ID: 1105464613

View in Genome Browser
Species Human (GRCh38)
Location 13:20626639-20626661
Sequence CAGTGCCAGTGAGAGATCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 240}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105464613_1105464615 -2 Left 1105464613 13:20626639-20626661 CCGCAGATCTCTCACTGGCACTG 0: 1
1: 0
2: 3
3: 17
4: 240
Right 1105464615 13:20626660-20626682 TGCTGCTCTCTTGCTAGCTTGGG 0: 1
1: 0
2: 1
3: 23
4: 327
1105464613_1105464616 1 Left 1105464613 13:20626639-20626661 CCGCAGATCTCTCACTGGCACTG 0: 1
1: 0
2: 3
3: 17
4: 240
Right 1105464616 13:20626663-20626685 TGCTCTCTTGCTAGCTTGGGTGG 0: 1
1: 0
2: 1
3: 17
4: 180
1105464613_1105464617 2 Left 1105464613 13:20626639-20626661 CCGCAGATCTCTCACTGGCACTG 0: 1
1: 0
2: 3
3: 17
4: 240
Right 1105464617 13:20626664-20626686 GCTCTCTTGCTAGCTTGGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 120
1105464613_1105464620 5 Left 1105464613 13:20626639-20626661 CCGCAGATCTCTCACTGGCACTG 0: 1
1: 0
2: 3
3: 17
4: 240
Right 1105464620 13:20626667-20626689 CTCTTGCTAGCTTGGGTGGGGGG 0: 1
1: 1
2: 1
3: 16
4: 163
1105464613_1105464618 3 Left 1105464613 13:20626639-20626661 CCGCAGATCTCTCACTGGCACTG 0: 1
1: 0
2: 3
3: 17
4: 240
Right 1105464618 13:20626665-20626687 CTCTCTTGCTAGCTTGGGTGGGG 0: 1
1: 0
2: 1
3: 14
4: 158
1105464613_1105464619 4 Left 1105464613 13:20626639-20626661 CCGCAGATCTCTCACTGGCACTG 0: 1
1: 0
2: 3
3: 17
4: 240
Right 1105464619 13:20626666-20626688 TCTCTTGCTAGCTTGGGTGGGGG 0: 1
1: 0
2: 2
3: 22
4: 387
1105464613_1105464614 -3 Left 1105464613 13:20626639-20626661 CCGCAGATCTCTCACTGGCACTG 0: 1
1: 0
2: 3
3: 17
4: 240
Right 1105464614 13:20626659-20626681 CTGCTGCTCTCTTGCTAGCTTGG 0: 1
1: 0
2: 0
3: 20
4: 217
1105464613_1105464622 14 Left 1105464613 13:20626639-20626661 CCGCAGATCTCTCACTGGCACTG 0: 1
1: 0
2: 3
3: 17
4: 240
Right 1105464622 13:20626676-20626698 GCTTGGGTGGGGGGTAGAGTGGG 0: 1
1: 0
2: 2
3: 53
4: 411
1105464613_1105464621 13 Left 1105464613 13:20626639-20626661 CCGCAGATCTCTCACTGGCACTG 0: 1
1: 0
2: 3
3: 17
4: 240
Right 1105464621 13:20626675-20626697 AGCTTGGGTGGGGGGTAGAGTGG 0: 1
1: 0
2: 4
3: 71
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105464613 Original CRISPR CAGTGCCAGTGAGAGATCTG CGG (reversed) Intronic
900490598 1:2947016-2947038 CAGAACCAGTAAGAAATCTGAGG + Intergenic
900561405 1:3308922-3308944 GCGTGCCGGTGAGAGATGTGTGG + Intronic
901621275 1:10589846-10589868 CAATGCCAGTGAGGGTGCTGTGG - Intronic
901882748 1:12203618-12203640 CAGTGCCTGGAAGAGATCAGGGG + Intronic
