ID: 1105494028

View in Genome Browser
Species Human (GRCh38)
Location 13:20914641-20914663
Sequence TGAGATTCCATATGAATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 6, 3: 110, 4: 445}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105494028_1105494031 26 Left 1105494028 13:20914641-20914663 CCTGTCATTCATATGGAATCTCA 0: 1
1: 0
2: 6
3: 110
4: 445
Right 1105494031 13:20914690-20914712 TTGAAAAAGAAGACCACGATTGG 0: 1
1: 0
2: 4
3: 45
4: 422
1105494028_1105494032 29 Left 1105494028 13:20914641-20914663 CCTGTCATTCATATGGAATCTCA 0: 1
1: 0
2: 6
3: 110
4: 445
Right 1105494032 13:20914693-20914715 AAAAAGAAGACCACGATTGGAGG 0: 1
1: 0
2: 4
3: 37
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105494028 Original CRISPR TGAGATTCCATATGAATGAC AGG (reversed) Intergenic
900212798 1:1464764-1464786 TGAGATTCCATATGAATTTTAGG + Intronic
900317395 1:2064839-2064861 TGAGATTCCAGATGAATTTTAGG + Intronic
901682809 1:10924787-10924809 TGAAATTCCATATGAATTTAAGG + Intergenic
902106082 1:14037282-14037304 AGACATTCCATTTGCATGACAGG + Intergenic
903100658 1:21026054-21026076 TGAGAATACATATGAATATCAGG - Intronic
903268010 1:22170042-22170064 TGAGAAGCCATGGGAATGACTGG + Intergenic
903599043 1:24520959-24520981 TGAGGTTCTATATGAATTTCAGG - Intronic
905073548 1:35248997-35249019 TGAAATTCCATATGAATTTCAGG + Intergenic
905317178 1:37090220-37090242 TGAGAGTCCATTTGAATCAGTGG - Intergenic
905406613 1:37737096-37737118 TTAGATTCCATATGAATTTTAGG - Intronic
905505099 1:38472438-38472460 TGACATTCCATATGAATTTTAGG - Intergenic
906709853 1:47921190-47921212 TCAGACTCCTTAGGAATGACAGG + Intronic
906977396 1:50590156-50590178 TGAAATTCCATATGAATTTTTGG + Intronic
907057502 1:51384231-51384253 TGAGATTCCATATGAATTTTAGG - Intronic
907178030 1:52543887-52543909 TGAGATTCCATGTGAATTTTAGG - Intronic
907525359 1:55050733-55050755 TGAGATCCCACATGAATTTCAGG - Intronic
908462669 1:64360764-64360786 TGAGATGCCATATGAATTTTAGG - Intergenic
908889905 1:68834449-68834471 TGAGATTCCATATGAACTTTAGG - Intergenic
910706620 1:90137049-90137071 TGAGATTCCATATGAAATTTGGG + Intergenic
910785059 1:90988537-90988559 TGAGATTCCATATGAATTTAAGG - Intronic
913369148 1:118077628-118077650 TGGGACTACAAATGAATGACAGG - Intronic
914383995 1:147149813-147149835 TAAGATTCCATATGAATGTAAGG - Intergenic
915159275 1:153905501-153905523 TGAGATGCCATATGAATTTTAGG - Intronic
915388257 1:155517101-155517123 TGAGATTCCATATGGATTTTAGG - Intronic
915467832 1:156107604-156107626 TGAGATTTCATTTGAGTGAGGGG + Intronic
917607480 1:176647932-176647954 TGAGGTTCCATATAAATTTCAGG + Intronic
917611387 1:176692362-176692384 TGGCATTTCATATGAATGAGGGG + Intronic
918256134 1:182749582-182749604 TGTGATTCCATATGAATTTTAGG + Intergenic
918898289 1:190378024-190378046 TGAGATTCCATATTAATTTTAGG - Intronic
919288411 1:195596347-195596369 TGAGATTCTATAAAAATGAAGGG - Intergenic
919481573 1:198096589-198096611 TCAGATTCCAGATGAATATCAGG + Intergenic
919876686 1:201874540-201874562 TGAGATTTCATATGGCAGACTGG - Intronic
