ID: 1105472650

View in Genome Browser
Species Human (GRCh38)
Location 13:20706125-20706147
Sequence CTGCCCACGGGGAAGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105472638_1105472650 -9 Left 1105472638 13:20706111-20706133 CCCCCTCAGAGCCCCTGCCCACG 0: 1
1: 1
2: 1
3: 38
4: 415
Right 1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG 0: 1
1: 0
2: 3
3: 11
4: 195
1105472637_1105472650 11 Left 1105472637 13:20706091-20706113 CCAAGCTCACTGTGGCAGAGCCC 0: 1
1: 0
2: 3
3: 29
4: 302
Right 1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG 0: 1
1: 0
2: 3
3: 11
4: 195
1105472639_1105472650 -10 Left 1105472639 13:20706112-20706134 CCCCTCAGAGCCCCTGCCCACGG 0: 1
1: 0
2: 1
3: 32
4: 347
Right 1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG 0: 1
1: 0
2: 3
3: 11
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105472650 Original CRISPR CTGCCCACGGGGAAGTTGGG TGG Intronic
903054596 1:20626789-20626811 ATGCCCAAGGGGAAGCTGAGAGG - Intergenic
903694946 1:25199652-25199674 CTCCCCACGTGGAGGATGGGGGG + Intergenic
905338202 1:37259936-37259958 CTGCCCACCGGGAAGTCGGATGG + Intergenic
907094622 1:51766464-51766486 CTGCCCACAGGGAACTTTTGGGG + Intronic
907188364 1:52629373-52629395 CTGGCCAGGGGGAAGCTCGGTGG + Intergenic
907946022 1:59137399-59137421 CTTCCCACAGAGAAGTGGGGGGG - Intergenic
908339063 1:63157842-63157864 GTGCCCAGTGGGAAGTTGGGAGG + Intergenic
908509518 1:64840288-64840310 CTGGCCTCGGGGACGGTGGGGGG + Intronic
910138373 1:83998999-83999021 CCGCCCACGGGGAAGCTGCGAGG - Exonic
910468872 1:87529318-87529340 CTGCTCACGGGGAGGTGTGGAGG - Intergenic
911281350 1:95933306-95933328 CTGCACACTGGGAAAATGGGTGG - Intergenic
912069830 1:105795887-105795909 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
913089264 1:115465605-115465627 CTGCTCATGGGGGAGGTGGGAGG + Intergenic
917962406 1:180155219-180155241 CTGCCCACCGGGCAGGTGGAGGG - Intronic
920077504 1:203348002-203348024 ATGGCCGTGGGGAAGTTGGGTGG + Exonic
924260732 1:242228118-242228140 TTGCACACGAGGAAGATGGGAGG + Intronic
1070761246 10:79025604-79025626 CTGCACACAGGGAAGTGCGGGGG + Intergenic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075073355 10:119333757-119333779 CTGTCCACGGGGGAGCTGAGCGG + Intronic
1075651235 10:124129313-124129335 CTGGTCACGGGGGAGTGGGGAGG - Intergenic
1075673424 10:124279888-124279910 CTGCCCACGGGGCAGGAGTGGGG - Intergenic
1076675710 10:132146539-132146561 CTGCCCATGGACAAGTGGGGTGG - Intronic
1077494917 11:2882266-2882288 CTGCCCCCGGTGGAGGTGGGAGG + Intergenic
1079361145 11:19771519-19771541 CAGCCCACAGGGACATTGGGAGG + Intronic
1083265995 11:61547024-61547046 CTGCCCATGGGGTGGATGGGTGG + Intronic
1083609684 11:63998951-63998973 GTACCCACGGGGAAGTAGTGGGG + Exonic
1084546433 11:69817353-69817375 CTGCGCACTGGGAAGGCGGGAGG - Intronic
1085016772 11:73178955-73178977 CTGCCCTGGGGGAAGAGGGGAGG - Intergenic
1085261374 11:75207137-75207159 CTGACCAAGGGGAAGCTGAGTGG - Intergenic
1088090627 11:106035146-106035168 TTGCTTAGGGGGAAGTTGGGGGG + Intergenic
1088625543 11:111727689-111727711 CTGCCCACGGGTTAGATGTGGGG + Exonic