903331973 1:22601140-22601162 CTGTCCCAGGGACAGATCTGGGG - Intronic
903578647 1:24354639-24354661 CAGGGCCAGGGAGAGACCTAGGG + Intronic
905106329 1:35565643-35565665 CAGTGCCTGTCAGAGCCCTGAGG + Exonic
905310788 1:37047438-37047460 CAGTGCCAGGGAAAGATTCGAGG - Intergenic
906114348 1:43346503-43346525 AAGTGGCAGCGAGAGAACTGTGG - Exonic
909806209 1:79876196-79876218 CAGTGCCAGAGAGAGCCCTAGGG - Intergenic
910539010 1:88333446-88333468 CAGCACCAGTGAAAGGTCTGTGG + Intergenic
915462434 1:156078110-156078132 CAGGGTCAGTGACAGATGTGGGG - Intronic
915586959 1:156849123-156849145 CATTCCCAGTGAGACCTCTGAGG + Intronic
916641253 1:166730435-166730457 GAGTGCCAGGCAGGGATCTGTGG + Intergenic
920355717 1:205370849-205370871 CAGAGCCTATCAGAGATCTGGGG - Intergenic
920514492 1:206574684-206574706 CAGTGCCATAGAGGGACCTGTGG + Intronic
920533751 1:206723819-206723841 CAGCGGCAGTGAGGGAGCTGCGG - Intronic
923064933 1:230509062-230509084 GAGTGCCATTGCGTGATCTGGGG - Intergenic
923626102 1:235615242-235615264 CAGAGTCAGAGAGAGATCTGAGG + Intronic
924164547 1:241268214-241268236 CAGAGCCAGGAAGAGAGCTGAGG + Intronic
1063970389 10:11377733-11377755 CAGGCCGAGTGAGAGCTCTGGGG - Intergenic
1064323527 10:14328235-14328257 GAGTGCCAGGGACAGATCTAAGG + Intronic
1064507980 10:16054772-16054794 CAGTGCATGTGAGAGATTTCAGG - Intergenic
1065132423 10:22635648-22635670 CAGTGCCAGGCCGAGTTCTGTGG + Intronic
1068175138 10:53447784-53447806 CAGTGCCAAGGAGAAATGTGGGG - Intergenic
1068211075 10:53921631-53921653 CAGTGCCATTAAGAAAGCTGAGG - Intronic
1068652587 10:59539023-59539045 CTGTACCAGCGATAGATCTGAGG - Intergenic
1069135927 10:64765903-64765925 CAGAATCAGTGACAGATCTGAGG - Intergenic
1069753270 10:70758316-70758338 CAGGGCCACTGAAAGGTCTGGGG - Intronic
1069833737 10:71296069-71296091 CAGAGACAGTGAGAGATCCAGGG - Intronic
1071284404 10:84131386-84131408 CAGAGACAGAGAGAGATCTCTGG + Intergenic
1071677809 10:87672702-87672724 CAGTGACAATGAGATATCTTGGG + Intronic
1073914478 10:108386306-108386328 CTGTGCATGTGAGGGATCTGGGG + Intergenic
1074278943 10:112032888-112032910 CAGTGCCAGTGAGAAAGGTCAGG - Intergenic
1075510517 10:123068785-123068807 CAGTGACAGTTAGGAATCTGTGG + Intergenic
1075569238 10:123527322-123527344 CAGTGGCAGAGAGAGAAATGGGG - Intergenic
1075704238 10:124489897-124489919 TGGTGCCAGTGAGAAAGCTGAGG - Intronic
1076284409 10:129278893-129278915 CAATGCCAGTGACAGATCCTTGG - Intergenic
1076309434 10:129493691-129493713 CAGGCCCAGTGTGGGATCTGGGG + Intronic
1076410138 10:130243329-130243351 CAATGCCCTTGAGATATCTGTGG - Intergenic
1076672815 10:132132568-132132590 CAGTGGCTGTGAGAGGTCGGCGG - Intronic
