419 16:88383910-88383932 GGACGCGGCGCCCCGCGTGGCGG + Intergenic
1142156317 16:88534248-88534270 GGCCGCGGCGACTCGGGCGCGGG - Exonic
1142336099 16:89490357-89490379 GGCGGCGGCGGCGCGGGCTCGGG + Exonic
1142395287 16:89828401-89828423 GGGCGGGGCGCGGAGGGCGCGGG - Intronic
1142395349 16:89828572-89828594 GGCGGCGCCGCGGCGGGCGCAGG + Exonic
1142400922 16:89858435-89858457 GCACGCGGGGCCGCGGGCGCTGG - Exonic
1142509830 17:386259-386281 GGGCGGGGCGGGGCGGGCGCCGG - Intergenic
1144107282 17:11997430-11997452 GGAGCCGGCGCCGCGGGCCGAGG - Intronic
1145041279 17:19579891-19579913 GCTGGCGGCGGCGCGGGCGCGGG - Intergenic
1146022635 17:29292894-29292916 GGCCGCGGTGCGGGGGGCGCCGG + Intronic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1146356966 17:32142568-32142590 GGGGGCGGCGCGGCGGGCCCCGG + Exonic
1146445360 17:32928286-32928308 GGACGCGGGGGCGCGGGGCCTGG + Intronic
1146716204 17:35089078-35089100 GGAGGCGGCGGCGGCGGCGCTGG - Intronic
1147028394 17:37609303-37609325 GGCGGCGGGGCCGCGGGAGCTGG - Exonic
1147179502 17:38675098-38675120 GGACCCGGCGCGGCGGCGGCTGG + Exonic
1147264087 17:39224829-39224851 GGACGCGAGGCCGCGGCCGGGGG - Intronic
1147400404 17:40177503-40177525 GGACGCGGCGGCGGCGGCGGCGG - Intronic
1147727819 17:42577631-42577653 GGTAACGGCGCCGTGGGCGCGGG - Exonic
1147731856 17:42609198-42609220 TGAGGCGGCGCAGCGGGCCCTGG - Exonic
1147907552 17:43832917-43832939 GCGCGCGGCGGGGCGGGCGCGGG + Intronic
1148760442 17:49997091-49997113 GGGCTCGGAGCGGCGGGCGCTGG - Intergenic
1148945593 17:51259888-51259910 GGAGGGGGCGCCGCGGGCTCGGG - Exonic
1149678498 17:58487736-58487758 GGCCGGGGCCCCGCGGGCGGCGG + Exonic
1149840927 17:59964544-59964566 GGCCGCGGCGCAGGGGGCTCTGG - Intronic
1150489006 17:65561689-65561711 GGGCGGGGCGGGGCGGGCGCGGG - Intronic
1150764626 17:67993546-67993568 CGCGGCGGCGGCGCGGGCGCGGG + Intronic
1151558730 17:74859994-74860016 GGCCCCGGAGCCGCGGACGCCGG - Intronic
1151559171 17:74861555-74861577 GGGCGCGGCGGGGCGGGGGCGGG + Intergenic
1152110076 17:78353050-78353072 GGCCGCGGCGATGCGGGCCCGGG + Intergenic
1152362635 17:79839615-79839637 GGACGCGGAGGGGAGGGCGCCGG + Intergenic
1152627205 17:81393285-81393307 GGTCCCGGCCCCGCGGGTGCAGG - Intergenic
1152924541 17:83081038-83081060 GGAGGCTCCGCCGGGGGCGCTGG - Intronic
1153515278 18:5895739-5895761 GGCCGCGGGGCAGGGGGCGCGGG + Intronic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1155054516 18:22171856-22171878 GGAGGCGGCGCGGCTGGCGGCGG + Exonic
1155928941 18:31685573-31685595 GGCCCCGGTGCGGCGGGCGCGGG - Intronic
1156008601 18:32471031-32471053 GCGCGCCGAGCCGCGGGCGCTGG - Intergenic
1156171841 18:34494361-34494383 GGACGGGGGGCGGCGGGGGCGGG + Intronic
1156253823 18:35376958-35376980 CGGCGCGGCGCGGTGGGCGCGGG - Intronic
1157338167 18:46756514-46756536 CTACCGGGCGCCGCGGGCGCGGG + Exonic
1157529533 18:48409497-48409519 CGAGCCGGCGGCGCGGGCGCGGG - Intronic