920894324 1:210029738-210029760 TGAGATTCCATATGAATTTTAGG + Intronic
923025481 1:230200517-230200539 TGAGCTGCCCTGTGAATGACTGG + Intronic
924536943 1:244943438-244943460 TGAGATTCCATATGAATTTTAGG - Intergenic
924897709 1:248360357-248360379 TGAGATTTAATGCGAATGACAGG + Intergenic
1062766185 10:67195-67217 TGATATTTCGTATAAATGACAGG + Intergenic
1064399265 10:15007607-15007629 TGTGATTCCACCTGGATGACAGG + Intergenic
1064497153 10:15923015-15923037 TGAGATTCTATATGAATTTTAGG + Intergenic
1064700471 10:18013955-18013977 TGAGATTTCATATGAATTTTAGG + Intronic
1064800155 10:19061432-19061454 TGAGATTCTACATGAATTTCAGG - Intronic
1064969715 10:21052530-21052552 TGAGCTTCCACATGAAGGGCAGG - Intronic
1065074922 10:22067806-22067828 TGAGATTCCATATGAATATTAGG + Intergenic
1065401727 10:25310385-25310407 TGAGATTACATATGAATTTTAGG + Intronic
1065459536 10:25943368-25943390 TGAGATTCCATATGAGTTTTAGG + Intronic
1066016492 10:31249906-31249928 TGAGATTCCATATGAATTTTAGG + Intergenic
1066095208 10:32065802-32065824 TGTGGTTCCATATGAATTTCTGG + Intergenic
1067282512 10:44883143-44883165 TGAGCTGCCCTTTGAATGACAGG - Intergenic
1067307506 10:45078888-45078910 TCAGATCCTATATGAAGGACCGG + Intergenic
1067353470 10:45499922-45499944 TGTGATTCCATATAAATTACAGG + Intronic
1067413751 10:46087713-46087735 TGAGATTCCATATAAATTTTAGG + Intergenic
1067516922 10:46956722-46956744 TGAAATTCCATATGAATTTTAGG + Intronic
1067645330 10:48095104-48095126 TGAAATTCCATATGAATTTTAGG - Intergenic
1068265284 10:54640665-54640687 TGAAATTACTTATAAATGACAGG + Intronic
1068961895 10:62875172-62875194 TGAGATTCCATATGAATTTAAGG + Intronic
1069011275 10:63375941-63375963 TGAGATTCTGTATGAATTTCAGG - Intronic
1069088323 10:64168552-64168574 TGAGGTTCCATATGAATTTTAGG + Intergenic
1069271006 10:66527397-66527419 TGAGATTCCATATGAAATTGAGG + Intronic
1069358834 10:67618875-67618897 TGAGATTCAAGATGGGTGACTGG - Intronic
1070098007 10:73357335-73357357 TGAGAATACATATGCATGCCAGG + Intronic
1071254513 10:83858601-83858623 TGATTTTACATATGAATTACAGG - Intergenic
1072142152 10:92598580-92598602 TGGGATTCCATATGAATTTGAGG + Intronic
1072246145 10:93545764-93545786 TGAGATTCCATCTCAAAAACAGG + Intergenic
1072552030 10:96486581-96486603 TGGGATTCCAGATGGGTGACAGG + Intronic
1072645957 10:97254179-97254201 TGAGATTCCGTATGAATTTTAGG - Intronic
1072775962 10:98193984-98194006 TGAGATTCCATATGAATTTTAGG - Intronic
1073198502 10:101715381-101715403 TGTGGTTCCATATGAATTTCGGG + Intergenic
1073505277 10:103981818-103981840 TGAGATTCCATGTGAATTTTGGG + Intronic
1073581503 10:104670670-104670692 TGAGATTCCATATGAATTTTAGG + Intronic
1073695810 10:105865994-105866016 TGAGTTTGCATATGAAGGACAGG + Intergenic
1075026639 10:118989709-118989731 TGAGATTCCATGTGAATTTTAGG - Intergenic
1075966729 10:126618332-126618354 TGAGTTTCCATGTCAATGTCAGG - Intronic
1076592428 10:131593646-131593668 TGAGATTCTATATGAATGTTAGG + Intergenic
1076592745 10:131598346-131598368 TGAGATTCTATATGAATGTTAGG + Intergenic