1077580416 11:3413775-3413797 CAGTGGAAGTGAAAGAACTGGGG - Intergenic
1079117573 11:17650349-17650371 CAGAGCCACTGAGAGATTGGTGG + Intergenic
1079351014 11:19692058-19692080 AAGTGCCAGCGTGACATCTGTGG + Intronic
1080214584 11:29826816-29826838 CAGTCCCAGTGAGAGAACCTGGG - Intergenic
1081874245 11:46397758-46397780 CAGTGCCCGTCTGAGAGCTGCGG + Exonic
1081926546 11:46834154-46834176 CAGTGTCATTGAGAGATTTTAGG + Intronic
1083620949 11:64049142-64049164 CAGAGCCCCTGAGAGGTCTGGGG + Intronic
1084237344 11:67796604-67796626 CAGTGGAAGTGAAAGAACTGGGG - Intergenic
1084675277 11:70630380-70630402 CGGGGCCAGGAAGAGATCTGCGG + Intronic
1084775576 11:71372501-71372523 CAGGGCCAGCGAGAGAGCAGAGG + Intergenic
1084835058 11:71796224-71796246 CAGTGGAAGTGAAAGAACTGGGG + Intronic
1085199620 11:74693890-74693912 CAGTGACAGTGAGCTATTTGTGG + Intergenic
1088006588 11:104948498-104948520 CAGTGGCAGTAAGGGATTTGTGG - Intronic
1089500402 11:118928669-118928691 CACTGTCAGTCAGAGGTCTGGGG + Intronic
1092109338 12:5947901-5947923 CAGTACCAGTTAGTGATTTGGGG + Intergenic
1096078808 12:48820400-48820422 CAGAGCCAGAGAGAGATGGGAGG - Intronic
1096204864 12:49712830-49712852 AAGTGCTATTGAGAGAACTGGGG + Intronic
1096217117 12:49803872-49803894 CAGTGCCAGCCAGAGCCCTGGGG - Intronic
1096280563 12:50249214-50249236 CAGTGCCAGGGAGAGAGCTGGGG + Intronic
1101342167 12:103852532-103852554 CAGGCCCAGTCAAAGATCTGGGG - Intergenic
1101917690 12:108908710-108908732 CAGTGCTGATGAGAGCTCTGTGG + Intergenic
1102441869 12:112969748-112969770 CAGTGAAGGTGAGAGATCTGTGG + Exonic
1102723112 12:115034714-115034736 CAGTGCCAGAGAAATATTTGGGG + Intergenic
1103316961 12:120063932-120063954 CAGTGTCAGTGAGAAAACAGAGG - Intronic
1104760699 12:131296235-131296257 CAGTGACAATTAGAGCTCTGGGG + Intergenic
1104819076 12:131664557-131664579 CAGTGACAATTAGAGCTCTGGGG - Intergenic
1105464613 13:20626639-20626661 CAGTGCCAGTGAGAGATCTGCGG - Intronic
1105900871 13:24752189-24752211 CATTGCCAGGAAGAGATTTGTGG - Intergenic
1107431729 13:40346291-40346313 CAGAGGCAGAGAGAGGTCTGAGG - Intergenic
1108642456 13:52395492-52395514 AGGTGCCAGGGAGACATCTGAGG + Intronic
1110879834 13:80558202-80558224 CAGTGGCAGAGACAGAGCTGTGG - Intergenic
1113362764 13:109646105-109646127 GAATCCCAGGGAGAGATCTGGGG - Intergenic
1113483137 13:110636147-110636169 CAGCGCCAGCGAGGCATCTGGGG + Intronic
1113970030 13:114181583-114181605 TAGTGCCAGTTGGAGAACTGTGG - Intergenic
1120061023 14:79983005-79983027 ATGTGTCAGTCAGAGATCTGGGG + Intergenic
1121881332 14:97502996-97503018 CAGTGCCTAATAGAGATCTGGGG + Intergenic
