ID: 1105466994

View in Genome Browser
Species Human (GRCh38)
Location 13:20653260-20653282
Sequence CTTTCTAAGTAGAAGCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105466994_1105466996 -4 Left 1105466994 13:20653260-20653282 CCATCAGGCTTCTACTTAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1105466996 13:20653279-20653301 AAAGGAGATTCAAAAAAATGAGG 0: 1
1: 0
2: 4
3: 90
4: 758
1105466994_1105466997 18 Left 1105466994 13:20653260-20653282 CCATCAGGCTTCTACTTAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1105466997 13:20653301-20653323 GCGAGCATAAATTGTTCCCTAGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105466994 Original CRISPR CTTTCTAAGTAGAAGCCTGA TGG (reversed) Intronic
900005166 1:40518-40540 ATTTTTAAGTACAAGTCTGAAGG - Intergenic
901154711 1:7127830-7127852 CTTCCTAAGGATAGGCCTGAGGG - Intronic
904879217 1:33682221-33682243 CTTTGTAAGAAGAAGACAGAGGG - Intronic
905616561 1:39404809-39404831 ATTTCTAAGTAGAGAGCTGAAGG - Intronic
905923822 1:41736127-41736149 CTTCCTAAGTGGGAGCGTGAAGG - Intronic
906266987 1:44439658-44439680 CTTTCTAAGGATAAGCCAAAAGG - Intronic
907772963 1:57484356-57484378 TTTTCTACGTAGCAGCCTGAGGG - Intronic
908792345 1:67795295-67795317 CTTTCCACCTAGAAGTCTGACGG + Intronic
910504320 1:87932428-87932450 CCTTCTAGGAAGAAGCCAGAGGG + Intergenic
911324653 1:96455838-96455860 CTTTTTAAATATAAGACTGAAGG - Intergenic
914803601 1:150976911-150976933 CTTTGGAATTAGAAGGCTGAAGG - Intergenic
920348888 1:205324474-205324496 CTTTTTAAGTTGAGACCTGAAGG + Intergenic
920530620 1:206699442-206699464 GTTTCTAAGGAGAAGTGTGAGGG + Intronic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
923424975 1:233859728-233859750 CCTGCTCAGAAGAAGCCTGATGG - Intergenic
923763000 1:236864182-236864204 CTTTGTAATGAAAAGCCTGATGG + Intronic
924405400 1:243739860-243739882 ATTTCTAATTTGAAACCTGAGGG - Intronic
1062865080 10:845651-845673 ATTTCTAAGAAGATGCCAGAGGG + Intronic
1063237104 10:4128384-4128406 CTTTCTAATTAGATCTCTGAAGG + Intergenic
1064009096 10:11721095-11721117 CTTTCTCCTTAGAAGCCCGAGGG + Intergenic
1064589400 10:16873143-16873165 CTTTCCATACAGAAGCCTGATGG - Intronic
1064602214 10:17005522-17005544 TTTTCTAAGTAGAAGCAGCAAGG - Intronic
1065275991 10:24086077-24086099 ATTTCTAAGTAGGAGGCTGAGGG - Intronic
1070407314 10:76108396-76108418 CTTTCTAATTGGAAGACTGATGG - Intronic
1070758402 10:79007800-79007822 CTTGCTGGGTAGAAGCCAGAAGG - Intergenic
1071279044 10:84082896-84082918 ATTTCTAATTAGAAGTTTGATGG + Intergenic
1071524604 10:86351164-86351186 CTTTCATTGTAGAAGCCTCATGG - Intronic
1079316159 11:19409556-19409578 CTTTCTAAGTGGAATGGTGAAGG + Intronic
1082873116 11:57961922-57961944 ATTTCTAAGTAGAGGCTTGAGGG + Intergenic
1085440133 11:76553928-76553950 CTTTATAAATAGAAAACTGAGGG + Intergenic
1086159364 11:83704148-83704170 CTTTCTAAGTAAAAGCTGGCAGG + Intronic
1087495934 11:98890772-98890794 GCTTCCAAGTATAAGCCTGAGGG - Intergenic
1089719367 11:120398963-120398985 CTTTCCAAGTAGAACTCTAATGG - Intronic
