ID: 1105466558

View in Genome Browser
Species Human (GRCh38)
Location 13:20647643-20647665
Sequence TACCTAATGCTGCTGAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105466558_1105466559 6 Left 1105466558 13:20647643-20647665 CCATTCTTCAGCAGCATTAGGTA 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1105466559 13:20647672-20647694 TTTAATATTGATTGTGATGATGG 0: 1
1: 4
2: 50
3: 366
4: 1167
1105466558_1105466560 30 Left 1105466558 13:20647643-20647665 CCATTCTTCAGCAGCATTAGGTA 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1105466560 13:20647696-20647718 TATTATAAGACACCATCAAGTGG 0: 1
1: 0
2: 1
3: 19
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105466558 Original CRISPR TACCTAATGCTGCTGAAGAA TGG (reversed) Intronic
902075491 1:13781253-13781275 TATCTATTCATGCTGAAGAATGG + Exonic
902969844 1:20039514-20039536 TACAAATTGCTGCTGAGGAATGG + Intronic
903196868 1:21696699-21696721 TACCTAAAGGTGCTGTAAAAAGG + Intronic
906970174 1:50505082-50505104 TATCTAACACTGCTGAAGAGTGG + Intronic
907256955 1:53186602-53186624 TACCTCTTGGTGCTGAGGAAGGG + Intergenic
908736879 1:67285783-67285805 TAACTAGTGCTCCTGCAGAAAGG - Intergenic
913326915 1:117635473-117635495 TACCAAATGCTCCTGATGAGAGG + Intergenic
916014635 1:160739080-160739102 TACCAAATGCTGATGAAGATGGG + Intronic
916461878 1:165033699-165033721 TAAGTAATGCAGCTGAAGACAGG + Intergenic
916709702 1:167392785-167392807 TACATACTACTGCTGCAGAATGG + Intronic
918454407 1:184693316-184693338 TACTTAATACTTCTGAAAAATGG - Exonic
922199593 1:223390724-223390746 TCCCAAATGCAGCTGGAGAAAGG - Intergenic
1067756830 10:49011807-49011829 TTCCAGATGCTGCTGAAGACAGG + Intergenic
1067789957 10:49280286-49280308 TACCTAATGCTGCCAAAGATGGG + Intergenic
1068236432 10:54240357-54240379 TATCCAATGCTGATGAACAAAGG + Intronic
1072007365 10:91266109-91266131 TACCCAATACTGTTGAGGAATGG + Intronic
1072046828 10:91665346-91665368 TACCAAATGTTGATGAAGATAGG + Intergenic
1072529185 10:96302488-96302510 TACCAAATGGTGCTGCAGCAGGG - Intergenic
1072811001 10:98461749-98461771 TACCTAATTCTTCAGAAGAAAGG - Intronic
1073211268 10:101804970-101804992 TTCCTAACGCTGCTTAAGGATGG + Intronic
1074211916 10:111343049-111343071 GACCTAAGGATGCTGAATAAAGG - Intergenic
1077866849 11:6229511-6229533 TACCTCAGTCAGCTGAAGAAAGG + Intronic
1078081498 11:8207581-8207603 TCATTAATGATGCTGAAGAAGGG - Intergenic
1078467102 11:11558582-11558604 TCCCTGATGCTTCTAAAGAAGGG - Intronic
1086213716 11:84351774-84351796 AACCTAAATCTGCTGAAGCAAGG - Intronic
1088177125 11:107066387-107066409 TACCTACTGAAGCTGAAGGAGGG - Intergenic
1088912235 11:114200323-114200345 TACCTACTGTGTCTGAAGAAGGG + Intronic
1100912095 12:99376497-99376519 TAGGAAATGCTGCTGAGGAAAGG + Intronic
1105466558 13:20647643-20647665 TACCTAATGCTGCTGAAGAATGG - Intronic
1105658507 13:22467048-22467070 TAGCTATTGCTACTAAAGAAGGG + Intergenic