1122411496 14:101528293-101528315 GAGTGGCAGTGAGAGAGCTGAGG + Intergenic
1202915376 14_GL000194v1_random:165736-165758 CAGTGGCAGGCAGAGTTCTGGGG - Intergenic
1126628582 15:50710323-50710345 TAGTGCCAGTGAGGTACCTGGGG - Intronic
1127484888 15:59409570-59409592 CAGTCCCGGTGAGTGATCTGTGG - Intronic
1128246803 15:66138579-66138601 CAGAGCCAGTGTGAGAGCAGAGG - Intronic
1128685347 15:69680484-69680506 CAGAGCCCGTGAGAAATGTGTGG + Intergenic
1129604255 15:77017141-77017163 CAGTGCCTGGGAGAGCTCAGGGG + Intronic
1129609401 15:77040888-77040910 CAGTGCCTGTGAGATCTGTGAGG - Intergenic
1129889375 15:79061018-79061040 AAGGGGCAGTGAGAAATCTGAGG + Intronic
1130699618 15:86165378-86165400 CAGAGGCAGTGAGTGATTTGGGG - Intronic
1131048080 15:89328815-89328837 CAGTCCCAGGATGAGATCTGGGG + Exonic
1131429331 15:92374098-92374120 GAGTGCCTGTGTGAGATGTGAGG - Intergenic
1133221734 16:4321809-4321831 CAGGGCCAGTGGGAGGCCTGGGG + Intronic
1133360039 16:5166936-5166958 CAGTCCCATTAAGAGAGCTGTGG - Intergenic
1133752705 16:8736994-8737016 CAGGGGCTGTGAGAGAGCTGGGG - Intronic
1134276651 16:12782376-12782398 CAATGCCAGAGCCAGATCTGGGG + Intronic
1134423002 16:14111988-14112010 CAATGCCCTTGAGAGATCAGGGG - Intronic
1136383475 16:29908184-29908206 CAGGGCCAGCGTGAGAGCTGTGG + Intronic
1137983665 16:53090517-53090539 TAGTGACAGTGAGGGTTCTGTGG + Intronic
1138150662 16:54653876-54653898 CAGGGTCTGTGAAAGATCTGTGG - Intergenic
1138340633 16:56286914-56286936 CAATGGCAAGGAGAGATCTGTGG - Intronic
1138919393 16:61508757-61508779 CAGTGCATGTGAGAGAACTTCGG + Intergenic
1140481095 16:75263303-75263325 CAATGCCAGCCAGAGGTCTGAGG + Intronic
1140990967 16:80210991-80211013 CAAGGCCAGTGAGAAAGCTGTGG + Intergenic
1141426427 16:83947374-83947396 CAGTGTGAGTGACAGAGCTGAGG - Intronic
1141479807 16:84298996-84299018 CTGTGCCAGTCAGGGAACTGTGG - Intronic
1142472936 17:173174-173196 CACTGCCATTGAGAGACTTGGGG - Intronic
1142859135 17:2750101-2750123 CACAGCTAGTGAGAGGTCTGGGG - Intergenic
1143287980 17:5805422-5805444 CAGAGCCAGGGAGATATCAGTGG - Intronic
1149853255 17:60054385-60054407 CAGTGCCAAAGAGAGATGTGAGG + Intronic
1151519388 17:74617424-74617446 CAGTGCCAGTCACAGAGCCGGGG + Exonic
1153466008 18:5388546-5388568 CAGTCCAGGTGAGAGATATGAGG + Intergenic
1153466525 18:5394565-5394587 AAATGCCAGTGAGAGAACAGAGG + Intronic
1154298878 18:13175406-13175428 CAGCGCCAGAGAGAGCCCTGAGG + Intergenic
1157080110 18:44515418-44515440 TAGTGACAGTGAGAGTTATGTGG + Intergenic
1158287180 18:55896510-55896532 CAGTCCCATTGAGAAAACTGAGG + Intergenic
1159053219 18:63441070-63441092 CAGAGGTAGTGAGACATCTGGGG - Intergenic
