ID: 1105473374

View in Genome Browser
Species Human (GRCh38)
Location 13:20711477-20711499
Sequence TGCCATGGTAACAGTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105473374_1105473379 8 Left 1105473374 13:20711477-20711499 CCTCCCACACTGTTACCATGGCA 0: 1
1: 0
2: 1
3: 17
4: 261
Right 1105473379 13:20711508-20711530 TTTAACACATGAGCTGTTGGAGG 0: 1
1: 0
2: 1
3: 38
4: 316
1105473374_1105473380 9 Left 1105473374 13:20711477-20711499 CCTCCCACACTGTTACCATGGCA 0: 1
1: 0
2: 1
3: 17
4: 261
Right 1105473380 13:20711509-20711531 TTAACACATGAGCTGTTGGAGGG 0: 1
1: 0
2: 2
3: 12
4: 169
1105473374_1105473378 5 Left 1105473374 13:20711477-20711499 CCTCCCACACTGTTACCATGGCA 0: 1
1: 0
2: 1
3: 17
4: 261
Right 1105473378 13:20711505-20711527 GTTTTTAACACATGAGCTGTTGG 0: 1
1: 1
2: 14
3: 128
4: 576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105473374 Original CRISPR TGCCATGGTAACAGTGTGGG AGG (reversed) Intronic
900218432 1:1494639-1494661 TGTCATGGTGACAGTGTTGTGGG + Intronic
900368466 1:2320988-2321010 GGGCCTGGGAACAGTGTGGGTGG + Intergenic
900387512 1:2417307-2417329 TGCACTGGTAAGAGTGAGGGAGG + Intergenic
901231891 1:7646171-7646193 GGCCATGGTGACTGTGAGGGTGG + Intronic
901231984 1:7646524-7646546 GGCCATGGTAACTGTGAAGGTGG + Intronic
901232032 1:7646717-7646739 GGCCATGGTGACTGTGAGGGTGG + Intronic
902722261 1:18311810-18311832 TACCATGAGAACAGTGTGGGGGG + Intronic
904481564 1:30797260-30797282 TGCAAAGGTCACAGTGTGTGAGG - Intergenic
904585829 1:31579994-31580016 TGCCCGGGTCACAGTGAGGGAGG + Intronic
905286791 1:36885909-36885931 TGCCATGGAAAGGGAGTGGGGGG - Intronic
906279829 1:44545592-44545614 TGCAAGGGCAACAGTGGGGGTGG + Intronic
909239182 1:73190990-73191012 TACCATGAGAACAGTATGGGAGG + Intergenic
913278200 1:117159422-117159444 TACCATGAGAACAGTATGGGGGG + Intronic
913597677 1:120394119-120394141 TGCCATAGTAATTGGGTGGGTGG - Intergenic
920294158 1:204945735-204945757 TCCCATGGTAACTGTCTGCGAGG + Intronic
920319917 1:205112059-205112081 TGCAATCCTAACAGTTTGGGAGG + Intronic
921817645 1:219581889-219581911 TGACATTGCAACAGTGTGAGGGG + Intergenic
921986447 1:221317758-221317780 TGCCATGGTAACAAGGATGGAGG + Intergenic
922855071 1:228768212-228768234 TGCCAATGTCACATTGTGGGTGG + Intergenic
924684740 1:246277314-246277336 AGCCATTGTAACAGTGTGCAAGG - Intronic
1065168520 10:23005494-23005516 TTCCATGGTACCAGTGCTGGAGG + Intronic
1066982318 10:42429139-42429161 TGCCAAGGTCACACTGTGGAAGG + Intergenic
1069098453 10:64288584-64288606 TGCCATGCTGACAGTGTGCTTGG - Intergenic
1071079853 10:81798132-81798154 TGCCATGGTGGAAGTGTGGAAGG - Intergenic
1072252932 10:93595874-93595896 TTCCAGGGTAACAGTGTCAGAGG + Intronic
1072428898 10:95354007-95354029 TGACCTGGTAGCAGTGGGGGAGG - Intronic
1073273879 10:102291345-102291367 TGGCATGGGAGCAGTGTGTGTGG + Intronic
1073942509 10:108714371-108714393 TACCATGAGAACAGTGTGAGGGG - Intergenic
1075360878 10:121832535-121832557 TACCATGATAACATTATGGGGGG - Intronic