1106283681 13:28300219-28300241 AAGCAAATGCTGCTGAAGAGAGG - Intergenic
1108927055 13:55763921-55763943 AACCTAATGCTGCAGAAAAGTGG - Intergenic
1112136765 13:96587465-96587487 TACCTCATGCTTCTGCAGACAGG + Intronic
1112308799 13:98299671-98299693 TTCCTAAGGCTGCAGAAGGATGG - Intronic
1114846987 14:26334410-26334432 TGCTAAATGCTGCTTAAGAAAGG - Intergenic
1115900389 14:38140749-38140771 GACCCAAACCTGCTGAAGAAGGG - Intergenic
1119579645 14:75766025-75766047 TCACTAATGTTGCTGAAAAAAGG - Intronic
1121054701 14:90843117-90843139 TTCCTAAGGCTGCAGAAGACTGG - Intergenic
1121896803 14:97656322-97656344 TTCCTAATACTGCTGCAGAGTGG + Intergenic
1122952855 14:105055395-105055417 TGCCCAATGCTACTGAAAAACGG - Exonic
1124995550 15:34720020-34720042 CACCTAGTGCTGCTGGAGAAGGG - Intergenic
1126389754 15:48134065-48134087 TACTTAATGCTTCTATAGAAAGG - Intronic
1127365128 15:58282458-58282480 TGCCTTATGCTACTGAACAAAGG + Intronic
1128945716 15:71819112-71819134 TACCTAATGCTGCTTAACTTTGG + Intergenic
1129177997 15:73853938-73853960 TACCTATTGCTTAGGAAGAAGGG - Intergenic
1131306008 15:91243776-91243798 AATCCAATGCTGCTGAAGCAAGG + Intronic
1135482016 16:22828508-22828530 TTCCCAAAGCTGCTGAAGCATGG + Intronic
1135641552 16:24123946-24123968 TTCCTAATGGTGCTGGGGAAAGG + Exonic
1137616075 16:49847810-49847832 TACTTAATGCCTCTGAAAAATGG + Intronic
1143612926 17:8030381-8030403 TACGTACTTCTGCTGAAGCAGGG - Intergenic
1149296711 17:55267737-55267759 TACTAAATGCTGCAGAAGAAGGG - Exonic
1151562618 17:74878640-74878662 TCCCTAACCCTGCAGAAGAAAGG + Intronic
1153519274 18:5936988-5937010 GCTCTGATGCTGCTGAAGAAAGG + Intergenic
1155736087 18:29224221-29224243 AATCTAATGCTGCTGATGATCGG - Intergenic
1155761380 18:29572286-29572308 TACCTAAGGTAACTGAAGAAAGG + Intergenic
1156659598 18:39331156-39331178 TACCTAATACTGCTGTGGATAGG + Intergenic
1163786580 19:19277794-19277816 TACCAGATGCTGATGAAGATGGG - Exonic
1166565017 19:43759199-43759221 CATCTAAAGATGCTGAAGAACGG + Intergenic
925654738 2:6134059-6134081 TAGCTAATGATGCTGACAAACGG + Intergenic
927260638 2:21085536-21085558 CAATAAATGCTGCTGAAGAAAGG - Intergenic
927537169 2:23872597-23872619 TTACTAATGTTGCTGTAGAAAGG + Intronic
928240162 2:29579078-29579100 TACCTAGAGATGCTGAAGAAAGG - Intronic
930972535 2:57414236-57414258 TAACAAATGCTACTGAGGAAGGG + Intergenic
934167532 2:89307989-89308011 CACCCCATGCTGCTGAGGAATGG + Intergenic
934199743 2:89874457-89874479 CACCCCATGCTGCTGAGGAATGG - Intergenic
934715732 2:96542232-96542254 CATCTAATGCTGCAGAAGAGGGG + Intronic
935865602 2:107384563-107384585 GACCCACTGCTGCTGAAGGATGG + Intergenic
936480887 2:112883900-112883922 TAACTACTGTTGCTGAAGAAAGG + Intergenic
937766125 2:125662595-125662617 TACCTGGTGCTGCTCTAGAATGG - Intergenic
938728295 2:134125952-134125974 TACCCCATGCTCCTAAAGAAAGG - Intronic
939586880 2:144016675-144016697 AACGTACTGCTGTTGAAGAAAGG + Intronic
940443201 2:153744320-153744342 TACCAAATGCTGGTGAGGAGTGG - Intergenic