1162450235 19:10749949-10749971 CAGTGCCAGAGAGAACTCAGAGG + Intronic
1164758442 19:30708453-30708475 CAGTGGCCATGAAAGATCTGGGG + Intronic
1165583632 19:36892812-36892834 CAGCGCCTGTGGGGGATCTGGGG - Intronic
1166018365 19:40001247-40001269 CAGTGTCAGTCAGTGACCTGGGG + Intronic
1166222265 19:41373320-41373342 CACTTCCAGTGAGAGCTCTCTGG - Intronic
1166587310 19:43960912-43960934 CAGTGCCAAGGAGAAATGTGAGG + Intronic
1167380558 19:49135773-49135795 CACTGCCAGGGAGAGACCTGTGG - Exonic
1168098195 19:54127341-54127363 CAGAGTCAGAGAGAGGTCTGAGG - Intronic
925578366 2:5384198-5384220 CAGTGCCTGTGGGAGACCTGGGG - Intergenic
927082084 2:19640559-19640581 CACTCCCAGTGAGAGCACTGGGG - Intergenic
927159427 2:20243247-20243269 CAGTGCCAGTTACAGAGCTGAGG - Intergenic
928924407 2:36563401-36563423 CATTGCCAGTGAAAGAGCTGGGG - Intronic
932012771 2:67994677-67994699 AAGTGACAGTGAGAGTGCTGTGG + Intergenic
932442646 2:71747412-71747434 CAGTGCCAGTCAGGGATCTGTGG - Intergenic
932903164 2:75723410-75723432 CAGTCCCAGTGAGAGAGCTTTGG + Intergenic
935603746 2:104948733-104948755 CAGTGACAGTGAAAAAACTGGGG - Intergenic
935617600 2:105102390-105102412 CAGTGCCAGGAGGAGAGCTGAGG + Intergenic
935626317 2:105174994-105175016 CTGTGAAAGTGAGAGATCTATGG - Intergenic
935679830 2:105626298-105626320 CAGTCCCAGAGCGAGACCTGAGG - Intergenic
937271380 2:120655034-120655056 CATAGCCAGGGAGAGAGCTGGGG - Intergenic
937925058 2:127161857-127161879 CAGTGCCAGAAAGAGACCTAAGG - Intergenic
939509663 2:143089952-143089974 CAGAGCCAGTGAGGGCTGTGAGG + Intergenic
939556445 2:143679836-143679858 CAGTATCAGGGAGAGATCTCAGG + Intronic
939567012 2:143797126-143797148 CAGTCCCAGTGAATGAACTGTGG - Intergenic
940159082 2:150692436-150692458 CAGGGCCACTCAGAGAACTGAGG + Intergenic
941333502 2:164210270-164210292 AAGAGCCAGTGAGAGAGATGAGG + Intergenic
941583963 2:167333414-167333436 CAGAGGCAGTAAGAGGTCTGGGG - Intergenic
943701890 2:190996014-190996036 CAGGACCAGTCAGAGATGTGGGG + Intronic
943852207 2:192738335-192738357 CAGTTCGAGGGAGAGAACTGGGG + Intergenic
945058026 2:205885019-205885041 CACTACCAGTGAGGGAGCTGAGG - Intergenic
946129375 2:217594001-217594023 CAGTCCCGGGGAGAGGTCTGAGG + Intronic
946926367 2:224631177-224631199 CAGTGAGAGTAAGAGATCCGAGG + Intergenic
946951815 2:224884435-224884457 CAGTGCCATTGTGAAATTTGAGG + Intronic
947916912 2:233838664-233838686 CCGGCCCAGAGAGAGATCTGAGG - Intronic
948277763 2:236723177-236723199 TAGTGCCAGTCACAGAACTGGGG - Intergenic
1171000433 20:21409551-21409573 TAGTGTCAGTGAGAGATGTAGGG - Intergenic