1160025432 18:75211798-75211820 GGACGCGGGGCCCCGGGCGCGGG - Intronic
1160204651 18:76822732-76822754 GGATGCGGCGCGGGGGGCGCCGG + Intronic
1160453406 18:78979984-78980006 GGCCGCGGCGCCTCGGGACCGGG - Intergenic
1160543656 18:79638761-79638783 AGACGCGGCGGCGCTGGGGCTGG + Intergenic
1160592353 18:79951580-79951602 GGGCGCGGGGCTGGGGGCGCAGG - Exonic
1160592359 18:79951594-79951616 GGACGCGGGGCGCTGGGCGCGGG - Exonic
1160680342 19:409221-409243 GGGGGCGGGGGCGCGGGCGCGGG - Intergenic
1160745414 19:709044-709066 GGACGCGGCCTGGCGGGGGCCGG - Intergenic
1160763890 19:798586-798608 GGACCCAGCACCGCGGGCTCGGG + Intronic
1160788701 19:913052-913074 GGGCGGGGCGCGGCGGGCGCCGG - Intronic
1160807874 19:1000589-1000611 GGCCAGGGCGGCGCGGGCGCGGG - Exonic
1160833111 19:1112453-1112475 GCACGCGGCGCCGCTGGTTCTGG + Exonic
1160858935 19:1229506-1229528 GGCCGGGGCCGCGCGGGCGCCGG + Exonic
1160909223 19:1467214-1467236 GGCGGGGGCGCCGGGGGCGCCGG + Exonic
1160948093 19:1652618-1652640 GGGCGGGGCGGCGCGGGCGGGGG - Intergenic
1160967706 19:1753846-1753868 GGTGGGGGCGCCGGGGGCGCGGG + Exonic
1161063528 19:2226867-2226889 GGACGCCGCGCCGCCTGCGGAGG - Exonic
1161203647 19:3029220-3029242 GGTGGCGGCGGCGCGGGCGGCGG + Intronic
1161318657 19:3631164-3631186 GGACGCGGTGCCGCCCGCCCGGG + Exonic
1161569121 19:5020597-5020619 GGAAGCCAGGCCGCGGGCGCTGG + Intronic
1161744507 19:6047444-6047466 GGACGCAGAGCCACGGACGCTGG + Exonic
1161957822 19:7506261-7506283 GGACGGGGCTCCGTGGGGGCGGG - Intronic
1162019608 19:7862664-7862686 GGAGGCGGGGCCGCGGGCGGGGG - Intronic
1162019651 19:7862771-7862793 GGAGGCGTGGCCGCGGGCGGGGG - Intronic
1162019688 19:7862864-7862886 GGAGGCGGGGCCGCGGGCGGAGG - Intronic
1162128235 19:8510865-8510887 GGGCGCGGCGGCCCGGCCGCGGG + Exonic
1162396637 19:10421050-10421072 GGCAGCGGCGGCGCGGGCGGAGG + Exonic
1163321538 19:16577538-16577560 TGAGGCGGCGCTGCGGGGGCTGG - Exonic
1163606935 19:18280862-18280884 GCGGGCGGCGCCGGGGGCGCGGG - Exonic
1163708630 19:18832390-18832412 GGCCCGGGCGGCGCGGGCGCGGG + Exonic
1164693204 19:30226030-30226052 GGAGGCGGCGGCCCAGGCGCAGG - Intergenic
1164990079 19:32676578-32676600 GCACGCGCCGCGGCGGCCGCTGG + Exonic
1165213694 19:34254619-34254641 GGAGCGGGCGCGGCGGGCGCAGG + Intronic
1165213792 19:34254894-34254916 GGCCGCGGCACCGCAGGGGCGGG + Intronic
1165305519 19:35000543-35000565 GGAGGGGGCGCCGCGGGCTTGGG + Intronic
1165349828 19:35269381-35269403 GGGCGCGGGGGCGGGGGCGCGGG + Intronic
1165349830 19:35269387-35269409 GGGGGCGGGGGCGCGGGCGCGGG + Intronic
1165496099 19:36152522-36152544 GGACGCGGCGGGGCTGGGGCTGG + Exonic
1166094536 19:40530693-40530715 GGGCGGGGCGGCGCGGGGGCGGG + Intronic
1166107708 19:40605526-40605548 GGAAGCGGCGGCGCGGGCGGAGG + Exonic
1166304251 19:41928590-41928612 GGAGGCGGCGGCGGCGGCGCGGG + Intronic
1166361644 19:42255045-42255067 GGACGGGGCAGCGAGGGCGCCGG - Exonic
1166366270 19:42280135-42280157 GGAGGCGGCGCGGCGGGCTAGGG - Intronic