1076602250 10:131665505-131665527 TGAGACTCAATATGCATTACAGG + Intergenic
1077427196 11:2487364-2487386 TGAGATTCCATATGAATTTTAGG + Intronic
1077449331 11:2626912-2626934 TGAGATTCCATGTGAATTTTAGG + Intronic
1077596989 11:3541688-3541710 TGTGGTTCCATATGAATTTCAGG - Intergenic
1077604489 11:3599387-3599409 TGTGATTCCACCTGGATGACAGG + Intergenic
1078254843 11:9649741-9649763 TGAGATTCCATATGAATTTTAGG + Intergenic
1079254423 11:18815132-18815154 TCAGGTTCCATATGAATGTTAGG + Intergenic
1081411963 11:42770014-42770036 TGAGATTCCATATGAATTTTAGG + Intergenic
1081868473 11:46372442-46372464 TGAGATACCAGAGGAAAGACTGG - Exonic
1081927056 11:46839581-46839603 TGTGATGAAATATGAATGACAGG - Intronic
1083030421 11:59586557-59586579 TGAGATTCCATATGAATTTTAGG - Intronic
1084226946 11:67722202-67722224 TGTGATTCCACCTGGATGACAGG + Intergenic
1084252912 11:67915638-67915660 TGTGGTTCCATATGAATTTCAGG - Intergenic
1084260378 11:67973978-67974000 TGTGATTCCACCTGGATGACAGG + Intergenic
1084808251 11:71594653-71594675 TGTGATTCCACCTGGATGACAGG - Intronic
1084812391 11:71621267-71621289 TGTGATTCCACCTGGATGACAGG - Intergenic
1084819954 11:71680354-71680376 TGTGGTTCCATATGAATTTCAGG + Intergenic
1084845359 11:71894663-71894685 TGTGATTCCACCTGGATGACAGG - Intronic
1084901488 11:72313185-72313207 TGAGAGTCCCTCTGAAGGACTGG - Intronic
1086539697 11:87893904-87893926 TGAGATTCCATATGAATCTTAGG + Intergenic
1086791960 11:91051285-91051307 TGAGATTTCATATGAACAAGAGG - Intergenic
1087490052 11:98814009-98814031 TGAGATTCCATATGAATTTTAGG - Intergenic
1088642922 11:111890706-111890728 TGAGATTCCATATGAATTTTAGG + Intergenic
1089799278 11:121011484-121011506 TGAGATTCCATATTAATTTTAGG - Intergenic
1089877278 11:121736572-121736594 TGAGATTCCACATGAATTTTAGG + Intergenic
1090866778 11:130707912-130707934 TGAGATTCCTTATGAATTTTAGG - Intronic
1091191966 11:133703424-133703446 TGAGATCCCATATGAATTTTAGG + Intergenic
1091211683 11:133865821-133865843 TGAGATTCCATATACATTTCAGG + Intergenic
1091707648 12:2709508-2709530 TGAGATTCCATATAAATTTTAGG - Intergenic
1091910030 12:4222719-4222741 TGAGATTCCATGTGAATGTTAGG + Intergenic
1092423158 12:8350465-8350487 TGTGGTTCCATATGAATTTCAGG - Intergenic
1092434591 12:8437146-8437168 TGTGATTCCACCTGGATGACAGG + Intergenic
1092614659 12:10205753-10205775 TGAGTTTGCATATGAAAGGCAGG + Intergenic
1092628224 12:10351114-10351136 TGTGATTCCATATGAATTTCAGG + Intergenic
1092827205 12:12412110-12412132 TGAGATTCCATATGAATTTTTGG + Intronic
1093046339 12:14449682-14449704 TGAGATTCCATATGAATTTTAGG + Intronic
1093206124 12:16252802-16252824 TAATATTCCATATGAATTTCAGG - Intronic
1093695382 12:22153947-22153969 TGTATTTCCATATGAATTACAGG - Intronic
1093832372 12:23778384-23778406 GGAGTTTCCATATGAATGAACGG + Intronic
1093944723 12:25094556-25094578 TTAGATTCCATATGAATTTTGGG + Intronic
1094258952 12:28469587-28469609 TGTGATTCCATATAAATTACAGG - Intronic
1094298309 12:28932869-28932891 TGAGATTCCAGCTAAATGAGTGG + Intergenic