1089938128 11:122386616-122386638 CTTTCTTAGCAAATGCCTGAGGG - Intergenic
1090447238 11:126774864-126774886 CTTTAAAAATAGAAGCTTGAGGG - Intronic
1090552562 11:127839022-127839044 CTTTCTAAGGAGATTACTGAAGG - Intergenic
1090760461 11:129832756-129832778 CTTTTTAAGTAGAAGAGTAATGG + Intronic
1091379151 12:44693-44715 ATTTTTAAGTACAAGTCTGAAGG - Intergenic
1100375336 12:94010334-94010356 GTTTCTTTGTAGAAGCATGAGGG + Intergenic
1100775347 12:97967312-97967334 ATTTCTAAGTTGAAGCCCTATGG - Intergenic
1104180557 12:126376201-126376223 CCTTTTAAGCAGAAGCCAGAGGG + Intergenic
1105466994 13:20653260-20653282 CTTTCTAAGTAGAAGCCTGATGG - Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105705289 13:22964512-22964534 CCTTCTCAGGAGAAGGCTGAAGG - Intergenic
1106460746 13:29965543-29965565 TTTTCTGAGAAGAAGCCTCAAGG - Intergenic
1108618248 13:52156990-52157012 CTATTTAAGCTGAAGCCTGAAGG + Intronic
1112202515 13:97290860-97290882 CTTTCTGAGCTGAGGCCTGAAGG + Intronic
1116260344 14:42616540-42616562 CTTTCCATGAAGAAGCCTGCAGG - Intergenic
1117905552 14:60581996-60582018 ATTACTATGTAGAAGCCTGCGGG - Intergenic
1119315635 14:73692148-73692170 CTTTCTACGTACAACCCTGAAGG - Intronic
1120509998 14:85401695-85401717 CTTTCCAGCTAGAAGCCTCAGGG + Intergenic
1121172075 14:91863040-91863062 CTTTCTAAGAAGCAGCCCTATGG - Intronic
1122735185 14:103835049-103835071 TTTGCTAAGAAGAAGCCTCATGG + Intronic
1124110246 15:26778654-26778676 ATTTCTATAAAGAAGCCTGATGG + Intronic
1124322063 15:28721465-28721487 CTTTCTAAGTAAAAGTTTAATGG + Intronic
1124523163 15:30423307-30423329 CTTTCTAAGTAAAAGTTTAATGG + Intergenic
1124535503 15:30542909-30542931 CTTTCTAAGTAAAAGTTTAATGG - Intergenic
1124763151 15:32464687-32464709 CTTTCTAAGTAAAAGTTTAATGG + Intergenic
1124775476 15:32584372-32584394 CTTTCTAAGTAAAAGTTTAATGG - Intergenic
1131072185 15:89472853-89472875 CTCTCTCTGTAGATGCCTGAAGG - Exonic
1132448347 15:101950426-101950448 ATTTTTAAGTACAAGTCTGAAGG + Intergenic
1135783908 16:25330767-25330789 ATTTCTAAGCAGAAGCTTTAAGG + Intergenic
1135892616 16:26371297-26371319 CTTTCTCTGGAGAACCCTGATGG + Intergenic
1140098773 16:71896580-71896602 CTTTCCCAGTAGAAGCCTTTTGG + Intronic
1147145668 17:38483067-38483089 CTTTCTCTGTAGAAGGCAGAGGG + Intronic
1149613328 17:57975050-57975072 CTTTCTGAGCACAAGCCTGGGGG + Intronic
1150206722 17:63414636-63414658 CTTTCAAGGTAGAATTCTGAGGG - Intronic
1154099028 18:11451488-11451510 CTCTTTAAGTTGAAGTCTGATGG + Intergenic
1156038129 18:32789015-32789037 CATTCTAAGCAGAAGATTGAAGG - Intergenic
1157924586 18:51749447-51749469 CTTTCTAAGTGGAAGCAACATGG + Intergenic
1160636920 19:82127-82149 ATTTTTAAGTACAAGTCTGAAGG - Intergenic
1162971934 19:14185947-14185969 CTATCTGAGCAGAGGCCTGAAGG - Intronic
927423822 2:22959037-22959059 ATTACTAAGCAGAGGCCTGATGG + Intergenic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
930222242 2:48756320-48756342 CTTACCATGTAGAAGCCAGAAGG - Intronic