1076123027 10:127951374-127951396 TACCATGGTAACTGTGTGCTGGG + Intronic
1078793060 11:14564209-14564231 TACCAGGGTAACAGAGTAGGTGG - Intronic
1079115056 11:17635325-17635347 TGTCCAGGAAACAGTGTGGGAGG + Intronic
1080432253 11:32209865-32209887 TGCCATGGTAACAGTCAAGAGGG - Intergenic
1081509548 11:43756041-43756063 TACCATGAGAACAGTATGGGGGG + Intronic
1084901478 11:72313102-72313124 TGCCAGGGATATAGTGTGGGAGG + Intronic
1085815475 11:79732842-79732864 TGCCAGGGTAAAAGTCTAGGAGG - Intergenic
1086472267 11:87127342-87127364 TGCCATGGAGACTGTGTGGCTGG - Intronic
1089113159 11:116072845-116072867 TGCCTTGGAAACAGTGCTGGAGG + Intergenic
1092486841 12:8909341-8909363 TGCAATTGTAACACTTTGGGAGG + Intergenic
1093251591 12:16811438-16811460 GGAGATGGTAAAAGTGTGGGAGG + Intergenic
1096297564 12:50396738-50396760 TGCCATGGTAGAAGGGTGAGGGG + Intronic
1097958790 12:65512690-65512712 TGCCAGGGTGGGAGTGTGGGTGG + Intergenic
1100389522 12:94136184-94136206 GGCCATGGTAACAGGCTGGTGGG - Intergenic
1101363083 12:104046000-104046022 TGCCATGGTTATAGTATGGTAGG + Intronic
1102399399 12:112615445-112615467 CTCCATGGTAACAGTTTTGGGGG + Intronic
1102789009 12:115628401-115628423 TGCCAAGGTAATGGTTTGGGAGG - Intergenic
1104280042 12:127368449-127368471 TTCTGTGGTAACAGTGTGGTTGG - Intergenic
1105266131 13:18817608-18817630 TGCCTTGGTCACAGTGCTGGGGG - Intergenic
1105431256 13:20339670-20339692 TGCAAAGGGGACAGTGTGGGTGG + Intergenic
1105473374 13:20711477-20711499 TGCCATGGTAACAGTGTGGGAGG - Intronic
1106170683 13:27285654-27285676 TGCCCTGGGAGCAGAGTGGGTGG + Intergenic
1106884484 13:34169256-34169278 TGCCATTGTAGCAGTATGGTGGG + Intergenic
1107998256 13:45882962-45882984 TGCCATGGTAACTCCCTGGGGGG - Intergenic
1108329444 13:49370593-49370615 TCCCATGGTAACCATGTGAGTGG + Intronic
1113126412 13:106984162-106984184 TGCCATGGTAAGAGTATGAAGGG + Intergenic
1113952045 13:114077498-114077520 TGCGTTGGTGCCAGTGTGGGGGG - Intronic
1113952079 13:114077621-114077643 TGCGTTGGTGCCAGTGTGGGGGG - Intronic
1114886654 14:26860099-26860121 TGTCATGGTAACATAGTGGAGGG + Intergenic
1115147901 14:30247564-30247586 TGCCATAATAACAGTGGTGGTGG - Intergenic
1115587188 14:34826076-34826098 GGACATGTTAACAGTGTGGATGG - Exonic
1117386550 14:55219809-55219831 GGTCATGGTAACAGTTTGCGGGG + Intergenic
1118140813 14:63080050-63080072 TACCATGAGAACAGTATGGGGGG - Intronic
1120541071 14:85751595-85751617 TACCATGAGAACAGTATGGGGGG - Intergenic
1120779311 14:88471958-88471980 AGTCCTGGTAACAGTGTTGGGGG + Intronic
1124371039 15:29104825-29104847 TGCAATGCCAACAGTTTGGGAGG + Intronic
1127257980 15:57307321-57307343 CGCCCTGGTCACGGTGTGGGGGG - Intergenic
1127462444 15:59211823-59211845 GGCCATGGTAGCAGTGTAGGTGG - Intronic
1128119915 15:65138175-65138197 TACCATGAGAACAGTATGGGGGG + Intergenic
1128502166 15:68234157-68234179 TGACATGGAAACAGTGTTGTGGG - Intronic
1129249377 15:74300392-74300414 TGGCACGGTCACAGTGTGTGTGG + Intronic