1088872907 11:113907844-113907866 CTGCCCACAGCAAAGTTGGCAGG + Intronic
1089073448 11:115718290-115718312 CTGCCCAAGGGGAAGTCGCAAGG + Intergenic
1089074173 11:115724774-115724796 ATGGCCAAGGGGAAGATGGGAGG - Intergenic
1090829419 11:130410670-130410692 CTGCACACTGGGCAGTTGGATGG + Intronic
1091461705 12:647981-648003 ATGACCACTGGGTAGTTGGGAGG + Intronic
1094492988 12:30972798-30972820 CTGCGCAGGGGGGAGGTGGGGGG + Intronic
1095749999 12:45699217-45699239 CTGCCCTTGGGGAAACTGGGTGG + Intergenic
1097186686 12:57199963-57199985 CTGCCCAGGTAGAAGTTGGTGGG - Exonic
1098428955 12:70398172-70398194 CTGCCCACTGGGGAGATGGCTGG - Intronic
1099537021 12:83857624-83857646 CTGGGAACAGGGAAGTTGGGTGG + Intergenic
1099783742 12:87234467-87234489 CTGCCCAGTGGGAATTTGAGAGG + Intergenic
1101673440 12:106897317-106897339 CTGCCCATAGTGGAGTTGGGTGG + Intergenic
1102020624 12:109679858-109679880 GTGCCCACTGGGCAGGTGGGAGG - Intergenic
1102295036 12:111729905-111729927 CTGCTGACGGGGAAGATGGAGGG - Exonic
1103037124 12:117665541-117665563 CGGGCCATGGGGAAGTGGGGAGG + Intronic
1103614279 12:122142271-122142293 CTGCCCGTGGGGCAGTTGGAAGG + Exonic
1103971691 12:124676446-124676468 CTGCACACGGGTAAGCTGGAAGG + Intergenic
1104934765 12:132358512-132358534 CTGTCTACGGGGATGTTTGGGGG + Intergenic
1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG + Intronic
1106108926 13:26760385-26760407 GTGCGCACGGGGCAGTCGGGAGG + Intronic
1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG + Intergenic
1116151376 14:41145791-41145813 CTGCCAACTGGGAAGGTGTGGGG + Intergenic
1121210663 14:92206123-92206145 CTGCCCATGGTGGAGTTGTGAGG - Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124149157 15:27161378-27161400 CTGCCCCCATGGAACTTGGGGGG - Intronic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1125674103 15:41493616-41493638 CTGCCCTCGGGGAGGTGGGAGGG - Intronic
1126678392 15:51181571-51181593 CTGCACCTGGGCAAGTTGGGAGG + Intergenic
1129867697 15:78922038-78922060 CTGCCCTGGAGGAAGTTGTGGGG - Exonic
1131517505 15:93089006-93089028 CTGCCCCGGGGCAAGGTGGGAGG + Intronic
1132851951 16:2028779-2028801 GTGCCCACTGGGAAGTGGGCAGG - Intronic
1133479547 16:6156658-6156680 TTGGCCACTGGGAAGTGGGGAGG - Intronic
1133654431 16:7846609-7846631 ATCCCCAAGGGGAAGATGGGAGG - Intergenic
1134066463 16:11231704-11231726 GTGCCAAGGGGTAAGTTGGGAGG - Intergenic
1134451768 16:14368192-14368214 CTGCCCAGGGGGACGTAGGCAGG + Intergenic
1135340079 16:21637744-21637766 CTGCTCGCGGGGAAGTGTGGAGG - Intronic
1135515895 16:23133434-23133456 CTGCACATGAGGGAGTTGGGGGG + Intronic
1138099851 16:54243981-54244003 CTGGCCACGTGGCAGATGGGAGG + Intergenic
1140266099 16:73422564-73422586 CTGACCTCTGGGAAGTTGGAAGG - Intergenic
1140412417 16:74748947-74748969 AGGCCCAGGGGGAAGGTGGGGGG + Intronic
1141635963 16:85313825-85313847 ATGCCCACTGGGGAGTTGGGAGG + Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1143781517 17:9231896-9231918 CTGGCCTCGGGGCGGTTGGGGGG + Intronic
1146646295 17:34579453-34579475 GTGACCACGGGGAATCTGGGAGG + Intergenic
