ID: 1105478402

View in Genome Browser
Species Human (GRCh38)
Location 13:20749306-20749328
Sequence TCTACATTGTAGTAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105478402_1105478408 18 Left 1105478402 13:20749306-20749328 CCATCCTCCTACTACAATGTAGA 0: 1
1: 0
2: 2
3: 13
4: 157
Right 1105478408 13:20749347-20749369 TGCAGCACAACCATTACACTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1105478402_1105478407 17 Left 1105478402 13:20749306-20749328 CCATCCTCCTACTACAATGTAGA 0: 1
1: 0
2: 2
3: 13
4: 157
Right 1105478407 13:20749346-20749368 TTGCAGCACAACCATTACACTGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105478402 Original CRISPR TCTACATTGTAGTAGGAGGA TGG (reversed) Intronic
900831438 1:4968597-4968619 TCTTCATAGCAGTAGGAGAATGG + Intergenic
901578178 1:10217862-10217884 TTTACATTCTAGTAGGGAGAGGG - Intronic
905268811 1:36773263-36773285 TCCACATTGTGGAAGGCGGAAGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907469044 1:54660234-54660256 CCTACATGGTGGTAGGTGGAAGG + Intronic
907961572 1:59288329-59288351 TCTAAATCTTGGTAGGAGGAGGG - Intergenic
909321910 1:74300612-74300634 TCAACATTTTAGTGGGAGAATGG - Intronic
910207433 1:84762167-84762189 TCTGCAATGTTGCAGGAGGAAGG + Intergenic
910416616 1:87007014-87007036 TGTCCATTGCAGTAGGAAGAAGG + Intronic
910698504 1:90047512-90047534 TTTATATTCTAGTAGGAGGATGG - Intergenic
912629710 1:111236133-111236155 ACCACATTGTAGTAGGAGCTTGG - Exonic
913370085 1:118089033-118089055 TTTATATTCTAGTAGGAGGACGG + Intronic
914382384 1:147128813-147128835 TACACAGTGTAGTTGGAGGATGG - Intergenic
917024078 1:170622939-170622961 TTTACATTCTTGTAGGAGGATGG - Intergenic
917229145 1:172817277-172817299 ACTACATTGTAGAATGAGGTGGG - Intergenic
919736808 1:200957762-200957784 CTTACAGTGTAGTGGGAGGAGGG + Intergenic
923220882 1:231891882-231891904 TCTGCATTGTAGAAAGGGGAAGG - Intronic
1063570825 10:7213278-7213300 CCTACTGTGTATTAGGAGGAAGG + Intronic
1065822352 10:29537528-29537550 TCTACATTGTAAGAGGAGACAGG - Intronic
1068623936 10:59218862-59218884 GCTACATTGTAATATGAGGTGGG - Intronic
1070016595 10:72539701-72539723 ACTAAATATTAGTAGGAGGAAGG + Intronic
1070160350 10:73863134-73863156 TCTACTTTGTGGAAGGAGGTGGG + Intronic
1072005342 10:91240878-91240900 GCTACATGGTAGTAGAAAGAGGG + Intronic
1077862884 11:6198968-6198990 TATGTATTGTAGTGGGAGGAAGG - Intergenic
1078067771 11:8089461-8089483 CCCACATGGTAGAAGGAGGAAGG - Intronic
1079944944 11:26730810-26730832 TCTACACTCTAGTAGGAGTGTGG + Intergenic
1080883425 11:36343867-36343889 TCTACATTGTAAAAAGAGCATGG - Intronic
1081394131 11:42564818-42564840 TCTAAATTGCAGTAGGAGTGGGG + Intergenic
1084156040 11:67313039-67313061 TTTGCTTTGTAGCAGGAGGAAGG - Intergenic
1086765992 11:90695038-90695060 TCTTCATAGTAGTATGAGAATGG + Intergenic
1090372616 11:126267289-126267311 TCTTCATGGTAGTGGGAGCACGG + Exonic
1091547235 12:1509619-1509641 TCTACACTGTTGTGAGAGGAGGG + Intergenic
1092755298 12:11757836-11757858 TCTCCCTCGTAGTAGGATGAGGG + Intronic
1094599719 12:31898057-31898079 TCTTCTTTGTAGTAGGGGCAGGG - Intergenic
1094683956 12:32691944-32691966 TCTAAATTGAAATAGGAGGGAGG + Intronic
1096918931 12:55063329-55063351 TCTGCATTGAAATAGAAGGATGG - Intergenic