1130934522 15:88457599-88457621 TGCTATGTTCTCAGTGTGGGAGG - Intergenic
1132286048 15:100663321-100663343 AGCCATGGTGAGAGGGTGGGTGG - Intergenic
1132661717 16:1064473-1064495 TGCCATCCTAACACTTTGGGAGG + Intergenic
1134220393 16:12348937-12348959 GGCGATGGTGACAGTGTGGAGGG - Intronic
1134225840 16:12389372-12389394 TACCATGAGAACAGTATGGGAGG - Intronic
1134839685 16:17391801-17391823 TACCATGAGAACAGTATGGGGGG - Intronic
1135386308 16:22044065-22044087 TACCATGAGAACAGTATGGGAGG + Intronic
1135417534 16:22280142-22280164 TACCATGGCAACAGGGTGGCAGG - Intronic
1136090706 16:27917895-27917917 TGCCATGGTAAGAAAGTGGCCGG + Intronic
1137593004 16:49705233-49705255 TGCCATGGTCACAGCATGGCAGG + Intronic
1141464393 16:84196545-84196567 TGACATTGTCACAGTGTGAGAGG + Intronic
1141792994 16:86249268-86249290 TACCATGAGAACAGTATGGGGGG - Intergenic
1143637809 17:8176414-8176436 TGCCTTGGTAACCGTGTACGCGG + Intergenic
1145228081 17:21147895-21147917 TCCCTTGGGCACAGTGTGGGAGG + Intronic
1146056025 17:29581636-29581658 TGCCATGGTGACAGAGCGGCTGG - Intronic
1146486987 17:33250719-33250741 TGCCCTGGTTACAGTGCGGAGGG + Intronic
1147234384 17:39046315-39046337 TGCCATGGTTTCGTTGTGGGTGG - Intergenic
1147806419 17:43135023-43135045 TGCCATGGTTTCGTTGTGGGTGG + Intergenic
1147921037 17:43917307-43917329 TGCCATGGTTTCCTTGTGGGTGG + Exonic
1148168497 17:45500931-45500953 TGCCATGGTTTCGTTGTGGGTGG + Intergenic
1148280315 17:46342009-46342031 TGCCATGGTTTCGTTGTGGGTGG - Intronic
1148302543 17:46559946-46559968 TGCCATGGTTTCGTTGTGGGTGG - Intronic
1148324990 17:46778108-46778130 TGCTATGGTTACGGTGTGTGTGG + Intronic
1150399690 17:64847382-64847404 TGCCATGGTTTCGTTGTGGGTGG + Intergenic
1153227153 18:2907638-2907660 TGTCGTGGTGACAGTGGGGGTGG + Intronic
1154236554 18:12611267-12611289 TCACATGGACACAGTGTGGGAGG - Intronic
1154422280 18:14243869-14243891 TGCCTTGGTCACAGTGCTGGGGG + Intergenic
1158023514 18:52870036-52870058 TGGCAGGGGAACAGTGTGGTCGG - Intronic
1159526265 18:69594730-69594752 TGCAATGCTAACACTTTGGGAGG + Intronic
1160883798 19:1335328-1335350 TGCGATCCTAACAGTGTGGGAGG - Intergenic
1161100681 19:2419771-2419793 TGCCATCCTAGCAGTTTGGGAGG - Intronic
1167203782 19:48086267-48086289 TGCCAGTGGAACAGGGTGGGAGG + Intronic
1168705958 19:58470409-58470431 AGCAATGGAAAGAGTGTGGGTGG + Intronic
925904544 2:8532288-8532310 TGCTATGGTAATTGTGTGTGTGG - Intergenic
926795160 2:16612904-16612926 TACCATGAGAACAGTATGGGGGG - Intronic
927618201 2:24621990-24622012 TGACATGTTAACTGTGTGAGAGG + Intronic
927899329 2:26808005-26808027 TGCCATGGAAACAGAAGGGGAGG - Intergenic
929029309 2:37635984-37636006 TGCCCTGGTGGCAGTGGGGGTGG - Intergenic
930968047 2:57356171-57356193 TGCAATCCTAACAGTTTGGGAGG - Intergenic
932453907 2:71834182-71834204 TGTCATGCGACCAGTGTGGGAGG - Intergenic
932878663 2:75478782-75478804 TACCATGAGAACAGTATGGGGGG + Intronic
933229605 2:79791224-79791246 TGAGATGTTAACAGAGTGGGAGG + Intronic