1172124084 20:32614769-32614791 GAGAGCCAGTGGGAGATTTGAGG - Intergenic
1173104529 20:40121071-40121093 CAATGCCAGTGAGTAATGTGGGG + Intergenic
1173399338 20:42710654-42710676 CAGTGCCATGGAGAAATGTGGGG + Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175693572 20:61084271-61084293 CACTGCCAGTGAGTGGTCTCTGG - Intergenic
1176267913 20:64220399-64220421 CAGAGCCAGTGAGAGAGCTTAGG + Intronic
1176634726 21:9180380-9180402 CAGTGGCAGGCAGAGTTCTGGGG - Intergenic
1178595835 21:33951513-33951535 CAGTGCCACCCAGAGACCTGAGG + Intergenic
1179884411 21:44307289-44307311 CAGTCCCCGTGGGAGATTTGGGG + Intronic
1181363910 22:22358905-22358927 TAGTGACAGAGACAGATCTGTGG - Intergenic
1183008513 22:34925002-34925024 CAGAACCAGTGATAGATCAGTGG - Intergenic
1183251345 22:36732555-36732577 CAGTGTCAGGGAGAAATTTGAGG - Intergenic
1183539780 22:38423313-38423335 CAGTGCCAGTGTGGGCACTGGGG - Intergenic
950539191 3:13599820-13599842 AAGTGCCAGGGAGACATCTGGGG + Intronic
950667094 3:14504061-14504083 CAGTGACAGGGACAGAGCTGGGG + Intronic
950668390 3:14510987-14511009 CGGGGACAGTGAGAAATCTGTGG + Intronic
953573768 3:44096166-44096188 CCATGCCAGTGAAAAATCTGTGG - Intergenic
953860842 3:46542985-46543007 CTGTGGCAGTGAGGGATTTGTGG - Intronic
955183268 3:56691723-56691745 CAGAGCCAGTGAGGGCTGTGAGG - Intergenic
955754654 3:62215429-62215451 TAGTGTCAGTGAGAGACCTAAGG - Intronic
961301538 3:125925173-125925195 CAGTGGAAGTGAAAGAACTGGGG + Intergenic
961925729 3:130478312-130478334 CAGTGCCAGTTTTAGTTCTGTGG + Intronic
962565016 3:136649024-136649046 CAGTGTCAGAGAGAGATTGGAGG - Intronic
963071326 3:141307754-141307776 CAGGGACACTGTGAGATCTGTGG - Intergenic
963432317 3:145224241-145224263 CAGGGCCTGTCAGAGAGCTGGGG - Intergenic
964406601 3:156354760-156354782 CAGTGCCAGTGAGACAGGTAGGG + Intronic
966579954 3:181549806-181549828 GAGTGACAGTGAGAACTCTGTGG - Intergenic
967531298 3:190551217-190551239 CAGAGCCAATGAAAGCTCTGGGG - Intronic
969435841 4:7188957-7188979 CAGTGCCAGAGAAAGACATGGGG - Intergenic
969673162 4:8600940-8600962 CAGAGCCTGTGAGAGACCAGAGG - Intronic
970783538 4:19768229-19768251 CAGGGCCTGTGAGAGCTGTGGGG + Intergenic
971386893 4:26149048-26149070 CAGGGCCAGTGAGGGAAATGTGG - Intergenic
973982598 4:56318575-56318597 CAGGGACAGTGATAGATTTGGGG - Intronic
976596101 4:86896651-86896673 CAGAGCCACTGAGAGTACTGAGG - Intronic
977627711 4:99205533-99205555 CAGTCCCAGTGAAAGCTCTTGGG + Intronic
977871411 4:102094690-102094712 CAGTGCCACTGACAGCTGTGAGG + Intergenic
978071393 4:104475967-104475989 CAGTACCAGAAAGAGAACTGGGG - Intronic
980369239 4:131845615-131845637 CAGTCCCAGTCATGGATCTGAGG - Intergenic