1166765603 19:45251161-45251183 GGTCGGGGCGCCGGGGGCTCCGG - Intronic
1167268250 19:48493882-48493904 GGGCGCGGCGGCGGGGCCGCGGG - Exonic
1167295446 19:48646563-48646585 GGAAGGGGGGCTGCGGGCGCTGG - Intergenic
1167643705 19:50695090-50695112 GGACGCGGCGGCGGCGGCGGCGG - Intronic
1167797521 19:51719517-51719539 GGACGCGCAGCCGCGCGCGCGGG + Exonic
1168297303 19:55383739-55383761 GGGCCCGGGGCGGCGGGCGCGGG - Exonic
1168332534 19:55578682-55578704 GGACGCGGCGGTGCTGGCGGAGG + Exonic
924987766 2:287742-287764 GGGCGCGGAGCCCCGGGAGCCGG - Exonic
926149989 2:10420139-10420161 AGACCCGGGGCCTCGGGCGCCGG - Intronic
927156491 2:20224293-20224315 GGGCGCAGCGCGGCCGGCGCGGG - Intronic
927215858 2:20667456-20667478 GCGCGCCGCGCCGCGGGCTCCGG + Exonic
927472214 2:23385238-23385260 GGCGGCGGCGGCGCGGGGGCTGG - Exonic
927652437 2:24920447-24920469 GGAAGCGCGGGCGCGGGCGCGGG + Intergenic
927714203 2:25341864-25341886 GGACGCGGCGCCGCGGCACCAGG - Intronic
928549433 2:32357004-32357026 GGAGGCGGGGCCCGGGGCGCGGG - Intergenic
928904520 2:36355917-36355939 GGAGGAGGCGCCGCCGGCCCGGG + Exonic
928904815 2:36356942-36356964 GGTGGGGGCGCCGCGGGCGGGGG + Intronic
930700813 2:54456647-54456669 CCACGCGGCTCCCCGGGCGCAGG - Intronic
931321343 2:61177310-61177332 GGACGCGGGGACGCGCGGGCGGG - Intergenic
931602593 2:64019213-64019235 GGAGGCGGCGCTGCGGACCCGGG - Intergenic
932345867 2:70994833-70994855 GGACGCGGCGGCGGCGGCGGCGG - Exonic
932398931 2:71466501-71466523 GAACGAGGCGCCGCTGACGCGGG - Intronic
932621828 2:73269317-73269339 AGGTGCGGCGCCGCGGGCGACGG + Exonic
932765309 2:74465372-74465394 GGAGGCGGAGGCGCAGGCGCTGG - Exonic
934763900 2:96869939-96869961 GCAGGCGGCGACGCGGGGGCAGG - Exonic
934846384 2:97663749-97663771 GGACGCGCCGAGGCGGGCGGGGG + Intronic
935255718 2:101308265-101308287 GGGCGCGGCCCCTCGGCCGCCGG + Exonic
935592740 2:104856237-104856259 GGCGGCGGCGGCGCGGGCGGTGG + Exonic
936278728 2:111120779-111120801 GGCCGCGGCGCCGAGGGGGGCGG + Intronic
936566142 2:113584041-113584063 GGACCCGGAGGCGCGGGCGGAGG + Intergenic
937221688 2:120345954-120345976 GGAAGGGGCGCCGAGGGCCCCGG - Intergenic
937956329 2:127423474-127423496 GGGCGCGGCGCGGGGGGCTCAGG + Intronic
938392410 2:130916232-130916254 GGACGCGGGGGCGCTGGCCCCGG - Intronic
939869042 2:147507005-147507027 GCACTCTGAGCCGCGGGCGCCGG + Intergenic
941666231 2:168246785-168246807 GGACGCGGCCCCCGGGGCCCTGG + Intronic
942276380 2:174326719-174326741 GGGCGCTCCGCCGAGGGCGCGGG + Intergenic
942446145 2:176080249-176080271 GGCGGCGGCGGCGGGGGCGCCGG - Exonic
943342084 2:186693928-186693950 GGGCGCGGGACCGCGGGCCCCGG + Intergenic
945699427 2:213151758-213151780 GGCAGCGGAGCCCCGGGCGCGGG + Intronic
947418482 2:229921706-229921728 GGCCCCGCCGCCGCCGGCGCCGG + Intronic
948801654 2:240435974-240435996 GGCCGGGTCCCCGCGGGCGCAGG - Exonic
948824794 2:240568917-240568939 GGGGGCGGCGGCGCGGGCCCCGG - Exonic