933265574 2:80177541-80177563 GGCCATGGTAACAGAGATGGAGG - Intronic
934495787 2:94796688-94796710 TGCCTTGGTCACAGTGCTGGGGG - Intergenic
934709141 2:96503759-96503781 TGCCTGGGTCAAAGTGTGGGAGG - Intronic
935258352 2:101332485-101332507 TCCCCTGATACCAGTGTGGGTGG + Intergenic
935388147 2:102522928-102522950 GGCCAAGGGAACAGTGAGGGAGG - Intronic
937060873 2:118979601-118979623 TGCCTTTGTGACAGTGTGGTTGG - Intronic
937152444 2:119695340-119695362 TGCCATGGGAACAGAGGGGAGGG - Intergenic
939613768 2:144339827-144339849 TGCCTTGGTAACAATCTGAGAGG + Intergenic
939719709 2:145633687-145633709 TGTCATGCTAACATTTTGGGAGG + Intergenic
940907182 2:159179819-159179841 TGGCTTGGTAACAGTGTGAGAGG + Intronic
942948008 2:181690519-181690541 TACCATGGTAACTGTGTAGTGGG + Intergenic
944747147 2:202669331-202669353 TCATATGGTATCAGTGTGGGTGG + Intronic
946175951 2:217922148-217922170 TGCCAGGGTAACAGACTGGGCGG + Intronic
947978242 2:234386155-234386177 TACCATGAGAACAGTATGGGGGG + Intergenic
947996666 2:234533799-234533821 TGCCATGGTAACACCGGGGCTGG - Intergenic
948986042 2:241524059-241524081 TACCATGAGAACAGTATGGGAGG - Intergenic
1169376840 20:5073184-5073206 TACCAGGGTGATAGTGTGGGAGG - Intronic
1174694496 20:52543313-52543335 TGCCATGCTAGCAGTGAGCGAGG - Intergenic
1175568300 20:59998415-59998437 AGCTATGGAAGCAGTGTGGGTGG + Intronic
1176514600 21:7774485-7774507 TCCCATGGGAAAAGTGTGGAGGG - Intergenic
1176851200 21:13916080-13916102 TGCCTTGGTCACAGTGCTGGGGG - Intergenic
1177205051 21:18000571-18000593 TGTCATGGTAAAAGTATAGGTGG - Intronic
1177411136 21:20732043-20732065 AGCAATGGTAACAGTCTAGGCGG + Intergenic
1178096763 21:29223374-29223396 TGCCATGGAACCAGTGAGGCAGG - Intronic
1178549925 21:33528213-33528235 TGCCATGACAACAGTTAGGGCGG + Exonic
1178648713 21:34405009-34405031 TCCCATGGGAAAAGTGTGGAGGG - Intronic
1180183239 21:46127225-46127247 TGCCATGGAGACAGGGTGGGAGG + Intronic
1180983054 22:19888357-19888379 ACCCATGGTGACTGTGTGGGTGG - Intronic
1183317073 22:37142662-37142684 TGCCATGGAGCCAGTGGGGGAGG - Intronic
1184089268 22:42283811-42283833 TGCAAAGGTAACGGTGTGCGCGG - Intronic
949818526 3:8089387-8089409 TACCATGAGAACAGTTTGGGAGG - Intergenic
951723506 3:25727543-25727565 TGCTATGGAAACAGTGAGGTGGG - Intronic
952257426 3:31707485-31707507 TGCCAAGTTAACAGTGTGTGGGG - Intronic
953910301 3:46889419-46889441 TGCCAGGGTACCCGTGTGGCTGG + Intronic
955163935 3:56492058-56492080 TACCATGAGAACAGTATGGGGGG - Intergenic
955409787 3:58648072-58648094 TGCCATGGGAACAGGCAGGGTGG + Intronic
955418519 3:58715026-58715048 GGCCATGGTAACAGGGATGGAGG - Intergenic
957183887 3:76916832-76916854 TCCCATGATAACAATGAGGGAGG - Intronic
959146378 3:102550689-102550711 TGCCTGGGCAACAGTGCGGGGGG - Intergenic
959439628 3:106360016-106360038 GGCCATGGTAGCAGTGATGGAGG + Intergenic
959476119 3:106814343-106814365 TGCCATGGCAACAGTGGAAGTGG + Intergenic
959563713 3:107813006-107813028 TGCAGTGGGAATAGTGTGGGAGG - Intergenic
