ID: 1105461215

View in Genome Browser
Species Human (GRCh38)
Location 13:20589845-20589867
Sequence GACCTATAGCTACTGGATAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105461210_1105461215 17 Left 1105461210 13:20589805-20589827 CCCAAGATAACTGCTAAAATATC 0: 1
1: 0
2: 2
3: 30
4: 346
Right 1105461215 13:20589845-20589867 GACCTATAGCTACTGGATATGGG 0: 1
1: 0
2: 1
3: 4
4: 103
1105461211_1105461215 16 Left 1105461211 13:20589806-20589828 CCAAGATAACTGCTAAAATATCA 0: 1
1: 0
2: 6
3: 86
4: 562
Right 1105461215 13:20589845-20589867 GACCTATAGCTACTGGATATGGG 0: 1
1: 0
2: 1
3: 4
4: 103
1105461209_1105461215 18 Left 1105461209 13:20589804-20589826 CCCCAAGATAACTGCTAAAATAT 0: 1
1: 0
2: 4
3: 49
4: 357
Right 1105461215 13:20589845-20589867 GACCTATAGCTACTGGATATGGG 0: 1
1: 0
2: 1
3: 4
4: 103
1105461208_1105461215 21 Left 1105461208 13:20589801-20589823 CCTCCCCAAGATAACTGCTAAAA 0: 1
1: 0
2: 2
3: 20
4: 174
Right 1105461215 13:20589845-20589867 GACCTATAGCTACTGGATATGGG 0: 1
1: 0
2: 1
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105461215 Original CRISPR GACCTATAGCTACTGGATAT GGG Exonic
901721770 1:11204341-11204363 GACCTAAAGCTACTAGAAAAAGG + Intronic
909379566 1:74982889-74982911 AACCTATACTTTCTGGATATAGG + Intergenic
911924235 1:103807876-103807898 CACCTATATCTGCTGGGTATAGG - Intergenic
915466763 1:156102875-156102897 GACCTATAGACACAGCATATGGG - Intronic
916848485 1:168678391-168678413 GACAAATAGCTAATGCATATGGG - Intergenic
918974395 1:191463233-191463255 TCTCTATAGATACTGGATATTGG - Intergenic
923329070 1:232905990-232906012 GCCATATAGCTACTGGATCAAGG + Intergenic
924201055 1:241659017-241659039 GAAGAATAGCTAATGGATATTGG - Intronic
924649142 1:245907477-245907499 GTCCTTTTGCTGCTGGATATAGG - Intronic
1063288750 10:4718219-4718241 GACATATAGTTACTGCAAATAGG + Intergenic
1065607186 10:27429923-27429945 GACCTATGAATCCTGGATATAGG - Intergenic
1068436622 10:57000765-57000787 GACAAATAGCTAATGCATATGGG + Intergenic
1069922234 10:71823028-71823050 GCCCTATACCTCCTGAATATTGG - Intronic
1073471719 10:103726630-103726652 GTCCCATAGCTACTGGATATTGG - Intronic
1079270225 11:18977439-18977461 GGCTTATATGTACTGGATATGGG - Intergenic
1080128501 11:28766179-28766201 GACCTAGAGCCAGTGGACATGGG + Intergenic
1082927366 11:58564160-58564182 GACATTGAGCTCCTGGATATTGG + Exonic
1085789388 11:79484069-79484091 GACCCAGAGCTACAGAATATAGG - Intergenic
1086592341 11:88530644-88530666 TACCAATATCTACTGAATATTGG + Intronic
1088357096 11:108955726-108955748 GACAAATAGCTAATGCATATGGG + Intergenic
1098695168 12:73543207-73543229 GACAAATAGCTACTGTATGTGGG + Intergenic
1101344662 12:103875644-103875666 GCCTTATAGATTCTGGATATTGG - Intergenic
1105053874 12:133079960-133079982 GACCTTTTGCTACTGGAAAGGGG - Exonic
1105461215 13:20589845-20589867 GACCTATAGCTACTGGATATGGG + Exonic
1109713680 13:66191915-66191937 GAACTATGGTTACTGGGTATGGG + Intergenic