949000375 2:241609954-241609976 GGAAGCGGCACCCCGGGCGCTGG + Intronic
949040089 2:241844055-241844077 GGGCGCGGGGGCGCGGGCGTGGG + Intergenic
1168855027 20:1002229-1002251 GGCGGCGGCACGGCGGGCGCGGG + Exonic
1169065793 20:2693461-2693483 GAAAGCGGGTCCGCGGGCGCCGG - Intronic
1169113349 20:3046804-3046826 GGGCACCGCGACGCGGGCGCTGG + Intronic
1170150510 20:13221732-13221754 GGACCCGGCGCGGCGGCCGGCGG - Intergenic
1172284644 20:33732143-33732165 GGCCGCGGGGCGGAGGGCGCCGG + Intronic
1172526192 20:35601773-35601795 AGCCGCGGCGCCGTGGGCCCCGG + Intergenic
1172529312 20:35619120-35619142 GGGCGCGGGGGCGCGGGGGCTGG - Intronic
1173685240 20:44918939-44918961 GGAGGCGGAGCTGGGGGCGCGGG + Exonic
1173856098 20:46251540-46251562 CGACGCGGCGACGGGGGCGCGGG - Exonic
1174317450 20:49713727-49713749 GGACGGGGAGCTGCGGGAGCAGG - Exonic
1174804607 20:53594223-53594245 GGGCGCGGCGCGTCCGGCGCTGG + Intronic
1175429657 20:58892072-58892094 GGCCGTGGCGACGCGGGCGCGGG + Intronic
1175856450 20:62123091-62123113 GGGGGCGGCACCGCGGGGGCCGG - Intronic
1175975618 20:62709026-62709048 AGACGCGCCGCCCCGGGCTCCGG - Exonic
1176005745 20:62861565-62861587 GGACGCGGCGCTGGGCGAGCCGG - Exonic
1178513836 21:33229904-33229926 CGCCGCGCCGCCGCCGGCGCGGG - Intronic
1178922488 21:36747786-36747808 GGACGGGGCGCGGCTGGCGCTGG + Exonic
1178951634 21:36990305-36990327 GGCCGCGGTGCCGCGCGCTCGGG + Intergenic
1178992648 21:37367743-37367765 GGAGGAGGCGCCGCGGGCCCAGG + Intronic
1179444225 21:41420280-41420302 GGGGGCGGGGGCGCGGGCGCGGG + Intergenic
1179511828 21:41878827-41878849 GGCCGCGGGGCCGCGGGCCGGGG + Exonic
1179794875 21:43776752-43776774 GGTCCCGGCCCCGCGGGAGCAGG + Intergenic
1180209468 21:46286110-46286132 GGAAACGGCGCCCCTGGCGCCGG + Intronic
1180259913 21:46662024-46662046 GGACGCGGCGTGGCGGTCGTGGG + Intronic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1180876660 22:19178097-19178119 GGCCGCGGCGCCGCGGGGGGCGG - Intronic
1181831669 22:25564954-25564976 GGTCGGGGCGCGGCGGGCGGCGG + Exonic
1182903912 22:33920611-33920633 GGGCGCGGGGCCGGGGGCGCGGG + Intronic
1183299454 22:37051778-37051800 GGAGGCAGCGCCGCCGGCGGGGG + Exonic
1183386742 22:37519385-37519407 GGCGGCGGCTCCGCCGGCGCAGG + Exonic
1183535601 22:38398830-38398852 GGGCGCGGCGCGTCCGGCGCTGG + Intergenic
1183649526 22:39145885-39145907 GGAAGGGGCGCAGCGGGTGCAGG + Intronic
1183744776 22:39686061-39686083 GGCCGCGGTGGCGCGGGCGGCGG + Exonic
1184035258 22:41915001-41915023 GGAGGCCGCGCCGGGGCCGCGGG + Intergenic
1184152970 22:42649225-42649247 GGACCCGGCGGCGAGGGGGCGGG - Intronic
1184152985 22:42649264-42649286 GGAGGGGGCGCCGGGGCCGCGGG - Intronic
1184265463 22:43343629-43343651 GGCCGGGGCGCCGCGGGCAGGGG - Intergenic
1184276555 22:43412173-43412195 GGGCGGGGCGCGGCGGGCGCGGG + Intronic
1184620302 22:45671820-45671842 GGAGACGGCGCCGCGGGGGAGGG - Exonic
1184766959 22:46577150-46577172 GGAGGCGGCCCCGCGGGTCCCGG - Intronic