981488723 4:145317331-145317353 CAGTGCAAGTGAGAGTCCTTTGG + Intergenic
981578677 4:146230525-146230547 GAGGGCCACTGAGAGGTCTGGGG - Intergenic
982843978 4:160226197-160226219 CAATTCCAGTCAGATATCTGGGG - Intergenic
983652574 4:170048405-170048427 CAGAGCCAGTGAGAGGAGTGGGG - Intergenic
983995145 4:174173761-174173783 CAGCCTCAGTGAGAGACCTGAGG + Intergenic
984770437 4:183432620-183432642 CTGTGCATGTGAGGGATCTGGGG - Intergenic
986504496 5:8434570-8434592 GAATGTGAGTGAGAGATCTGAGG + Intergenic
988475576 5:31582306-31582328 CAGTGTCTGTGAGTGATCTTGGG + Intergenic
990881006 5:60539415-60539437 CAGAGCAATTGAGAGATCAGGGG - Intergenic
992015096 5:72567474-72567496 CAGACCCAGAGAGAGATTTGGGG + Intergenic
992186782 5:74251953-74251975 CTGAGGCAGTGAGAGATCAGGGG - Intergenic
992420013 5:76594237-76594259 TGTTGCCAGTGAGACATCTGAGG + Intronic
993031145 5:82707264-82707286 CAATGCCATGGAGAGATTTGAGG + Intergenic
993117449 5:83734982-83735004 CTGTGGAACTGAGAGATCTGTGG + Intergenic
993549264 5:89253763-89253785 CAGTGCCTGGGAGATAACTGAGG + Intergenic
994298669 5:98121123-98121145 CAGTCCCAGTGAGAGAACCTGGG - Intergenic
995462956 5:112421363-112421385 CAGTGGCAGTGAGAAGGCTGAGG + Intergenic
1004528263 6:16429293-16429315 CAGTGCCAGTGAGAAACTTGGGG - Intronic
1004817159 6:19324356-19324378 CAGAGCCAGTGAAAAAGCTGTGG + Intergenic
1005978318 6:30816813-30816835 CAGAGCGAGTGAGAGCTGTGAGG + Intergenic
1006193642 6:32223980-32224002 CTGCCCCAGTGAGAGCTCTGAGG - Exonic
1006603760 6:35242529-35242551 TAGTTACAGTTAGAGATCTGGGG + Intronic
1007130369 6:39466757-39466779 AAGAGCAAATGAGAGATCTGGGG + Intronic
1007693908 6:43719699-43719721 CACTGCCAGGCAGGGATCTGTGG - Intergenic
1010365985 6:75051495-75051517 CAGGGCCAGCCAGAGACCTGAGG + Intergenic
1011087893 6:83562814-83562836 GAGTGAGAGTGAGGGATCTGTGG - Intronic
1011197893 6:84801023-84801045 CATTGCCAGTGCAAGTTCTGGGG + Intergenic
1012763530 6:103333122-103333144 CAGTTCCTGTGAGAGATGTTTGG - Intergenic
1013634520 6:112016416-112016438 CAATGTCTGTGACAGATCTGGGG + Intergenic
1014110901 6:117617608-117617630 CAGTGCCAGGGGGAGAGCAGAGG + Intergenic
1017280450 6:152618491-152618513 AAGTGCCAGTGACACATGTGAGG + Intronic
1020320362 7:6935098-6935120 CAGTGGAAGTGAAAGAACTGAGG - Intergenic
1021624913 7:22583567-22583589 CAGTTACAGTGAGACATCTGGGG - Intronic
1022418037 7:30195114-30195136 CAGAGTGAGTGGGAGATCTGTGG - Intergenic
1023234223 7:38066916-38066938 CAATCCCAGGGAGAGAGCTGTGG - Intergenic
1023689623 7:42772698-42772720 CACTTCCAGTTAGAGATGTGCGG + Intergenic
1024840807 7:53585179-53585201 CAGGGACAGTGAGAGCTCAGAGG - Intergenic