933628784 2:84633069-84633091 CATTCTATGAAGAAGCCTGCTGG - Intronic
936564556 2:113572914-113572936 ATTTTTAAGTACAAGTCTGAAGG + Intergenic
936980395 2:118259175-118259197 ATTTCTAAAAAGAAGCCTGCTGG + Intergenic
938622864 2:133075160-133075182 CTTTCTAATTAGAAATCTAAAGG - Intronic
942990321 2:182192794-182192816 CTTTCAGAGAAGAAACCTGAAGG - Intronic
943002747 2:182349546-182349568 CTTTCTAATCAGAAGATTGATGG - Intronic
943851660 2:192730812-192730834 ATTAATAAGTAGAAGCATGAAGG + Intergenic
944096285 2:195972451-195972473 CTTTCTGAATGTAAGCCTGAGGG + Exonic
944170438 2:196770721-196770743 CTTCCAAAATAGAAGCCAGAAGG - Intronic
946494765 2:220184691-220184713 CCTTCTAAGAAGAAACCTTAGGG - Intergenic
947939072 2:234033201-234033223 CTTTCTGAGTGGCTGCCTGAGGG + Intergenic
948449761 2:238061578-238061600 CTTTCTAGGAAGCAGCCAGAAGG - Intronic
1169336893 20:4764037-4764059 CTTCCTCTGTGGAAGCCTGAGGG - Intergenic
1170428406 20:16257705-16257727 GTTTCTAAGCAGCAGCCTGAGGG + Intergenic
1177529430 21:22340738-22340760 GTGTCCAGGTAGAAGCCTGAAGG - Intergenic
951442249 3:22736814-22736836 CTTTCAGAGTAGAACCCGGATGG - Intergenic
951489289 3:23251008-23251030 TTTTTTAATTAGAAGCATGATGG - Intronic
953137359 3:40192882-40192904 GTTACTATGTAGAAGCATGATGG - Intronic
956567281 3:70652959-70652981 TTTTCAAAGTAGAAGCTGGAAGG - Intergenic
959847247 3:111048123-111048145 CTTGCTAAGAGGAAGACTGAAGG - Intergenic
961614931 3:128171437-128171459 CTTTCTAATTAAAAACCAGATGG + Intronic
962342823 3:134599296-134599318 CTTCCTAAGGAGAAGCATGCTGG + Intronic
964308994 3:155372203-155372225 CCTTCTCAGTACTAGCCTGAAGG + Intergenic
965485489 3:169273411-169273433 ATTTCTATGTGGAAGCATGATGG - Intronic
968593349 4:1470676-1470698 CTTACAAAGTTGAAGCCTGTAGG - Intergenic
970435550 4:16031203-16031225 CATTCTAACTAGAAGCCCTAAGG + Intronic
973744808 4:53953136-53953158 CTTTCCAAAAAGAAGACTGAGGG - Intronic
978083989 4:104627378-104627400 ATTTCCAAGTCCAAGCCTGAAGG + Intergenic
979220914 4:118223520-118223542 CTTTTTATGTAAAAGCCTGCAGG + Intronic
984314648 4:178112221-178112243 CTTTGTAAATAGAACCCTAAAGG - Intergenic
986253362 5:6081442-6081464 ATTTCTAAGTAGCAGGCAGATGG - Intergenic
986258301 5:6120661-6120683 CCTTCCAAAAAGAAGCCTGATGG + Intergenic
986702829 5:10428203-10428225 CCTTCTAAGTAGAAACTTCAAGG + Intronic
987541954 5:19267415-19267437 ATTTTTAAGCAGAAGACTGATGG + Intergenic
987674248 5:21053513-21053535 TTCTCCAAGCAGAAGCCTGAGGG - Intergenic
989519883 5:42389284-42389306 CTTTCTAAGTAGCTTACTGAAGG + Intergenic
991145187 5:63294304-63294326 TTTTCTTAGTAGAAGCCTCAGGG - Intergenic
991311063 5:65242483-65242505 CTTTATAAGGAGATACCTGATGG - Intronic
995084750 5:108095190-108095212 CTTTAAAAGTAGAATTCTGATGG - Intronic
996772723 5:127101814-127101836 CTTTCCAACCAGAAGCCTAAAGG - Intergenic
996921718 5:128775807-128775829 AGTTCCAAGTAGATGCCTGAAGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1005814497 6:29539765-29539787 CTTTCTTTGTAGAATCATGAGGG + Intergenic