1184796881 22:46738006-46738028 GGAGCCGGCGCCCCCGGCGCGGG - Exonic
1185055203 22:48575678-48575700 GGCCGCGGCGGCGGAGGCGCGGG + Intronic
1185331799 22:50255317-50255339 GGACGCGGAGCAGCGGGTGACGG - Exonic
1185398546 22:50604557-50604579 GGTCGAGGCGCGGCGGGCGCGGG - Exonic
950215279 3:11154467-11154489 GGGGGCGGCGGCGGGGGCGCCGG - Intronic
952867228 3:37862120-37862142 GGGCGCGGCGCGGGGGGCGCGGG - Intronic
953027565 3:39153697-39153719 GGAGGCGGCGCCTCCGGGGCGGG - Intronic
953705344 3:45226244-45226266 GGCCCCGGCGCCGGGGGCGGCGG - Exonic
953925395 3:46980008-46980030 GGCCGCGTAGCCGCGCGCGCGGG + Intronic
954632916 3:52056608-52056630 GGGGGCGGGGCCGCGGGGGCCGG + Intergenic
954779100 3:53046138-53046160 GGGCGCGGCGCGAGGGGCGCAGG - Intronic
955387587 3:58491965-58491987 AGCCGCGGCGCCACGAGCGCGGG - Intergenic
955818800 3:62874863-62874885 GGGGGCGGCGGCGCCGGCGCCGG - Exonic
955916386 3:63912313-63912335 GGACCCAGCGCCGCGGTGGCGGG + Intronic
956678059 3:71753805-71753827 GCCCGCGGCGCCTAGGGCGCAGG + Intronic
956761203 3:72446892-72446914 GGAAGGGCCGCGGCGGGCGCAGG + Exonic
958692113 3:97481553-97481575 GGGCGCGGCGCGTCCGGCGCTGG + Intronic
962809001 3:138946178-138946200 GGGTGCGGCGTGGCGGGCGCCGG - Exonic
963706798 3:148698106-148698128 TGACGCAGCGCCCGGGGCGCGGG + Exonic
965590592 3:170357514-170357536 AGCGGCGGCGCCGCGCGCGCGGG - Intergenic
966182237 3:177197669-177197691 GGGAGGGGCGCCGCGGACGCCGG + Intergenic
966808732 3:183825555-183825577 GGGAGCGGGGCGGCGGGCGCCGG - Exonic
967055478 3:185825538-185825560 GGAAGGCGCGCCCCGGGCGCGGG + Intergenic
967055494 3:185825579-185825601 CGACGGGGAGCCGCGGGCGTGGG + Intergenic
967685276 3:192409903-192409925 GGAGGCGGCGGCGCGGCGGCGGG - Intronic
967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG + Intronic
968178188 3:196569036-196569058 AGCGGCGGCGGCGCGGGCGCGGG + Exonic
968230571 3:197002830-197002852 GGACACGGTCCCGCGGGCGAAGG + Exonic
968434106 4:576189-576211 GGCGGCGGCGGCGCGGGCCCGGG - Intergenic
968479163 4:826221-826243 AGGGGCGGGGCCGCGGGCGCCGG + Intergenic
968512957 4:1003348-1003370 GGGCGGGGCGCCGCGGCCACCGG - Exonic
968701204 4:2059094-2059116 GGGGGCGGCGGCGCGGGCGGGGG - Intergenic
968820184 4:2844066-2844088 TGAGGCGGCGGCGGGGGCGCGGG + Intronic
969645814 4:8428256-8428278 GGACGCGACGGGGCGGGAGCGGG - Intronic
970333145 4:15004210-15004232 TGCTGCGGCGCCGCGGGCGGCGG - Exonic
971244146 4:24913124-24913146 GGTCGCGGGGCTGAGGGCGCGGG - Intronic
971457810 4:26860798-26860820 GGCGGCGGCGGCGCGGGAGCTGG + Intronic
973613726 4:52659460-52659482 GGAGGCGGCGCGGCGGGGCCCGG - Intergenic
973640795 4:52900908-52900930 GGGAGAGGCTCCGCGGGCGCAGG + Intronic
973954527 4:56049433-56049455 GGGCTCGGCGCGGCGGGCGGTGG + Intergenic
976226397 4:82798273-82798295 GGCCGGGGCGCAGGGGGCGCCGG + Intronic
979455644 4:120922860-120922882 GGCCTGGGCGCTGCGGGCGCCGG + Intronic
981366666 4:143912144-143912166 GGAGGCGGCGGCGCCGGCGGAGG - Intergenic