1147331755 17:39703392-39703414 CTTCCCAGGGGGAGGATGGGTGG - Intronic
1148107833 17:45128636-45128658 CTGCCCATGGGGAGGATGAGGGG + Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148492956 17:48034944-48034966 CTGCCCACGCTGAAGTTCAGTGG - Intronic
1148783641 17:50134911-50134933 CTGCCCATGGGGCACCTGGGTGG - Exonic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149682013 17:58513722-58513744 ACACCCACGGGGAAGGTGGGGGG + Intronic
1150127502 17:62647880-62647902 CTGCCCGCTGGGTAGTTGGCAGG - Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1151557126 17:74852193-74852215 AGGCCCACGGGGAAGGTGGCGGG + Exonic
1151820108 17:76492602-76492624 CTGCACCTGGGGGAGTTGGGAGG - Intronic
1152371879 17:79893350-79893372 TTGCCCCCGGGGCAGTTGTGAGG - Intergenic
1152523217 17:80872569-80872591 GTGCCCCCTGGGAAGGTGGGAGG + Intronic
1152556660 17:81056500-81056522 CCGCACACGGGGAAGTGGTGTGG + Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1156651907 18:39235325-39235347 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
1158940552 18:62403139-62403161 CTGCCCACCTGCAAGATGGGTGG + Intergenic
1160242415 18:77132946-77132968 CTGCCCACGCGGAACTTGGGGGG + Intronic
1161221225 19:3119133-3119155 CAGCCCAAGGGGCAGCTGGGGGG - Intronic
1161294611 19:3513349-3513371 CTGCCCACGGGGAAGCTGCAAGG - Intronic
1161521049 19:4723666-4723688 CTGCTCACCGGGACGTGGGGCGG + Exonic
1162327691 19:10008504-10008526 GCCCCCACGGGGATGTTGGGTGG + Intronic
1164577902 19:29416908-29416930 CTGCCCGCAGGGAAGCGGGGAGG - Intergenic
1165132458 19:33641403-33641425 CTGCCCAGGGGGTGGTGGGGCGG - Intronic
1167593577 19:50416636-50416658 GTGCTCACGGGCAAGGTGGGCGG + Exonic
1167715002 19:51137479-51137501 CTGCAGACCGGGATGTTGGGTGG - Intergenic
924977663 2:192783-192805 CTACCCAGGGGAAAGTTGGGTGG + Intergenic
925138224 2:1534177-1534199 TTGCACACGGGGGATTTGGGAGG - Intronic
925613620 2:5724628-5724650 CTGCACACAGTGTAGTTGGGCGG - Intergenic
928793825 2:34992028-34992050 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
929970291 2:46568424-46568446 ATGACCACGGGGAGGTTGTGAGG + Intronic
932161726 2:69466245-69466267 CCCCCCCCGGGGAAGCTGGGAGG - Intronic
935208642 2:100919759-100919781 CAGCCCAGGGGAAAGCTGGGTGG - Intronic
936778889 2:116007825-116007847 CTGTCCACGGTGAAGTTGCCTGG - Intergenic
937332894 2:121043172-121043194 CTGCCGAAGGGCAGGTTGGGAGG + Intergenic
937556471 2:123164121-123164143 ATGCCTACGAGGAAGTTGGGTGG - Intergenic
945924255 2:215787753-215787775 CTGGCCACGGAGAAGATGGACGG + Intergenic
948426050 2:237887075-237887097 CTGCCCATGGGGAAGGGGTGGGG + Intronic
949026382 2:241768238-241768260 TTGCCCACGTGGAAGCGGGGTGG + Exonic
949062962 2:241971836-241971858 CTGCCTCCTGGGAAGTTGGGAGG + Intergenic
1169236574 20:3934426-3934448 CTTCACACGTGGAAGATGGGAGG - Intronic
1172639448 20:36432079-36432101 CTCGCCACGGGGAAATTGGAGGG - Exonic
1176171362 20:63697779-63697801 CTGCCCGAGGGGAAGGTGGCTGG + Intronic
1176448196 21:6840167-6840189 CTGTTCACGGGGAAGCCGGGCGG + Intergenic
1176826366 21:13705189-13705211 CTGTTCACGGGGAAGCCGGGCGG + Intergenic
1178922052 21:36745148-36745170 CTGCTCGTGGGGAAGGTGGGAGG + Intronic