1094388578 12:29922446-29922468 TGGGATTCCATATGAATCTTAGG - Intergenic
1095781082 12:46060506-46060528 TGCGATTCCATATGAATTTTAGG - Intergenic
1097298735 12:57995898-57995920 TGAGATTCTATATGAATTTTAGG + Intergenic
1098165299 12:67691059-67691081 TGATATTCCATATACAGGACAGG - Intergenic
1098546218 12:71714449-71714471 TGAGATTCCATATGAATTTTAGG - Intergenic
1100413733 12:94350144-94350166 TGAGATTCCATACGAATTTTAGG - Intronic
1100424205 12:94467914-94467936 TGAGATTCCATATGAATTTTAGG - Intergenic
1100483940 12:95006547-95006569 TGAGATTCCGTATGAATTTTAGG + Intergenic
1100526792 12:95427101-95427123 TGAGATTCCATTTTAAAGAGTGG - Intergenic
1100683969 12:96965255-96965277 TGAGATTCCATATGAATTTTAGG - Intergenic
1101498856 12:105282517-105282539 TGACATTCCATATGAATTTTAGG - Intronic
1105460771 13:20584116-20584138 TGATATTCCATATGAATTTTAGG + Intronic
1105466810 13:20651160-20651182 TGAGATTCCACATGAATATTAGG + Intronic
1105494028 13:20914641-20914663 TGAGATTCCATATGAATGACAGG - Intergenic
1105774815 13:23648078-23648100 TGAAATTCCATATGAATTTTAGG + Intronic
1106238880 13:27891485-27891507 TGATATTCCATATGAATGTTAGG + Intergenic
1107201740 13:37728682-37728704 TGAGATTCCATATGGATTTTAGG - Intronic
1107361976 13:39628272-39628294 TGAGATTTCATATGAATTTTAGG + Intergenic
1107437877 13:40396869-40396891 TGAAATTCCATATGAATTTTAGG - Intergenic
1107787259 13:43969365-43969387 TGAGATACCAGAGGAAAGACTGG - Intergenic
1108480261 13:50862620-50862642 TGAGATTCCATATGGATTTTAGG - Intergenic
1109290693 13:60471499-60471521 TGAGATTCCTTATGAATTATAGG + Intronic
1109839475 13:67903453-67903475 TGTGATTCCACCTGGATGACAGG - Intergenic
1110062367 13:71058130-71058152 TGAGAGTCCATATGAATTTTAGG + Intergenic
1110210184 13:72962782-72962804 TGAAATTCCATATGAATTTTAGG - Intronic
1111769759 13:92582489-92582511 TGAGATTCCATATAAATTTTAGG + Intronic
1112500177 13:99936898-99936920 TGAGATTCAAATTGAATGACGGG - Intergenic
1113006749 13:105713389-105713411 TGACATTCCATATGAATTTCTGG + Intergenic
1113511805 13:110862344-110862366 TGAGATTTCATATGAATTTTAGG + Intergenic
1113546959 13:111160346-111160368 TGTGATTCCATGTGAATTTCAGG + Intronic
1115898211 14:38114959-38114981 TGAGATTCCATATGAATTTTAGG - Intergenic
1116865457 14:50028156-50028178 AGAGATTCCATAGAAATGTCAGG + Intergenic
1117039678 14:51758220-51758242 TGTGATTCCACCTGGATGACAGG - Intergenic
1117041259 14:51771537-51771559 TGTGATTCCACCTGGATGACAGG + Intergenic
1117114770 14:52498822-52498844 TGAGATTCCATATGAATTTTAGG - Intronic
1117633569 14:57719311-57719333 TGTGATTCCATATGAATTTTAGG + Intronic
1117782410 14:59247376-59247398 TGAGATTCCATATGCCTTCCTGG + Intronic
1118140543 14:63075877-63075899 TGAGATTCCATATGAATTTTAGG - Intronic
1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG + Intronic
1118551350 14:66954126-66954148 TGAGATTCCATATGAATTTCAGG + Intronic
1118561010 14:67082618-67082640 TGAGATTCCATATAAATTTTAGG + Intronic
1118969951 14:70627262-70627284 TGAAATTCCATATGAATTTTAGG - Intergenic