960080423 3:113534419-113534441 TGCCATGGTAACAGTGCCATAGG - Intronic
960636451 3:119789501-119789523 TGCCATGAGAACAGTATTGGGGG + Intronic
960931075 3:122850959-122850981 TGCCAAGCTAATAGAGTGGGGGG - Intronic
960957714 3:123045931-123045953 TGCCCTGGAAACCGTGTAGGTGG - Intergenic
961557524 3:127706822-127706844 TGTCCTGGGGACAGTGTGGGAGG + Intronic
965806996 3:172552075-172552097 AGCCATGGTGACAGAGAGGGAGG - Intergenic
966375192 3:179289539-179289561 TGACATGGGAAGTGTGTGGGTGG - Intergenic
966685102 3:182684790-182684812 TACTATGGTGACACTGTGGGGGG - Intergenic
967345864 3:188454776-188454798 TACCATGAGAACAGTATGGGGGG + Intronic
968237884 3:197048212-197048234 TGCCATCCTAACACTTTGGGAGG + Intronic
969435252 4:7185720-7185742 TGCCATGGGAACAGAGAGCGGGG - Intergenic
969469410 4:7378691-7378713 TGTTCTGGTAGCAGTGTGGGGGG - Intronic
971235641 4:24839674-24839696 TGCAATGGAAACTGTGTGAGAGG + Intronic
971935120 4:33137895-33137917 TGTCATTGTAACAGTGTTGGGGG - Intergenic
972167503 4:36305454-36305476 TACCATGAGAACAGTATGGGGGG + Intronic
973370535 4:49243608-49243630 GGCCTTGGTCACAGTGTTGGGGG - Intergenic
973383811 4:49487768-49487790 GGCCTTGGTCACAGTGTTGGGGG - Intergenic
973390489 4:49551808-49551830 GGCCTTGGTCACAGTGTTGGGGG + Intergenic
974104677 4:57456327-57456349 TGCCACGAGAACAGTGCGGGAGG + Intergenic
977223245 4:94363323-94363345 TAACATGGTAACAGTGAGGGTGG - Intergenic
977442316 4:97083766-97083788 GACCACAGTAACAGTGTGGGTGG + Intergenic
979676198 4:123412828-123412850 GGCCATGGAAACACTCTGGGAGG + Intergenic
979778662 4:124622489-124622511 TGCCATTGTAACAGTGTTAGAGG - Intergenic
980324345 4:131322989-131323011 TACCATGAGAACAGTATGGGGGG - Intergenic
980513545 4:133824295-133824317 TACCATGAGAACAGTATGGGAGG - Intergenic
980621374 4:135309026-135309048 TCCCAATGCAACAGTGTGGGAGG + Intergenic
981694267 4:147543884-147543906 TGAAATGGTGACAATGTGGGAGG - Exonic
983033053 4:162827609-162827631 TGCAATGCCAACAGTTTGGGCGG + Intergenic
983393779 4:167167949-167167971 TACCATGAGAACAGTATGGGGGG - Intronic
985416108 4:189737188-189737210 TACCACGGGAACAGTATGGGAGG - Intergenic
985434551 4:189916527-189916549 TGTCATCCCAACAGTGTGGGAGG + Intergenic
1202767657 4_GL000008v2_random:163111-163133 GGCCTTGGTCACAGTGTTGGGGG - Intergenic
985730386 5:1544127-1544149 TGCCATGGCAGGAGAGTGGGAGG + Intergenic
986432982 5:7699842-7699864 TACCATGTCAACAGTTTGGGAGG - Intronic
986481188 5:8189841-8189863 TGTCAGGGTCACTGTGTGGGGGG - Intergenic
988133850 5:27142398-27142420 TGTAATGGTAACAAAGTGGGAGG - Intergenic
989067941 5:37482500-37482522 TACCATGAGAACAGTATGGGGGG + Intronic
991417777 5:66409483-66409505 TACCATGAGAACAGTATGGGGGG + Intergenic
992217670 5:74542131-74542153 TGCAATCGTAACACTTTGGGAGG + Intergenic
994386823 5:99142741-99142763 TACCATGAGAACAGTATGGGGGG - Intergenic
995723597 5:115163350-115163372 TGACATTTTAACAGTGGGGGAGG + Intronic
995760992 5:115561774-115561796 TACCATGAGAACAGTATGGGGGG + Intergenic