982745790 4:159103338-159103360 GGCCGCGGCGGCGCCGGCGCCGG + Intergenic
984206461 4:176792763-176792785 GGGCGCTGCGGCGGGGGCGCTGG + Intergenic
985630093 5:1009530-1009552 GGAAGCGGAGCGGCGCGCGCGGG + Exonic
985669789 5:1201387-1201409 GGAGGCTGCTCCGTGGGCGCTGG - Intergenic
985688805 5:1295530-1295552 GGACGCGGGGCGTCGGGCTCCGG + Intergenic
986315357 5:6583201-6583223 GAACGCGGGGCCGCGGGGGCTGG + Intergenic
986813665 5:11385174-11385196 GGCGGCGGCGGCGCGGGCTCGGG + Exonic
987050443 5:14143666-14143688 GCACGCGGCGCTAGGGGCGCGGG + Intergenic
988578003 5:32444839-32444861 GGCCTCGGCGGTGCGGGCGCGGG + Intergenic
988734655 5:34008112-34008134 GGGCGCGGCGCCGCGGCTGGGGG - Intronic
990347448 5:54884128-54884150 GGACGCGGGGCCGCCGCGGCGGG - Intergenic
990955119 5:61332699-61332721 GGCGGCGGCGGCGCGGGCGGCGG + Exonic
992067462 5:73120719-73120741 CGACCCGCCGCCGCCGGCGCAGG - Intronic
992105720 5:73448028-73448050 GGCGGCGGCGGCGCGGGCGGCGG - Exonic
993901022 5:93584509-93584531 GGGCGCAGCGCCGGGGGCGGCGG - Exonic
995764704 5:115602428-115602450 GGACGTGGCGCTGCGGGCCGGGG + Exonic
996290907 5:121851777-121851799 GGAAGCGCCGCCGGGGGCTCTGG - Intergenic
996443034 5:123512694-123512716 GGGGGCGGCGCCGCAGGCGCGGG + Intronic
996948164 5:129094697-129094719 GGAGGCGGGGCCGCGGCAGCCGG + Intergenic
997521639 5:134527238-134527260 GGGCGCCGCTCCGCAGGCGCAGG - Intronic
1001906542 5:175478412-175478434 AGAAGCGGAGTCGCGGGCGCGGG + Exonic
1002784980 6:393424-393446 GGAGGCGGCGCCGGGGACCCCGG - Intronic
1002897998 6:1390176-1390198 GGCGGCGGCGGCGCGGGCGCCGG + Exonic
1003139151 6:3456741-3456763 GGCCGCAGCGCCCGGGGCGCGGG - Intronic
1003290634 6:4776164-4776186 GGGGGCGGGGCCGCGAGCGCGGG - Intronic
1003290869 6:4776894-4776916 GGAGGGGACGCGGCGGGCGCGGG - Intronic
1003645442 6:7910316-7910338 GGGCGCGGGGCCGGGAGCGCGGG - Intronic
1004193871 6:13487270-13487292 GGCTGCGGCGGCGCGGCCGCGGG - Exonic
1004216930 6:13711746-13711768 GGACGAGGCGCCGAGGGCGGGGG + Intergenic
1004627921 6:17393926-17393948 GGGCGCGGCGACCCGGGCGCGGG + Intronic
1004690437 6:17987996-17988018 GGGGGGGGCCCCGCGGGCGCCGG - Intergenic
1006224226 6:32522473-32522495 GGAGGAGGCGGCGCGGGCTCCGG - Intronic
1006665085 6:35688264-35688286 CGCCGGGACGCCGCGGGCGCGGG - Intronic
1007424064 6:41735504-41735526 GGCCGCGGCGCCGACGGCGGCGG - Intronic
1007775733 6:44223492-44223514 GGGGGCGGGGCCGCGGGCGTCGG + Intronic
1007781554 6:44257472-44257494 GGAGGCGGCGGCGGGAGCGCAGG - Exonic
1008649485 6:53548223-53548245 GGAGGCGGTGCCGCGCGCGGGGG - Intronic
1011277442 6:85643768-85643790 GGCCGCGGAGCCGGGGGCGGGGG - Intronic
1011470230 6:87701424-87701446 GGACCCGGCCCCGCGGCCGCCGG - Intronic
1013099480 6:106974867-106974889 GGCGGCGGCGGCGGGGGCGCTGG - Intronic
1014045220 6:116877167-116877189 GGACCCGGGGCCGCAGGGGCGGG - Intergenic
1015626002 6:135181497-135181519 GGCCATGGCGCGGCGGGCGCGGG - Exonic