1179066159 21:38026660-38026682 CTGCCCAATGGGATGTTAGGAGG - Intronic
1179432012 21:41328117-41328139 CTGCCCACGGGAAAGTGGACAGG + Intronic
1182424877 22:30266665-30266687 CTGCCCTCCGGGAACTGGGGAGG - Intronic
1182657554 22:31902767-31902789 CCCCTCACGGGGAAGCTGGGAGG + Intronic
1183098509 22:35569026-35569048 CTGCATGCGGGGAAGGTGGGAGG + Intergenic
1183329461 22:37211744-37211766 CTGCCCAGGATGAACTTGGGAGG - Intronic
1184769581 22:46589479-46589501 CTGCCCAGGGAGAAGGTGAGTGG + Intronic
1184980490 22:48092035-48092057 CTGCCCACAGTGGAGTTGGCTGG - Intergenic
1184987697 22:48146598-48146620 CTGCCCCCGGGGAAGTCTGTGGG - Intergenic
1185330084 22:50248570-50248592 GTGCCCACGGGGTATTTGGGAGG - Intronic
949896285 3:8769264-8769286 CTCCCCCCGGGGAAGTTGCACGG + Exonic
956797954 3:72733000-72733022 CTGGCCACGGTGCAGATGGGTGG + Intergenic
959358974 3:105366813-105366835 CTGCGTCCGGGGAAGTGGGGAGG + Intergenic
959728247 3:109570116-109570138 TAGCCCACTGGGGAGTTGGGTGG + Intergenic
960969579 3:123130045-123130067 CTGCCCACTGGGCAGTGGAGGGG - Intronic
965240207 3:166187400-166187422 CTGCACACTGGGAGGATGGGTGG - Intergenic
968621317 4:1604621-1604643 CTGTCCTGGGGGAAGTAGGGTGG - Intergenic
969259080 4:6022344-6022366 CTGCCCACAGGTCAGCTGGGAGG - Intergenic
969553615 4:7890825-7890847 CTTCCCACCGGGAAAGTGGGAGG - Intronic
969611461 4:8229693-8229715 CTGCCCAAGGAGGAGTGGGGGGG + Intronic
969916040 4:10492586-10492608 CTTCCCTCGGGGCTGTTGGGAGG + Intronic
970036911 4:11746640-11746662 CTGCCCACTGAGATGTTGTGAGG - Intergenic
970191598 4:13523707-13523729 CTGCCGAGAGGGAAGTGGGGTGG + Intergenic
971530274 4:27679023-27679045 CTGGGCACTGGGAAGTTGTGAGG - Intergenic
975820760 4:78268147-78268169 CGGCCCACAGGGAAATTGGTGGG - Intronic
980744843 4:137000556-137000578 CTGCCAACTGGGAAGTGGGTAGG - Intergenic
982630214 4:157821985-157822007 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
984172746 4:176380707-176380729 GTGCACACGGGGGAGTGGGGCGG + Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985640016 5:1059184-1059206 CTGTCCACGGACAAGCTGGGCGG + Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
992494839 5:77282112-77282134 CTGTCCACGGGGCAGTTAGCAGG - Intronic
993500384 5:88660403-88660425 CTCCCTGCGGGGAAGCTGGGTGG - Intergenic
993606287 5:89994296-89994318 CTGTCCACAGGGCAGTTTGGTGG - Intergenic
996681149 5:126229082-126229104 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
997415766 5:133727449-133727471 GTGCCCAGTGGGAAGATGGGTGG - Intergenic
999395291 5:151223308-151223330 CTGCCCTTGGGGTAGCTGGGAGG - Intronic
1000130286 5:158290621-158290643 CTCCCCAAGGGGCAGTTGGCAGG - Intergenic
1000133342 5:158320838-158320860 CTGGCCACCGGCATGTTGGGAGG - Intergenic
1004253795 6:14044336-14044358 CTGTCCAGGGAGAAGCTGGGAGG - Intergenic
1004811785 6:19270764-19270786 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
1006415911 6:33903855-33903877 CTGCCCAAGCGGATGTTAGGCGG - Intergenic
1009690900 6:67031059-67031081 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
1012976359 6:105784769-105784791 CTGCCCATGGGGATGTAGGCCGG + Intergenic