944301726 2:198131314-198131336 TACCTAACTCTGTTGAAGATGGG - Intronic
944659842 2:201912267-201912289 TACCTACTGCTGCTGGGGGACGG + Intergenic
946626191 2:221614311-221614333 TACCTAATGCTTTTGGAGGAGGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170905269 20:20509779-20509801 TACCATATGCTTCTGAAGGATGG + Intronic
1172325076 20:34028325-34028347 TTCCTACTACTTCTGAAGAATGG - Intronic
1173105746 20:40132414-40132436 TACCAAGTGCTGCTCAACAAAGG - Intergenic
1173515181 20:43660239-43660261 TACCAAATGTTGATGAAGATGGG - Intergenic
1177114503 21:17069483-17069505 TCCCTAATCCTTCTGAAGATTGG - Intergenic
1177452991 21:21296283-21296305 AACCCAATGCAGCTGAAGACAGG + Intronic
1177890178 21:26795452-26795474 TTCCTAAAACTGCTTAAGAAAGG + Intergenic
1181419828 22:22790027-22790049 AACCTAATCTTGCTGAGGAAGGG - Intronic
1182684406 22:32110421-32110443 TACCTACTGGAGCTGCAGAAGGG + Exonic
952191586 3:31028612-31028634 AGCTTAATGCTGCTGAAGGAGGG - Intergenic
953305084 3:41821580-41821602 TAGCTAATGACCCTGAAGAAGGG - Intronic
955944559 3:64180348-64180370 TATTTAATGCTGCTGAAAAGTGG - Intronic
955967409 3:64402743-64402765 TAACTAATGATGCTTAATAATGG + Intronic
956085462 3:65604379-65604401 TAGCAAATACTGCTGGAGAAAGG + Intronic
957408353 3:79801924-79801946 TATCTAGTGCTGCTAAAGCAAGG - Intergenic
960930920 3:122848967-122848989 TACCAGCTGCTGATGAAGAAGGG - Intronic
962267023 3:133951160-133951182 TACCTGATGGAGTTGAAGAAAGG - Intronic
962687815 3:137864349-137864371 TACATGAAGCTGCTAAAGAAAGG + Intergenic
966338716 3:178901341-178901363 TGCCTCATGCTTCTGAAGAGTGG - Intergenic
971726889 4:30326196-30326218 TACCTAAGGATGCTGAACATAGG + Intergenic
973116084 4:46461372-46461394 TAACAAATGCTGGTGAAGATGGG + Intronic
973635365 4:52857360-52857382 TCCCTAATTCTGCGGAAGAAGGG - Intergenic
974982611 4:68978709-68978731 TACCTCATGTGGCTGATGAAAGG - Intergenic
974994843 4:69142008-69142030 TACCTCATGTGGCTGATGAAAGG + Intronic
975395027 4:73864535-73864557 TACCTGATGCAGCTGAGGCAGGG + Intergenic
975666192 4:76737572-76737594 TACCAAATGCTGGTGAGGATGGG - Intronic
975978376 4:80125993-80126015 TACCTAGTGCCGCAGATGAAAGG - Intergenic
978830468 4:113078157-113078179 TACATAATCATGCTAAAGAACGG + Intronic
978877619 4:113660763-113660785 CAGCTACTGCTGCTGAAGTATGG - Intronic
979098523 4:116583773-116583795 AACCCATTGCAGCTGAAGAAAGG - Intergenic
981138426 4:141238938-141238960 TACCTCCTTCTGATGAAGAAAGG - Intergenic
981557612 4:146012272-146012294 TAGCGAATTCTGTTGAAGAAGGG - Intergenic
981674563 4:147326621-147326643 AACCTAATGATTCTTAAGAATGG + Intergenic
984126042 4:175812233-175812255 TACCAGATTCTACTGAAGAAAGG - Exonic
986361778 5:6985347-6985369 TACCAAATGCTGCTGAGGAATGG - Intergenic
986746582 5:10750231-10750253 TTCTTTATGCTGCTGATGAACGG + Intronic
986812854 5:11378292-11378314 TTCCTAATGCTTATGAGGAAGGG + Intronic
990473984 5:56143859-56143881 ACACAAATGCTGCTGAAGAAGGG - Exonic