999113563 5:149142131-149142153 TGCCATGGGAACAGGGGTGGGGG + Intronic
1000367002 5:160501027-160501049 TGCTATGGTAACAGTGGGGGTGG + Intergenic
1002795015 6:465267-465289 TGCCATGGACACTGTGGGGGGGG + Intergenic
1007833690 6:44657831-44657853 AGCCATGGCAAGAGTGAGGGAGG + Intergenic
1010052600 6:71525367-71525389 TGTGATGGTAGCAGTTTGGGCGG - Intergenic
1012583768 6:100898537-100898559 ACCCATGTTAACAGGGTGGGGGG - Intergenic
1014417113 6:121196240-121196262 TGCCATGGTAGCAGGGATGGAGG + Intronic
1015824611 6:137298383-137298405 TTGGATGGTAACAGTGAGGGAGG - Intergenic
1015901566 6:138073651-138073673 TACCATGAGAACAGTATGGGGGG - Intergenic
1016706857 6:147118839-147118861 TGCCAGTGTAACAGTGATGGGGG + Intergenic
1016850192 6:148611330-148611352 TGACATGGTACTTGTGTGGGCGG - Intergenic
1017195398 6:151694953-151694975 TGCCAGGGTGGAAGTGTGGGTGG + Intronic
1017649409 6:156567294-156567316 TTCCTTGGTAACACGGTGGGTGG - Intergenic
1019209138 6:170390901-170390923 CGCCTTGGGAACAGTGTGGAAGG + Intronic
1019580210 7:1758277-1758299 AGCCATGGTAGCAGGGAGGGAGG - Intergenic
1019644700 7:2122850-2122872 GGCCATGGCGTCAGTGTGGGTGG + Intronic
1019802303 7:3096984-3097006 TACCATGAGAACAGTATGGGGGG - Intergenic
1019893493 7:3965402-3965424 TGCCGTGGTAACAGTGCAGGTGG - Intronic
1020184571 7:5949110-5949132 TGTCATCGTAACACTATGGGAGG - Intronic
1020298345 7:6775634-6775656 TGTCATCGTAACACTATGGGAGG + Intronic
1023227074 7:37981974-37981996 TTCCAAGGTAACAGGGTGGTAGG + Intronic
1026239319 7:68558362-68558384 TACCATGAGAACAGTATGGGGGG + Intergenic
1026537652 7:71253370-71253392 TACCATGAGAACAGTATGGGGGG + Intronic
1026554357 7:71392948-71392970 TTCCATGATTACAGTGTGTGGGG - Intronic
1026861649 7:73793920-73793942 GGCCATGGTAGCAGCGGGGGAGG + Intergenic
1029259765 7:99293931-99293953 TGCCAGGGTCAGAGTGTGGTGGG - Intergenic
1030015579 7:105216936-105216958 TGCCATGGTAACTGTGTACATGG + Intronic
1030267475 7:107635066-107635088 TACCATGAGAACAGTATGGGGGG - Intergenic
1030526486 7:110660868-110660890 TGCCATGCTAGCAGTGAGCGAGG + Intergenic
1034417198 7:150971401-150971423 TGCCATGGTAACAGGGTCAGAGG - Intronic
1035952318 8:4036345-4036367 TACCATGGTAACAATTTTGGAGG - Intronic
1036427576 8:8659800-8659822 TTCCCTGGTGCCAGTGTGGGTGG - Intergenic
1036800260 8:11785884-11785906 TGCCTTGTTAACTTTGTGGGTGG + Intronic
1037163126 8:15796198-15796220 AGCCAAGGTAACAATCTGGGTGG + Intergenic
1038279644 8:26152407-26152429 TGACATGTTAACAGTCTGGTAGG + Intergenic
1039846211 8:41327299-41327321 TGACATGGCAGCAGTGGGGGAGG - Intergenic
1042787591 8:72566795-72566817 AACCTTGGTAACAGTGTTGGAGG + Intronic
1042809173 8:72805161-72805183 GGCAATGATAACAGTGTGTGAGG - Intronic
1042979861 8:74514498-74514520 TGCATTGGTAACAGTGTGTGAGG - Intergenic
1043040864 8:75260114-75260136 TGCTATAGAAAAAGTGTGGGAGG + Intergenic
1043559851 8:81479769-81479791 TGCGATGGTAGTAGTATGGGTGG + Intronic
1046311688 8:112445473-112445495 TGTCATGGTGACAGTGAGAGTGG + Intronic
