ID: 1105474691

View in Genome Browser
Species Human (GRCh38)
Location 13:20719981-20720003
Sequence GATATATCCCGTGTTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105474691_1105474692 5 Left 1105474691 13:20719981-20720003 CCTGGAACAACACGGGATATATC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1105474692 13:20720009-20720031 TCCTACATTCCGTCCTTTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105474691 Original CRISPR GATATATCCCGTGTTGTTCC AGG (reversed) Intronic
902042688 1:13504250-13504272 GATAAGTCCCCTGATGTTCCTGG - Intronic
904069419 1:27781792-27781814 TATATATGCATTGTTGTTCCAGG - Intronic
908506797 1:64810822-64810844 GTTAAAACCCGTGTTGTTCTAGG - Intronic
911884350 1:103278581-103278603 AATATATCCTGTTTTGCTCCTGG + Intergenic
921545568 1:216470753-216470775 GTTAAAACCCGTGTTGTTCAAGG + Intergenic
923202159 1:231723280-231723302 GTTAAAACCCGTGTTGTTCAAGG + Intronic
1064481128 10:15741871-15741893 TATTTATCCCGTGATGTCCCTGG + Intergenic
1064882377 10:20070523-20070545 GATATATCCAGTATAGTGCCAGG + Intronic
1068464734 10:57375312-57375334 GATATAACCTGTAGTGTTCCAGG - Intergenic
1072671981 10:97437117-97437139 GATAAATCCATTGTTTTTCCTGG - Intronic
1078262145 11:9719776-9719798 GACACATCCTGTTTTGTTCCTGG - Intronic
1082618156 11:55388001-55388023 GATATTTCACGTGTTATTCTTGG + Intergenic
1084439673 11:69165576-69165598 GAGATATCCCGTGTGCTTCCAGG + Intergenic
1088614810 11:111614700-111614722 GTTAAATCCCATGTTGTTCAGGG + Intronic
1089495616 11:118907436-118907458 GCTGTAGCCCGTGATGTTCCTGG - Intronic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1105474691 13:20719981-20720003 GATATATCCCGTGTTGTTCCAGG - Intronic
1108026199 13:46180604-46180626 GATTTTTCCCCTGATGTTCCTGG + Intronic
1110455743 13:75688554-75688576 TATATATCCCATGTTGTTTTTGG + Intronic
1111822509 13:93229954-93229976 GAAATATACCCTGTTGTTACAGG + Intronic
1117191127 14:53292990-53293012 GATATGGCCAGTGTTTTTCCTGG + Intergenic
1119645961 14:76348807-76348829 GATATACCCCGTGTTGATGCAGG + Intronic
1120002499 14:79318387-79318409 GATCTACTCCGTGTTGTTTCTGG - Intronic
1130707074 15:86243499-86243521 GATAAATCTCCTGTTGTTCATGG + Intronic
1142913540 17:3115089-3115111 GAGAAATCCAGTGTTGTTCCTGG + Intergenic
1144192635 17:12860575-12860597 GATATATCCAGGGTTTTTTCTGG + Intronic
1155769033 18:29673185-29673207 GATAAATCCTGAGTTCTTCCTGG + Intergenic
936955092 2:118014736-118014758 GATGTACCCCTTGTTGGTCCCGG + Intergenic
940031676 2:149270012-149270034 GATATATCCAGTGGGGTTGCTGG - Intergenic
947805780 2:232966924-232966946 GATATTTACAGTGTTGTTCTTGG + Intronic
1170612450 20:17925764-17925786 GATAAACCCCGTGTTGTTTTAGG - Intergenic
1173534912 20:43802106-43802128 GATGCATCCAGTGTTGTTGCTGG + Intergenic
969649477 4:8455794-8455816 GTTCAATCCCGTGTTGTTCAAGG - Intronic
974518087 4:62942408-62942430 AATATATCTCATGTTTTTCCTGG - Intergenic
974767635 4:66368405-66368427 AATATAACCTGTCTTGTTCCAGG - Intergenic
975928529 4:79489946-79489968 AATATATCCCGTTATGTTTCTGG + Intergenic
984748359 4:183245895-183245917 GATATATCCCTTGTGTATCCTGG - Intronic
1002952937 6:1833291-1833313 GATGTGTCCAGTGTTGTTCTGGG - Intronic
1003126354 6:3359114-3359136 GATGCAGCCCGTGTTGTTCTGGG - Intronic
1003642971 6:7891089-7891111 GAAATATCCAGTGTAGCTCCAGG - Intronic
1014415761 6:121181865-121181887 GATATATGCCTTTTTGTGCCTGG - Intronic
1021903738 7:25313202-25313224 GATGTATCCTGTGTGGTTCTCGG + Intergenic
1028635817 7:92988165-92988187 GATATGTCCTGTCTTGTTCCTGG + Intergenic
1028941019 7:96522158-96522180 CATACATCACGTGTAGTTCCTGG + Intronic
1033793275 7:144817922-144817944 GATTTCTCCAGTGTGGTTCCTGG - Intronic
1035216687 7:157372825-157372847 GATGTGTCCCGTCTTGCTCCAGG + Intronic
1037153940 8:15676564-15676586 GGTATTTCCTGGGTTGTTCCAGG + Intronic
1037711957 8:21361888-21361910 CATTTATCCCTTGTTGGTCCTGG - Intergenic
1040660329 8:49566632-49566654 GGTATATGCAGTTTTGTTCCAGG + Intergenic
1046963604 8:120137306-120137328 GTTATATCCTCTGTTATTCCTGG + Intronic
1047723655 8:127666051-127666073 GATATATCCAGTGGGGTTACGGG - Intergenic
1049259465 8:141631041-141631063 GACATTTCCCATGCTGTTCCAGG - Intergenic
1049259671 8:141632122-141632144 GACATTTCCCATGCTGTTCCAGG - Intergenic
1049259886 8:141633248-141633270 GACATTTCCCATGCTGTTCCAGG - Intergenic
1049260098 8:141634374-141634396 GACATTTCCCATGCTGTTCCAGG - Intergenic
1050063134 9:1731340-1731362 AGTATAACCTGTGTTGTTCCCGG + Intergenic