1119570925 14:75671385-75671407 TGCAATTCCATATGAATGTTAGG + Intronic
1120660695 14:87247111-87247133 TGAGATTCTATATGAATTTTAGG + Intergenic
1120701985 14:87707974-87707996 AGAGTTTCCATATGAATGAGTGG - Intergenic
1121367550 14:93328265-93328287 TGAGATGCCATATGAATTTTAGG - Intronic
1122170252 14:99867317-99867339 TGATATTCCATATGAATTTTAGG + Intronic
1122648580 14:103211494-103211516 TGAGAGTCCATATGAATTCTAGG + Intergenic
1122752342 14:103947038-103947060 TGACATTCCATATGAATTTCAGG - Intronic
1123102478 14:105814381-105814403 TTTTATTCCATATGAATGATGGG + Intergenic
1202839230 14_GL000009v2_random:105653-105675 GGAGATTCCATATGAATTTTAGG - Intergenic
1202908608 14_GL000194v1_random:95806-95828 GGAGATTCCATATGAATTTTAGG - Intergenic
1202884648 14_KI270722v1_random:93511-93533 GGAGATTCCATATGAATTTTAGG + Intergenic
1124082149 15:26509814-26509836 TGCATTTCCATATGAATGCCTGG - Intergenic
1124191701 15:27583816-27583838 TGAGATTCCATATGAATTTTAGG - Intergenic
1124809422 15:32920080-32920102 GGAAATTCCAAATGAATGCCAGG + Intronic
1125988339 15:44078431-44078453 TGAGATTCTATGTGAATTATAGG - Intronic
1126463017 15:48933615-48933637 TGAAATTACAGATGAATGTCAGG - Intronic
1127730202 15:61793779-61793801 TGTGGTTCCATATGAATTTCAGG + Intergenic
1127830584 15:62747416-62747438 TTAAATTCTATATGATTGACTGG - Intronic
1128663323 15:69519295-69519317 TGAGATTTCATATGAATTTTAGG - Intergenic
1128825046 15:70706942-70706964 TGAGATTCCATGTGAATGTTAGG - Intronic
1128996081 15:72295900-72295922 TGAGATTCCATATGAATTTTAGG - Intronic
1129576357 15:76751378-76751400 TGAGATTCCATATGAATTTTAGG - Intronic
1130158438 15:81374254-81374276 TAACATTACATATGCATGACTGG - Intergenic
1130943568 15:88532462-88532484 TGAGATACCATATGAATTTTAGG - Intronic
1131630496 15:94171667-94171689 TGAGATTCCCTATCAATTTCAGG - Intergenic
1132791813 16:1694489-1694511 TGAAATTCCATATGAATTATAGG - Intronic
1133177553 16:4026757-4026779 TGTGGTTCCATTTTAATGACAGG + Intronic
1133280818 16:4664276-4664298 TGCAATTCCATGTAAATGACAGG + Intronic
1134264695 16:12683178-12683200 TGAGATTCCGTTTGAATAACTGG + Intronic
1135029689 16:19028480-19028502 TGCGATTCCATATGAATTTTAGG + Intronic
1136423996 16:30156634-30156656 TGAGTTTCCATATGAATTTTAGG - Intergenic
1137024850 16:35462945-35462967 TGAGATTCCATATAAATTTTAGG + Intergenic
1137983067 16:53086063-53086085 TGAGAATCCATATGTTTGAGAGG + Intronic
1138192481 16:55026440-55026462 TGTGATTCCATATGAATTTTAGG - Intergenic
1138326862 16:56180006-56180028 TGAGATTCCATATGAATTTTAGG + Intergenic
1138995265 16:62444105-62444127 TGAGATTCCATATAAATTTTAGG - Intergenic
1140177576 16:72678755-72678777 TGAAATTCCATATTAATTTCAGG - Intergenic
1142439231 16:90084110-90084132 TGAAATTTCATATAAATGATAGG - Intronic
1144285920 17:13774400-13774422 TTTCATTCAATATGAATGACTGG + Intergenic
1145982721 17:29023408-29023430 TCAGATTCCAGAGGAATAACAGG - Intronic
1146238942 17:31197017-31197039 TGAGATTCCATATGAATTTTAGG + Intronic
1148993988 17:51691989-51692011 TGTGATTCCATATGAATTTTAGG + Intronic