1017103138 6:150865876-150865898 GGAGGCGGCGCGGAGGGCCCGGG - Exonic
1017253041 6:152302271-152302293 CGACGCGGGGACGCGGGCTCGGG - Intronic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1017671971 6:156777710-156777732 GGCGGCGGCGGCGCGGGCGCGGG + Intergenic
1017672519 6:156779630-156779652 GGTCGGGGCGCCCCGGGGGCCGG + Intronic
1017877645 6:158537217-158537239 GGGGGCGGCGAGGCGGGCGCGGG - Intronic
1018876641 6:167827269-167827291 GGGCGCGGCGCAGCGGGCGGGGG - Intronic
1019196579 6:170286759-170286781 GGAGGTGGGGCCGGGGGCGCGGG - Intronic
1019563940 7:1670550-1670572 GGCGGCGGCGGAGCGGGCGCAGG + Intergenic
1019711492 7:2520041-2520063 GGCGGCGGCGCCCGGGGCGCTGG + Exonic
1020238467 7:6374468-6374490 GGGAGCGGCGGCGCCGGCGCGGG + Intergenic
1020281787 7:6653559-6653581 GGCGGCGGGGCCGCGGGCGGCGG + Exonic
1021313147 7:19117053-19117075 GGCGGCGGCGGCGCGGGCGGCGG - Exonic
1021452784 7:20798081-20798103 GGAGGCGGAGGCGCAGGCGCCGG + Intergenic
1022207571 7:28179706-28179728 GGACGCGGGCCCGGGGGCTCTGG - Intronic
1022396021 7:29989118-29989140 GGACACGGTGCGGCGGCCGCGGG + Intronic
1023000373 7:35801642-35801664 GGAAGCGGGGCCGCGGAAGCCGG - Intronic
1023955594 7:44884714-44884736 GGAGGCGGCGCCGGGGGCCCAGG - Exonic
1027232661 7:76281735-76281757 GGCCGCGGCGCCCCCGGCCCCGG + Exonic
1027361674 7:77416206-77416228 GGAAGCGGCGGCGCAGGTGCGGG - Exonic
1028621433 7:92833341-92833363 CGCCGCGGCGCCGCTGGGGCGGG + Exonic
1028762427 7:94510256-94510278 GGAGGCGGCGACGCGGCGGCTGG + Intronic
1029110823 7:98212324-98212346 GGGCCCGGCGCCGTGGGGGCCGG - Exonic
1029537385 7:101164428-101164450 CGAGGCGGAGCCGCGGGCTCCGG + Exonic
1030820728 7:114087629-114087651 GGCGGCGGCGCCGGCGGCGCGGG + Intronic
1032230626 7:130070683-130070705 GGAGGAGGCGCCGCCGGCGCTGG + Exonic
1032306112 7:130733791-130733813 GGGCGCGGCGCCGCCCGCGCCGG + Exonic
1033253162 7:139777752-139777774 GGAGGCGGTGATGCGGGCGCGGG - Intronic
1033361258 7:140640513-140640535 GGCGGCGGCTCCGCGGGCTCTGG + Exonic
1034182126 7:149147345-149147367 GGAGGCGACGCGGGGGGCGCTGG + Intronic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1034227916 7:149497429-149497451 GCACACGGCGCCGCAGGCCCTGG - Intronic
1036195298 8:6708559-6708581 GGGCGCGGCGGCCCGGGCCCGGG + Exonic
1037589804 8:20303351-20303373 GGACGCGAGGCCGCAGGAGCAGG - Intronic
1038204959 8:25457903-25457925 GGGCGCGGGGACGGGGGCGCGGG - Intronic
1041275897 8:56157275-56157297 GAAAGCGGCGCAGCGGACGCGGG + Intergenic
1043148337 8:76682468-76682490 GCTCTCGGCGGCGCGGGCGCGGG + Intronic
1044306534 8:90646149-90646171 GGGGGCGGGGCCGCGGGCGATGG + Intronic
1045432135 8:102124112-102124134 GCTCGGTGCGCCGCGGGCGCAGG - Intronic
1049419555 8:142510786-142510808 GGGCGCGCGGCTGCGGGCGCAGG + Intronic
1049585439 8:143430627-143430649 GGAGGCGGCGACGCGGGCCCGGG - Intergenic
1049682014 8:143923475-143923497 AGAGGCGGCGCGGCGGGCACAGG - Exonic
1051174010 9:14346111-14346133 GGGGGGCGCGCCGCGGGCGCGGG + Intronic