1110149649 13:72235482-72235504 TCCCTATAGATTCTGGATATTGG + Intergenic
1111534905 13:89590857-89590879 TACCTATAGCTTCTGCATTTTGG + Intergenic
1115958368 14:38808070-38808092 GAGCAATAGCTAATGGATACTGG + Intergenic
1122159267 14:99771211-99771233 GACCAATTGCTAATGGGTATGGG - Intronic
1124816156 15:32995166-32995188 GACCTATATCTCCTGCAAATTGG - Intronic
1126368806 15:47923888-47923910 GACAAATATCTAATGGATATGGG - Intergenic
1127002966 15:54531806-54531828 GACTTATTGCTAATGGGTATAGG - Intronic
1130745633 15:86650800-86650822 GACCTATGGATTCTGAATATAGG + Intronic
1144354695 17:14434254-14434276 GTCCCATAGCTAATGAATATTGG + Intergenic
1149128690 17:53268513-53268535 GACAAATAGCTAATGCATATGGG + Intergenic
1158426998 18:57349210-57349232 CAACTGTAGCTACTGGATAAGGG - Intergenic
1158803516 18:60942551-60942573 TACCTATAGCTAAGGGATATTGG - Intergenic
1159400134 18:67920645-67920667 TCCTTATAGATACTGGATATTGG + Intergenic
1159535884 18:69714190-69714212 GACGTACAGCTTCTGGATTTAGG + Intronic
1160379660 18:78443172-78443194 GACAAATAGCTAATGCATATGGG + Intergenic
1166093387 19:40524599-40524621 GGCCTCTAGCTGCTGGATCTGGG - Intronic
1168359913 19:55730790-55730812 GAAGAATAGCTAGTGGATATCGG + Intronic
932788468 2:74630446-74630468 GACCAATAGCTAATGCATGTGGG - Intronic
933668009 2:84980342-84980364 GATCTGTAGCTACAGGATGTTGG + Intronic
934094016 2:88581981-88582003 GACCTGTAAATACTGGCTATGGG - Intronic
936859210 2:116995879-116995901 GACTTATGTCTACTGGAAATTGG - Intergenic
942988047 2:182165143-182165165 GACCTATGACTCCTGGCTATGGG - Intronic
944589073 2:201200494-201200516 GACCTGTAGCTCCTGGAGCTTGG + Intronic
944994880 2:205282684-205282706 GACCTATATCTAATTGAGATTGG - Intronic
947123438 2:226841422-226841444 GAACAATAGCTAATGGATGTGGG - Intronic
1173134668 20:40428841-40428863 GAACAATAGCTAATGGATGTTGG + Intergenic
1173741826 20:45406978-45407000 GACCTATAGGTACTGGAAAGGGG - Intronic
1173799963 20:45888926-45888948 GACCTAGACCTTCTGGATCTTGG - Intronic
1177964092 21:27705439-27705461 GACATATAGCTAATGCATGTGGG - Intergenic
1181696786 22:24596937-24596959 GAACTGAAGCTACTGGATTTAGG + Intronic
1183530570 22:38351247-38351269 GCCCTACAGCCACTGGATCTGGG - Intronic
949367210 3:3295614-3295636 TCCCTATAGGTTCTGGATATTGG - Intergenic
953262965 3:41358120-41358142 GATCTCTAGCTACAGGACATTGG + Intronic
964995827 3:162879214-162879236 GACTTATAGACACTGGATCTGGG + Intergenic
970301284 4:14683933-14683955 TTCCTAAAGCTACTGGATACTGG + Intergenic
972137639 4:35911838-35911860 GACCTATGGATACAGGATACAGG - Intergenic
975451599 4:74533887-74533909 TTCCTAGAGCTAGTGGATATTGG + Intergenic
978984429 4:114992866-114992888 GAACTCTAGCTCCTGGGTATAGG + Intronic
979774872 4:124577771-124577793 GACAAATAGCTAATGCATATGGG - Intergenic
981238423 4:142445047-142445069 GACAAATAGCTAATGCATATGGG + Intronic
981564915 4:146090166-146090188 GACCTATATCTAGTGAATAATGG - Intergenic
982822792 4:159965268-159965290 GCCCTATTACTTCTGGATATAGG + Intergenic