1098622175 12:72614984-72615006 TATAAATTGGAGAAGGAGGAGGG + Intronic
1098905690 12:76159917-76159939 TGTGAAGTGTAGTAGGAGGAGGG - Intergenic
1099051680 12:77788679-77788701 TCTACATAATAGAAGGAAGAAGG - Intergenic
1102707803 12:114897051-114897073 TCTAGCTTGTAGGAGGAGGTGGG + Intergenic
1105478402 13:20749306-20749328 TCTACATTGTAGTAGGAGGATGG - Intronic
1107759204 13:43658691-43658713 TCTAAATTGCAGTAGGTAGAGGG - Intronic
1108141169 13:47423312-47423334 TCTACATTGTACTAGGGCTAGGG + Intergenic
1111994123 13:95146252-95146274 CCTACTTTATGGTAGGAGGAGGG + Intronic
1112161383 13:96871924-96871946 CCTTCATAGTAGTAGAAGGAAGG - Intergenic
1113410899 13:110088813-110088835 TATACATTGTAGGCCGAGGAGGG + Intergenic
1116380477 14:44261762-44261784 TGGACATTGAAGTATGAGGAGGG + Intergenic
1116823769 14:49651614-49651636 TTTACATTCTAGTAGGGGGTGGG + Intronic
1117240484 14:53827535-53827557 TGTAAATTCTTGTAGGAGGATGG - Intergenic
1117909369 14:60622025-60622047 TTTACATTGTAGCAGGAAGAAGG - Intergenic
1122680407 14:103456631-103456653 TTTACATTCTAGTTGGGGGAGGG - Intronic
1128692701 15:69737353-69737375 TGTGCTTTGTAGTTGGAGGAGGG + Intergenic
1129159470 15:73739397-73739419 TCTGCCTTGGAGTAGAAGGATGG + Exonic
1129910578 15:79222828-79222850 TCTGCATCCTAGCAGGAGGATGG + Intergenic
1130061580 15:80574325-80574347 TTTCCATTGTAGTGGGGGGATGG - Intronic
1131373298 15:91902556-91902578 CCTACATGGGAGTAGGAGGGAGG + Intronic
1131761261 15:95624984-95625006 TCTACATTTTAAGAGGAGAATGG - Intergenic
1134387220 16:13784611-13784633 TCTAGATTGTAGTAGCAACATGG - Intergenic
1134556602 16:15171088-15171110 TCTACATTCTAGTGGGATGGTGG - Intergenic
1134917182 16:18082801-18082823 TCTACATTCTAGTGGGATGGTGG - Intergenic
1136715335 16:32277154-32277176 TCTTGATTCCAGTAGGAGGAAGG - Intergenic
1136752580 16:32652575-32652597 TCTTGATTCCAGTAGGAGGAAGG + Intergenic
1136822011 16:33327866-33327888 TCTTGATTCCAGTAGGAGGAAGG - Intergenic
1136828574 16:33384405-33384427 TCTTGATTCCAGTAGGAGGAAGG - Intergenic
1136833640 16:33483179-33483201 TCTTGATTCCAGTAGGAGGAAGG - Intergenic
1139253503 16:65519286-65519308 GCTACATGGCAGGAGGAGGATGG + Intergenic
1140746534 16:77985508-77985530 TCTCCATTTTAATAGGAGAAAGG - Intergenic
1140915165 16:79486899-79486921 TCCACCTTGTAGGAGGTGGAGGG - Intergenic
1202994112 16_KI270728v1_random:40762-40784 TCTTGATTCCAGTAGGAGGAAGG - Intergenic
1203011276 16_KI270728v1_random:241343-241365 TCTTGATTCCAGTAGGAGGAAGG + Intergenic
1203054719 16_KI270728v1_random:912615-912637 TCTTGATTCCAGTAGGAGGAAGG + Intergenic
1152523145 17:80872302-80872324 TCCACATGGAACTAGGAGGATGG - Intronic
1153361210 18:4198943-4198965 TGTGCATTGTAGTGGGTGGAGGG + Intronic
1154030403 18:10748539-10748561 TCTTCTTTGCAGCAGGAGGAAGG + Exonic
1158877404 18:61746378-61746400 TCTCTATTGTGGTAGCAGGAAGG - Intergenic
1160069886 18:75618825-75618847 TCTACATTGTAATAATAGGCTGG + Intergenic
1162833408 19:13300903-13300925 TCTTCATTGTAGGAAGAGAAGGG - Intronic
1164821248 19:31252767-31252789 TCTTCATAGTAGTATGAGAATGG + Intergenic
1166684024 19:44784407-44784429 TCTCCATTCTGGTAGGAGGAGGG + Intronic
925590771 2:5507423-5507445 TCTAGATTCTAGCAGAAGGAGGG + Intergenic
926452795 2:13026245-13026267 TCAACATTGTAATAGCATGACGG - Intergenic