991401098 5:66252393-66252415 TATCTCATGCTACTGAGGAATGG - Intergenic
993774834 5:91980391-91980413 TAGCTATAGTTGCTGAAGAAAGG + Intergenic
996447846 5:123577326-123577348 TTCCTAGTTCTGCTGCAGAAAGG - Intronic
997274783 5:132575555-132575577 CTCCTAATGATGCTGAATAAAGG + Intronic
1002350581 5:178580709-178580731 CACTAAATGCTGCTCAAGAAAGG + Intronic
1003002863 6:2352236-2352258 TACCCTATGCTGCTGGTGAAAGG + Intergenic
1005326730 6:24709105-24709127 TGGCTAGTGCTACTGAAGAATGG - Intronic
1008369050 6:50713015-50713037 AACCTAATGCTACTGCTGAACGG + Intergenic
1008709493 6:54207540-54207562 TACATAAGGCAGCTGAAGAGGGG - Intronic
1010068032 6:71708963-71708985 TAGGAAATGATGCTGAAGAATGG - Intergenic
1010206712 6:73328871-73328893 GACCTAATCCTTCTGGAGAAAGG - Intergenic
1012118078 6:95330166-95330188 TATCTAATGCTGCATAAGAAAGG + Intergenic
1012710510 6:102597246-102597268 TACCTACTGCTGCTTACAAATGG - Intergenic
1015626226 6:135182594-135182616 GACCTAAGGCGGCTGAAGGAGGG - Intronic
1016917401 6:149257501-149257523 GACCGAATGCAGCTGAAGTAGGG + Intronic
1019404059 7:873823-873845 TACCTACTGGTGCTGAAAAAAGG - Exonic
1023688180 7:42758405-42758427 TACCAAATGCTGGTGAAGCTGGG - Intergenic
1024800076 7:53066947-53066969 TACTTACTGATGCTGATGAAAGG + Intergenic
1025860157 7:65319242-65319264 TCTCTAATGCTGAAGAAGAATGG + Intergenic
1027835465 7:83235861-83235883 TACCTACTGCTGCTGGTAAATGG - Intergenic
1029863225 7:103597873-103597895 CAGCTAATGGGGCTGAAGAAAGG + Intronic
1030058234 7:105601881-105601903 AACCAAATGCTGCTGCAAAATGG - Intergenic
1031486304 7:122330313-122330335 TACTAAATGATCCTGAAGAATGG - Intronic
1033421819 7:141210511-141210533 TACTTAATGTGGCTGTAGAATGG + Intronic
1037029752 8:14090484-14090506 AACCTACTCCTGCTGGAGAAAGG + Exonic
1039366217 8:36930790-36930812 TATCTAATGCAGCTGAAGGATGG - Intronic
1039922778 8:41904990-41905012 CTCCTAATACTGCTGTAGAAAGG - Intergenic
1043764955 8:84119562-84119584 TACCTAGTGCTGCTCATGACTGG - Intergenic
1046083299 8:109399317-109399339 AACCAAATTCAGCTGAAGAAGGG + Intronic
1047916545 8:129590211-129590233 TACCAAATGCTGATGGAGAAAGG - Intergenic
1048740743 8:137557619-137557641 TAAGCAATGCAGCTGAAGAAAGG + Intergenic
1051094243 9:13447143-13447165 TTTCTAATGCCGCTGAGGAATGG - Intergenic
1057380945 9:94567106-94567128 TACTGAATGCTTATGAAGAAAGG + Intronic
1061020589 9:128011892-128011914 TGCCACATGATGCTGAAGAAGGG - Intergenic
1189996822 X:46646933-46646955 TTACTGATGCTGCTGTAGAAGGG + Intronic
1190841487 X:54148990-54149012 TACCAAATGCTGGTAAGGAATGG + Intronic
1190900900 X:54672264-54672286 TTACTAATGCTGCTATAGAAGGG - Intergenic
1193334268 X:80269383-80269405 TACCAAATGTTGCTGCAGAGAGG - Intergenic
1194039717 X:88925221-88925243 TACTTTATGCTGCTGAATATAGG - Intergenic
1195138612 X:101935437-101935459 CACCAAATGCAGCTGAAGGATGG - Intergenic
1198114087 X:133528127-133528149 TGCCTAATGGTGCTGACGACCGG + Intergenic