1007138118 6:39542550-39542572 CTTTCTTTGTAGAACCCAGAAGG - Intronic
1008929696 6:56925714-56925736 CTTTCCAAGTGGAAGCATCATGG + Intronic
1010371434 6:75113904-75113926 CCTTCTAAGGAGAAGTCAGAAGG - Intronic
1010393706 6:75366161-75366183 CATTCTAACTAGACACCTGAAGG + Intronic
1010928358 6:81770663-81770685 CTTTATAAGAAGAAGAGTGAGGG - Intergenic
1011800991 6:91016154-91016176 CTCTCTAAGTAAAATCCTGCTGG - Intergenic
1013042029 6:106444835-106444857 CTTTCAAAATGGCAGCCTGAAGG - Intergenic
1015202274 6:130596209-130596231 CTTCCTAAGAAGGAACCTGACGG - Intergenic
1016417273 6:143845926-143845948 CTTTCCAAGTAGGAGGCAGATGG - Intronic
1018437351 6:163774441-163774463 CTCTCCATGTAGAAGCCTCATGG - Intergenic
1018746639 6:166767465-166767487 TTTTCCAAGTAGGATCCTGAAGG - Intronic
1020469768 7:8522877-8522899 CTTTCTAAGGGGAAGCCCCATGG - Intronic
1020523240 7:9222006-9222028 ATTTCTAAGTAGTAGCATGGTGG - Intergenic
1020957338 7:14757656-14757678 CTTGCAAAGTATAATCCTGAAGG - Exonic
1022629128 7:32069194-32069216 GTTTCTAAGGAGAAGCATTAAGG - Intronic
1028106983 7:86889870-86889892 CTTTCTAAGGTAAACCCTGATGG + Intronic
1030810741 7:113969267-113969289 CTTTCTATCTAGAACCCTTATGG + Intronic
1031227978 7:119065538-119065560 CTTTCTGAGAAGGACCCTGAAGG + Intergenic
1031389519 7:121196319-121196341 CTTACTGAGTAGCAGCCTGCAGG - Intronic
1036054023 8:5230205-5230227 CTTTCTAAGGTGGACCCTGATGG + Intergenic
1036513700 8:9423733-9423755 TATTGTTAGTAGAAGCCTGATGG + Intergenic
1037000491 8:13712007-13712029 GTTTCTAAGTAAAATCATGACGG - Intergenic
1037125635 8:15345306-15345328 CTATCTAAGTGGAAGACAGAAGG - Intergenic
1040975448 8:53189109-53189131 ATTTCTAAGTAAAAGCCTTAGGG + Intergenic
1044418592 8:91965130-91965152 CTTTAGAATTAGAAGGCTGATGG + Intronic
1048940022 8:139392476-139392498 CTTTCTAAGTAGAGACCTGGAGG - Intergenic
1049887862 9:40300-40322 ATTTTTAAGTACAAGTCTGAAGG - Intergenic
1050693826 9:8258121-8258143 CTTTCTGAGTGGATGTCTGAAGG + Intergenic
1052486944 9:29113742-29113764 CTTTACCAGTAGAATCCTGAAGG + Intergenic
1057485138 9:95477036-95477058 CTTTCGAAGTAGAAACGTGCAGG - Intronic
1057515709 9:95718718-95718740 TTTTAAAAATAGAAGCCTGATGG + Intergenic
1058555598 9:106163459-106163481 CTTTTTAAGTAGAAGAGGGAGGG + Intergenic
1058859398 9:109100086-109100108 CTTACTTAGTAGAAACCTTATGG - Intronic
1060183973 9:121552653-121552675 ATGTCTAAGCAGAAACCTGAGGG - Intergenic
1061787934 9:133041998-133042020 CTCTCTCAATAAAAGCCTGACGG - Intronic
1185505740 X:631305-631327 CTTTCTTAGGCAAAGCCTGACGG - Intronic
1185687392 X:1940574-1940596 CTTTCTAAGAAGGAGGCAGAGGG - Intergenic
1194685716 X:96911568-96911590 CTTTCCAAGTAGAAGGATTAAGG - Intronic
1195350902 X:103996244-103996266 CTTTCTATGTAAAACCCTGGTGG + Intergenic
1196766451 X:119249836-119249858 TTTTCAAAGTGGAAGCGTGATGG - Intergenic
1197916590 X:131542310-131542332 CCTTGTAAGTAAAAACCTGAGGG + Intergenic
1198641762 X:138763910-138763932 CTTTCTAAGGAGCAGCCAGCTGG - Intronic
1201727464 Y:17169701-17169723 CTTTCTTACTAAAAGCCTCATGG - Intergenic