929806458 2:45150605-45150627 TCTACAGTCCAGTAGGAGGAAGG + Intergenic
931079594 2:58753935-58753957 TCTTCATAGTAGTAGGAAAATGG + Intergenic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
933750158 2:85598160-85598182 TAGACATTGCAGTGGGAGGAGGG - Intergenic
934101076 2:88653613-88653635 TCTATATGGAGGTAGGAGGAAGG - Intergenic
936933192 2:117811431-117811453 TCTACATTGTAGAAAGCAGATGG - Intergenic
938763373 2:134444364-134444386 TCTACAGTGGGGTAGGAGGTGGG - Intronic
940475849 2:154161433-154161455 TATGCATTGTGGTAGGAGTAGGG + Intronic
941236118 2:162976459-162976481 TTTTCATTGAAGTAGGAGTAAGG - Intergenic
941491952 2:166153631-166153653 TCTACATACTAGGAGGAGCATGG + Intergenic
942679232 2:178459308-178459330 TCTGCAATTTTGTAGGAGGAGGG + Intronic
945526577 2:210895276-210895298 TCTAGATTCTCGTAGGAGCATGG - Intergenic
946047766 2:216835402-216835424 TCTCCATGGTAGCAGGAGGCAGG - Intergenic
946361101 2:219219768-219219790 TCTAAATTGTAGGAGCAGGATGG - Exonic
947948625 2:234128152-234128174 TCTATATTTTAGTAATAGGAAGG - Intergenic
1170116052 20:12860808-12860830 TCTACAGTGGAATAGGAGAATGG + Intergenic
1172962145 20:38806676-38806698 TCTACATGGGGGAAGGAGGAGGG - Intronic
1178353335 21:31889130-31889152 TGTTCATTCTCGTAGGAGGATGG - Intronic
949172777 3:1021977-1021999 TCTACATCATGGTAAGAGGACGG + Intergenic
949660964 3:6278035-6278057 TTTACATTCTAGTGGGTGGAGGG + Intergenic
950367336 3:12496894-12496916 CCTACAGTGTAGCTGGAGGAAGG - Intronic
950987983 3:17396669-17396691 GTTACATTGTAGTATGTGGATGG - Intronic
951350514 3:21601959-21601981 TCTTCATAGCAGTAGGAGAATGG - Intronic
952080900 3:29756329-29756351 TCTTCATAGAAGTATGAGGATGG - Intronic
952508315 3:34028223-34028245 ACTACATGGTAGTAGGTGGGTGG - Intergenic
954048788 3:47955360-47955382 GCTACATTATGGTAGGAGAATGG - Intronic
955871056 3:63438913-63438935 TCTTCATTGCAGTAGGAGAAAGG - Intronic
957654965 3:83062055-83062077 TCTTCATAGCAGTAGGAGAAGGG - Intergenic
959035322 3:101356139-101356161 TCAACATTATAGTGAGAGGAAGG - Intronic
959070431 3:101696805-101696827 TCTTAATTGTACTATGAGGAAGG - Intergenic
962301428 3:134246891-134246913 TCTAGATTGGAGCAAGAGGATGG + Intronic
965896038 3:173577446-173577468 TATAAATTGTACTAGGAGGAAGG - Intronic
967632435 3:191760860-191760882 CTTACAATGTAGTAGGAAGAGGG + Intergenic
967784198 3:193472040-193472062 TCTACATAGGAGTGGGATGAGGG + Intronic
968983361 4:3862850-3862872 TCTCCATTGTAGGAGGACGCAGG + Intergenic
970886404 4:20992108-20992130 TCTTCATAGTAGTATGAGAACGG - Intronic
971178671 4:24306787-24306809 TCTACAAAGTAGTAATAGGAAGG + Intergenic
971644784 4:29185032-29185054 TCTACAATGGAGTAAGAGAAAGG - Intergenic
974507739 4:62798488-62798510 TATACATTGTAGTAGGAACCAGG + Intergenic
980001315 4:127492129-127492151 CCTACATTGAAAGAGGAGGAAGG + Intergenic
982400894 4:154966591-154966613 TCTTTATAGTAGTACGAGGACGG + Intergenic
983906657 4:173190238-173190260 TCCACATTGCAGCAGTAGGAAGG + Intronic
990085808 5:51975161-51975183 TCTACATTCTAGGAGGAATAAGG + Intergenic
992075904 5:73192471-73192493 TCTTCATAGCAGTAGGAGAATGG + Intergenic
993823885 5:92657030-92657052 TCAACATTGTAGAAGGAAGAGGG + Intergenic
995574271 5:113513390-113513412 TTTATATTTTAGTGGGAGGAGGG - Intergenic