1053055162 9:34989680-34989702 GGAGGCGGAGCCGTGGGGGCGGG + Exonic
1054434068 9:65196029-65196051 GGCGGCGGCGCGGCGGGCGGCGG - Intergenic
1054434074 9:65196047-65196069 GGCGGCGGCGCGGCGGGCGGCGG - Intergenic
1057245609 9:93451890-93451912 GGCGGCGGGGGCGCGGGCGCGGG - Exonic
1057259744 9:93576934-93576956 GGGCGCGCAGCCGGGGGCGCGGG - Intronic
1057294440 9:93827162-93827184 GGAGGCGGGGCCGCAGGGGCAGG + Intergenic
1057600048 9:96450123-96450145 GGCGGCGGCGCCGCGGGGGCGGG + Intergenic
1057922058 9:99105387-99105409 TGGCGCGGGGCCGGGGGCGCAGG + Intronic
1058866654 9:109167178-109167200 AGCGGGGGCGCCGCGGGCGCGGG + Exonic
1059234504 9:112750696-112750718 GGCCGCGGCGCCTCGGGGGCGGG + Intergenic
1059299785 9:113303055-113303077 GGAGGCGGCTCCGAGGGAGCAGG - Intronic
1060106743 9:120877292-120877314 GGAAGGGGCCCCCCGGGCGCGGG + Exonic
1060300312 9:122371220-122371242 GGACGGGGAGCGGCGGGAGCAGG - Exonic
1060555311 9:124504817-124504839 GGACGGGGAGGCGGGGGCGCGGG + Intronic
1060596752 9:124853268-124853290 GGACGCGCAGCCGCTGGCGCGGG + Intergenic
1060856044 9:126915297-126915319 GGGCGGGGCGCCGCGGCTGCAGG + Intronic
1060969942 9:127732195-127732217 GGACGTGGTGCCGCTGGAGCGGG + Exonic
1061129863 9:128702798-128702820 GGAAGCGGCGCCGGAGACGCGGG - Exonic
1061208537 9:129177737-129177759 GGACGCGGAGGCGCGCGAGCCGG - Exonic
1061275928 9:129569272-129569294 GGGGGCGGGGGCGCGGGCGCGGG + Intergenic
1061415384 9:130444696-130444718 GGGCGCGCCGGCGGGGGCGCAGG - Intergenic
1061975958 9:134068150-134068172 GGGCGCGGCGCCGGCGGGGCCGG - Intronic
1062022580 9:134326397-134326419 GCGCGCGGCGGCGGGGGCGCGGG + Intronic
1062341270 9:136094902-136094924 GGACGCCGCGCCGCGCGTTCGGG - Intronic
1062517731 9:136944602-136944624 GGGGGCGGCGCAGCGGGCGGAGG - Exonic
1062574558 9:137200206-137200228 GGCCGGGGCGGCGCGGGCGGCGG + Exonic
1062579254 9:137222280-137222302 GGGGGTGGCGCTGCGGGCGCGGG - Intergenic
1062583893 9:137240477-137240499 GGACGCCGCGCCCCGAGGGCCGG - Intergenic
1185621794 X:1454233-1454255 GGGCGCGGTGCTGGGGGCGCAGG + Intergenic
1186496293 X:10015052-10015074 GGACGCGGGGCCGGGGGAGGCGG + Intergenic
1187419543 X:19122527-19122549 GGGGGCGGCGCCGAGGCCGCGGG - Exonic
1187900905 X:24025748-24025770 ACGCGGGGCGCCGCGGGCGCGGG - Intronic
1189262508 X:39688789-39688811 CGACGCGGCGCCTCGCTCGCCGG + Intergenic
1190024574 X:46912223-46912245 GAACGCGGCGCCGCGGGTGCGGG + Intergenic
1195156120 X:102125917-102125939 GGATGCGGAGTCGCGGGGGCGGG + Intronic
1198254724 X:134914941-134914963 GGGCCGGGCGCCGCGGGCGGCGG + Intronic
1200058752 X:153474725-153474747 GGGGGCGGGGGCGCGGGCGCTGG + Intronic
1200092983 X:153644391-153644413 GGAGGCCGCGCCGCGCGCCCGGG - Intronic
1200107821 X:153724539-153724561 GGAAGAGGCGCCTCGGGCTCCGG + Intronic
1200128683 X:153829983-153830005 AGGCGCGGTGCGGCGGGCGCGGG - Intronic
1200128941 X:153830727-153830749 GGCCGCGGCGCCGAGCGCGAGGG - Intergenic