982824997 4:159993187-159993209 GACAAATACCTAATGGATATGGG - Intergenic
983355063 4:166646374-166646396 GACAAATAGCTAATGGATGTGGG - Intergenic
990532276 5:56686352-56686374 GACCTGTAACTACAGAATATGGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
993797967 5:92293433-92293455 GTCCTACAGCTTTTGGATATTGG + Intergenic
993875139 5:93297824-93297846 AATCTATAGCTAGTGGATTTGGG - Intergenic
994009187 5:94879832-94879854 GACCCAAAGCTAATGGAAATAGG + Intronic
995778136 5:115747166-115747188 GACCAATGGCTACTGGAGGTTGG - Intergenic
996639603 5:125736304-125736326 GACAAATAGCTACTGCATGTGGG + Intergenic
997071186 5:130624058-130624080 TATCTAAAGATACTGGATATTGG + Intergenic
997632717 5:135380989-135381011 GACAAAGACCTACTGGATATGGG + Intronic
1000947862 5:167444232-167444254 GAGACATATCTACTGGATATTGG - Intronic
1001192630 5:169644749-169644771 GACAAATAGCTAATGCATATGGG - Intronic
1008275214 6:49536297-49536319 GACCTATAAATAGTGGAGATTGG + Intergenic
1009503227 6:64443235-64443257 GACCTGTAGCTACTTGGTTTTGG + Intronic
1010082892 6:71885276-71885298 GACAAATAGCTAATGTATATGGG + Intergenic
1018843663 6:167538611-167538633 TCCCTATAGATTCTGGATATTGG - Intergenic
1020525803 7:9256877-9256899 GACAAATAGCTAATGCATATGGG + Intergenic
1020705646 7:11540842-11540864 GTCCTAGAGCCACTGGATAGTGG - Intronic
1022747908 7:33191201-33191223 TACCTGTAGCTAGTGGATGTTGG + Intronic
1027530812 7:79329960-79329982 GACCTACAGCTGCTAAATATAGG + Intronic
1029332144 7:99867440-99867462 GACCAATAGCTAATGCATGTGGG - Intergenic
1030547519 7:110915633-110915655 TATCTATAGCTACTGTATGTGGG - Intronic
1031988455 7:128179056-128179078 GGCCTATACCTACTAAATATGGG - Intergenic
1038556706 8:28524809-28524831 TTCCAATGGCTACTGGATATAGG - Intronic
1039446857 8:37639878-37639900 GACCAATACCTAATGCATATGGG + Intergenic
1040057999 8:43077559-43077581 GAAATATTGCTACTGGAGATTGG + Intronic
1040587206 8:48755461-48755483 GACCTCTATCTACTGGCTTTTGG + Intergenic
1043577923 8:81679053-81679075 GACCTATAGATACTCTATTTAGG - Intronic
1046709383 8:117492629-117492651 GACAAATAGCTAATGTATATGGG + Intergenic
1050767842 9:9157834-9157856 GAAGAATAGCTAGTGGATATTGG - Intronic
1053797537 9:41740154-41740176 GACCGATAGCTTCAGGATGTGGG - Intergenic
1054185949 9:61952206-61952228 GACCGATAGCTTCAGGATGTGGG - Intergenic
1054467399 9:65505836-65505858 GACCAATAGCTTCAGGATGTGGG + Intergenic
1054652557 9:67636313-67636335 GACCGATAGCTTCAGGATGTGGG + Intergenic
1059895677 9:118861632-118861654 GACAAATAGCTAATGCATATGGG + Intergenic
1187078222 X:15957849-15957871 GATCAATAGCTACTGCATATGGG - Intergenic
1187119196 X:16387078-16387100 GATCAATAGCTACTGCATATGGG + Intergenic
1189813816 X:44804947-44804969 CACATATAGCTAATGGCTATTGG - Intergenic
1190959550 X:55232715-55232737 TCCCTATAGATTCTGGATATTGG - Intronic
1195906739 X:109851651-109851673 GGCCTAGAGCCACTGGAAATGGG - Intergenic
1197950802 X:131894264-131894286 GAAATATAGCTAATGGATGTTGG + Intergenic