1026033908 7:66817400-66817422 CAGTGCCAGGCACAGAGCTGGGG + Intergenic
1026985683 7:74553956-74553978 CAGTGCCAGGCACAGAGCTGGGG - Intronic
1027535716 7:79398461-79398483 CAGTGACATTGACAGATTTGGGG - Intronic
1027586664 7:80066508-80066530 CAGTGCCAAGGAGAAATGTGGGG - Intergenic
1032011580 7:128351221-128351243 CAGGGCCAGTGAGAGATCAGGGG - Exonic
1033581539 7:142741636-142741658 CAGTGCAAGAGAGGGTTCTGTGG + Intergenic
1033763636 7:144464043-144464065 CAGTGGCTGTGAGAGATCAGCGG - Intronic
1033763647 7:144464103-144464125 CAGTGGCTGTGAGAGATCAGTGG - Intronic
1034098826 7:148434695-148434717 GAGTGCCAGTGATACACCTGAGG - Intergenic
1036579773 8:10063140-10063162 CAGTGCCACTGAGAGAGGTTGGG - Intronic
1037502855 8:19501948-19501970 CAGTGCCAATGGAACATCTGGGG + Intronic
1039336190 8:36592329-36592351 CTGTGCCAGTGAGAGATACTTGG + Intergenic
1042316238 8:67429136-67429158 CAGTACCTGTGTAAGATCTGTGG - Intronic
1043997975 8:86842893-86842915 CAGTACCAGTCAGAGTTGTGAGG + Intergenic
1044474785 8:92613431-92613453 CTGGGCAAGTGAGAGAGCTGGGG + Intergenic
1044760169 8:95509688-95509710 CAGTGGCAGTGGGAAATGTGAGG + Intergenic
1045292934 8:100849315-100849337 CAGTGTCAGATTGAGATCTGTGG + Intergenic
1045408114 8:101888033-101888055 CAGTCCCAGTGAAAGTTCTGAGG + Intronic
1047938847 8:129807990-129808012 CAGTGCCAAGGGGAGATATGGGG + Intergenic
1049308616 8:141921266-141921288 CAGGGCCGGTGAGAAAGCTGAGG + Intergenic
1049805474 8:144536830-144536852 CAGTGCCAGCGAGCTTTCTGTGG - Intronic
1051678290 9:19580719-19580741 CAGAGACAGTGAGAGAGCTAGGG - Intronic
1052187763 9:25619969-25619991 CAGTGCAAGAGAGAAATATGGGG - Intergenic
1052729450 9:32267838-32267860 CAGAGGCATTGAGAGATCTTTGG - Intergenic
1053052901 9:34976529-34976551 CAGTGTCAGGGAGCAATCTGTGG - Exonic
1055955147 9:81766287-81766309 ATGTGACAGTGGGAGATCTGGGG + Intergenic
1058394213 9:104531303-104531325 AAGTTGGAGTGAGAGATCTGTGG + Intergenic
1059974976 9:119706328-119706350 CATGGACAGTGAGAGAGCTGAGG - Intergenic
1061466716 9:130786178-130786200 CAGGGCCAGGGAAACATCTGAGG + Intronic
1203757507 Un_GL000218v1:147689-147711 CAGTGGCAGGCAGAGTTCTGGGG - Intergenic
1188860522 X:35250883-35250905 CAGTCCCAGTAAGAGAACTTTGG - Intergenic
1190992383 X:55565935-55565957 CAGTCCCAGTGAGAGAACCTGGG - Intergenic
1191758543 X:64622430-64622452 CAGTGACATTGAGAGCTATGGGG - Intergenic
1193209464 X:78789160-78789182 CAGTCCCAGTGAGAGAACCTTGG - Intergenic
1197623992 X:128782046-128782068 GAGTGCCAGGCTGAGATCTGTGG + Intergenic
1198958237 X:142156068-142156090 CAGTCCCAGTAAGAGAACTTTGG - Intergenic