1047342337 8:123994244-123994266 TGTTATGTTATCAGTGTGGGTGG + Intronic
1047969472 8:130072342-130072364 TACCATGAGAACAGTATGGGGGG - Intronic
1048367927 8:133754622-133754644 TGCCGTGCTTACAGGGTGGGAGG + Intergenic
1048827103 8:138438906-138438928 TGCCATGGCAACCTTGTGGGTGG + Intronic
1049156991 8:141073324-141073346 TGCCAAGGTCACAGCCTGGGAGG - Intergenic
1050995743 9:12215290-12215312 TACAATGAGAACAGTGTGGGGGG + Intergenic
1051490416 9:17657873-17657895 TGCCAGGGTAACAGAGAGGTAGG - Intronic
1052153105 9:25144403-25144425 TGCCATTGTAACAGTATGAAGGG - Intergenic
1052336872 9:27329424-27329446 TGCCAAGGTAACAGTGGAGCTGG - Exonic
1052876245 9:33567980-33568002 TGCCTTGGTCACAGTGTTGAGGG + Intronic
1053514101 9:38715252-38715274 TGCCCTGTAAAGAGTGTGGGGGG - Intergenic
1053911728 9:42913040-42913062 TGCCTTGGTCACAGTGCTGGGGG + Intergenic
1054373472 9:64429912-64429934 TGCCTTGGTCACAGTGCTGGGGG + Intergenic
1054681101 9:67919683-67919705 TGCCTTGGTCACAGTGCTGGGGG + Intergenic
1054965898 9:71026489-71026511 TGCCAGGAAAACAATGTGGGTGG - Intronic
1055351083 9:75389069-75389091 TGGCATGGTCTCAGTGTGGCTGG + Intergenic
1055401613 9:75930184-75930206 TACCATGAGAACAGTATGGGGGG + Intronic
1055725332 9:79221705-79221727 TACCATGAGAACAGTGTGGGGGG - Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057679194 9:97161067-97161089 TGCCTTGGTCACAGTGTTGAGGG - Intergenic
1058142716 9:101375103-101375125 TACCATGAGAACAGTATGGGGGG - Intronic
1059303581 9:113335693-113335715 TGCAATGGAAACAATGTGAGTGG + Intronic
1059572443 9:115453933-115453955 TACCATGAGAACAGTATGGGGGG - Intergenic
1060739290 9:126087682-126087704 TGCCATTGTAACAGTATTAGAGG - Intergenic
1060742921 9:126111338-126111360 TACCATGAGAACAGTATGGGGGG - Intergenic
1061154598 9:128850140-128850162 TGCAATCCTAACACTGTGGGAGG - Intronic
1203692072 Un_GL000214v1:52062-52084 GGCCTTGGTCACAGTGTTGGGGG - Intergenic
1203548413 Un_KI270743v1:147983-148005 GGCCTTGGTCACAGTGTTGGGGG - Intergenic
1203644223 Un_KI270751v1:52129-52151 GGCCTTGGTCACAGTGTTGGGGG + Intergenic
1186307353 X:8276838-8276860 CGCCAGGGAAATAGTGTGGGTGG + Intergenic
1187300876 X:18048411-18048433 TGCCTTGGACACAGTGTTGGGGG + Intergenic
1189081321 X:37975612-37975634 TCCCATGGTCACAGAGTGGGTGG + Intronic
1190023887 X:46904223-46904245 TGACATGGCAACAGTGGGGAGGG - Intergenic
1192552066 X:72062538-72062560 TGCCTTGGGAACAGGGTTGGGGG + Intergenic
1193745479 X:85274529-85274551 TGTCATGGTTACAGTGGGGCTGG + Intergenic
1194161414 X:90457565-90457587 TGCCCTGGTAACAGATTGGATGG + Intergenic
1194996484 X:100596566-100596588 TGCCATGGATACAGTGTGGAGGG - Intronic
1196779018 X:119365769-119365791 TAGCATGGCAACAGTGTGGTAGG - Intergenic
1198691759 X:139292465-139292487 TGACAGGGAAACAGTGTAGGAGG + Intergenic
1199320991 X:146439156-146439178 TGTGATGGTAGCAGTTTGGGAGG + Intergenic
1199846662 X:151696389-151696411 TGCCATGGGAACTGTTTTGGGGG + Intronic
1200507703 Y:4035294-4035316 TGCCCTGGTAACAGATTGGATGG + Intergenic