1017764237 6:157593651-157593673 CTGTCCTGGCGGAAGTTGGGAGG - Intronic
1022887189 7:34658416-34658438 CTGCCCTCTGTGAAGTTGGCTGG - Exonic
1023256592 7:38318645-38318667 GTGGCCATGGGGAAGGTGGGTGG - Intergenic
1023790519 7:43749908-43749930 CAGCCTCCAGGGAAGTTGGGGGG + Intergenic
1024673913 7:51621185-51621207 CTTCCCAGGGGGAAGCCGGGAGG - Intergenic
1025007465 7:55365698-55365720 CGGGCCACGGGGAAGGTGCGAGG + Exonic
1031730912 7:125299532-125299554 CTGCTCACGGGGAGGTGTGGAGG - Intergenic
1035593075 8:833053-833075 CTGCTCATGGGGATGATGGGAGG - Intergenic
1036699352 8:11001772-11001794 CTGCCCACTGGGAGGCTGGTAGG - Intronic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1040075021 8:43220471-43220493 CTGCCCACGTGGAATTTGTGGGG + Intergenic
1044456037 8:92393931-92393953 CTGCTCACGGGGAGGTGTGGAGG - Intergenic
1044838982 8:96322164-96322186 CTGCCCAGGGGGCAGTGGTGGGG - Intronic
1046628347 8:116598831-116598853 CTGCCCATGTGGGAGTTGAGTGG - Intergenic
1048020572 8:130535271-130535293 TTGCCCAAAGGGAAGCTGGGTGG - Intergenic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1053575920 9:39357514-39357536 CTCCCCACAGGGCAGTTGTGAGG + Intronic
1053840436 9:42185451-42185473 CTCCCCACAGGGCAGTTGTGAGG + Intronic
1054097489 9:60916205-60916227 CTCCCCACAGGGCAGTTGTGAGG + Intergenic
1054118892 9:61191835-61191857 CTCCCCACAGGGCAGTTGTGAGG + Intronic
1054455100 9:65426419-65426441 CAGCCCACGGGGGAGGGGGGTGG + Intergenic
1054588860 9:66990727-66990749 CTCCCCACAGGGCAGTTGTGAGG - Intergenic
1055986868 9:82061889-82061911 CTCCCCACAGGGCAGTTGTGAGG - Intergenic
1056007134 9:82284882-82284904 CTGCCTCGGGGGAAGGTGGGTGG - Intergenic
1057689571 9:97271483-97271505 CTGCTCATGGGGAAGTGTGGAGG - Intergenic
1057895397 9:98904810-98904832 TTGCCCACAGGGTTGTTGGGAGG + Intergenic
1060944520 9:127562037-127562059 CTGCCCGCGGGGAAGGAGGAGGG + Intronic
1203520995 Un_GL000213v1:44351-44373 CTGTTCACGGGGAAGCCGGGCGG - Intergenic
1187319347 X:18226336-18226358 CTGCCCTCGAGCAAGTGGGGAGG + Intergenic
1187670090 X:21658329-21658351 CTGGTCACGGGGCAGTGGGGGGG + Exonic
1187842858 X:23506728-23506750 CTGCTCACTGGGAAGATTGGTGG + Intergenic
1188745146 X:33831941-33831963 CTGACCACCGGCAAGTTGGATGG + Intergenic
1191618605 X:63192656-63192678 CAGCCCACGGAGAGGGTGGGAGG + Intergenic
1192892667 X:75407424-75407446 CTGCCCAGGAGGGAGGTGGGAGG + Intronic
1193543501 X:82799411-82799433 CTGCCCACCTGGAGGATGGGAGG - Intergenic
1194981923 X:100450004-100450026 CTGCCAATGGCGGAGTTGGGTGG - Intergenic
1196832885 X:119790167-119790189 CTGCCCCCAGAGAAGTTGTGAGG - Intronic
1197262528 X:124333712-124333734 CAGGCCACGGGCAAGGTGGGTGG - Intronic
1197821699 X:130547746-130547768 TTTCCCAGGGAGAAGTTGGGTGG + Intergenic
1200383513 X:155865354-155865376 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
1202242433 Y:22785571-22785593 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
1202395418 Y:24419320-24419342 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
1202475367 Y:25250772-25250794 CTGCTCACGGGGAGGTGTGGAGG - Intergenic