996484156 5:124011837-124011859 CCAACATTGTAGAGGGAGGATGG - Intergenic
997606642 5:135179612-135179634 TCTACCTCGCAGCAGGAGGAGGG + Intronic
1005730103 6:28688452-28688474 TCTTCATTGTACTGTGAGGAAGG - Intergenic
1007571869 6:42898200-42898222 TCTTAATTGTACTATGAGGAAGG + Intergenic
1007943651 6:45805612-45805634 ACTATATTGTAGTAGGTAGAAGG - Intergenic
1008226019 6:48918137-48918159 CCTACATAGTTGTAGGAAGAAGG - Intergenic
1009529574 6:64794625-64794647 TCTTCATAGTAGTATGAGAATGG + Intronic
1015545495 6:134357166-134357188 TCTAAATGGTAGTTGGGGGAAGG - Intergenic
1016129511 6:140448811-140448833 TATACATTGTTGTAGCAAGATGG - Intergenic
1016680211 6:146820540-146820562 TGTACATTGAAGTGTGAGGAGGG + Intergenic
1017203604 6:151781315-151781337 TCTACATGGTGGAAGGCGGAAGG + Intronic
1017555906 6:155567994-155568016 TCGACATTCTTGTAGGAGTAAGG + Intergenic
1017750725 6:157488197-157488219 TCTTAATTGTAGTGGGAGGCGGG + Intronic
1018336100 6:162791743-162791765 ACTGCATTCTAGAAGGAGGATGG + Intronic
1024060893 7:45697750-45697772 TCAACATAGTAGTTGGAGGCAGG - Intronic
1024228323 7:47345276-47345298 TGTATATTGTATTAGAAGGATGG - Intronic
1028470481 7:91201113-91201135 TCTACATTTGAGAAGGAGGTTGG + Intronic
1028768297 7:94585610-94585632 TTTACATTGTATTAAGAAGATGG - Intronic
1029570953 7:101368786-101368808 ACTACTTTGAAGTAGGAGGCGGG - Intronic
1030556139 7:111026176-111026198 TATACAATGTAGTAGAATGAAGG - Intronic
1032420643 7:131776285-131776307 CCACCATTGCAGTAGGAGGAGGG + Intergenic
1040948276 8:52908035-52908057 TATACTCTGTTGTAGGAGGAAGG - Intergenic
1041362031 8:57064812-57064834 TCTACATTTTATAAGGAGGATGG - Intergenic
1041517276 8:58714346-58714368 TTTACATGGTAGAAGGAGCAAGG - Intergenic
1041654958 8:60339809-60339831 TCTACATTGTGGAAGGAATATGG - Intergenic
1042149040 8:65761801-65761823 TCTACTTTCTAATATGAGGAGGG - Intronic
1044590517 8:93909795-93909817 TCTACAGTGTAGCAAGAGGAGGG - Intronic
1044859680 8:96510657-96510679 CCTACAATGGAGTTGGAGGAGGG + Intronic
1045776657 8:105811682-105811704 TTTACATTGTAGCAGGAGGACGG - Intergenic
1047020014 8:120765393-120765415 TCTACGTTATAGGAAGAGGAAGG - Intronic
1047524798 8:125623607-125623629 TCCACATTCCAGTAGGAAGAAGG - Intergenic
1048602411 8:135932161-135932183 TGTAAGTAGTAGTAGGAGGAGGG + Intergenic
1050061363 9:1713016-1713038 TTTACAGTGGAGTAAGAGGAGGG - Intergenic
1050714131 9:8501493-8501515 TCTATATTCTAGAATGAGGATGG + Intronic
1055447240 9:76395115-76395137 TCTGCATTGCAGTAGAGGGACGG - Intergenic
1055475059 9:76654816-76654838 CCTACAGTGTGGTAGGAAGAAGG - Intronic
1055995340 9:82151674-82151696 TCTTTATTGTAGAATGAGGAGGG + Intergenic
1059294764 9:113260379-113260401 TCTGCATTGCAGTAGCAGCAGGG + Exonic
1060590758 9:124815134-124815156 TCTCCATTTTAATAGGAGAAAGG - Intergenic
1186495940 X:10013359-10013381 TCTGTGTTGTAGTAGGAGGAGGG + Intergenic
1186562330 X:10625952-10625974 TCTAAATTGTAGCAGGAGGATGG + Intronic
1186997786 X:15142033-15142055 TCTACATGGAAATATGAGGATGG + Intergenic
1187259698 X:17673873-17673895 GTAACATTGAAGTAGGAGGAGGG - Intronic
1195935847 X:110125094-110125116 TTTACATTGTAAAATGAGGACGG + Intronic
1198790342 X:140338789-140338811 TCTACAGATTATTAGGAGGAAGG - Intergenic
1199239470 X:145529407-145529429 TTTACATGGTGGCAGGAGGAGGG - Intergenic