1149167766 17:53774115-53774137 TGAGATTCCATATGAATTTTAGG + Intergenic
1150817557 17:68405180-68405202 TGAGATTCCATGTGAATTTTAGG + Intronic
1151849214 17:76680302-76680324 TGAGATGCCATATTGATTACAGG - Intronic
1151911584 17:77086944-77086966 TGAGTTTACATAAGAATGAAAGG - Intronic
1152582863 17:81175436-81175458 TGAGATTCTATATGAATTTTAGG - Intergenic
1152959052 18:66759-66781 TGAAATTTCATATAAATGACAGG + Intronic
1153831384 18:8926530-8926552 TGAGATTCCATATGAATTTGGGG - Intergenic
1155013720 18:21810391-21810413 TGAGATTCCTTATGAATTTCTGG - Intronic
1155425441 18:25701930-25701952 TGAGATTCCGCAGGAATGCCTGG - Intergenic
1155672252 18:28386224-28386246 TGAAATTCCATATGAATTTTAGG - Intergenic
1155683247 18:28515764-28515786 AGAGATATCATATAAATGACTGG + Intergenic
1156320827 18:36020026-36020048 TGAGACTCCATCTGAAAGAATGG + Intronic
1156438251 18:37156670-37156692 TGAGATTTCTTATGAGTGACTGG + Intronic
1156827822 18:41453596-41453618 TGAGATTCCATATTGATTATTGG - Intergenic
1157177708 18:45466455-45466477 TGAGATTCTTTCTGAATGAGAGG + Intronic
1157790216 18:50524633-50524655 TGAGTTTCCAAATGAATGAAAGG - Intergenic
1158339454 18:56449796-56449818 ACAGATCCCATATGAATCACAGG + Intergenic
1159248935 18:65848489-65848511 TGAGATTTCATTTGAAGGAGTGG + Intronic
1159600403 18:70423583-70423605 TTAGTTTCCATATGAAGGATGGG + Intergenic
1161018534 19:1996292-1996314 TGGGATTCCATATGAATTCTAGG + Intronic
1162238558 19:9327788-9327810 TGAGCATCAATACGAATGACAGG - Intronic
1164387776 19:27791180-27791202 TGAGATTCCATATGAAATTTAGG - Intergenic
1164962756 19:32449423-32449445 TGAGTTTCCATATGAATTTCAGG - Intronic
1165556687 19:36639180-36639202 TGAGAAACCCTATGAATGTCGGG - Exonic
1165568018 19:36749011-36749033 TGAGAAACCCTATGAATGTCCGG - Exonic
1165670062 19:37669872-37669894 TGAGAAACCCTATGAATGTCTGG - Exonic
1165712827 19:38024296-38024318 TGAAATGTCATATGAAAGACTGG + Intronic
1166019647 19:40014749-40014771 TGAGATTCCCTATGAATGTAAGG + Exonic
1166019699 19:40015421-40015443 TGAGCTTCCATATGAATGTAAGG + Exonic
1166050938 19:40258910-40258932 TGAAATTCCATGTGAATGTGAGG - Intronic
1166272551 19:41724456-41724478 TGAGATTCCATATGAATTTCAGG + Intronic
1166419263 19:42623186-42623208 TGAGACTCCATATGAATTTTAGG - Intronic
1166424604 19:42665499-42665521 TGAGATTCCATATAAATTTTAGG + Intronic
1167187926 19:47960620-47960642 TGAGATTCCGTATGAATTTTAGG - Intergenic
1168268101 19:55233858-55233880 TGAGATTCCATATGAATTTTAGG - Intronic
1202660057 1_KI270708v1_random:60539-60561 GGAGATTCCATATGAATTTTAGG + Intergenic
925271392 2:2611401-2611423 TGTGATTCCATGTGAATGCTAGG - Intergenic
925354699 2:3230836-3230858 TGGGGTTCCATATGAATTTCAGG + Intronic
925364201 2:3300314-3300336 AGTGATTACATATGAATGGCTGG + Intronic
925506472 2:4570306-4570328 TAAGATTCCATATGAATTTTAGG + Intergenic
925650276 2:6081980-6082002 TGAGATTCCATAAGAAGGGAAGG - Intergenic
925796314 2:7547246-7547268 TGAGATTCCATATGAATTTGAGG + Intergenic
926130276 2:10298819-10298841 TGAGATTCCATATGAATTTTAGG - Intergenic
927315946 2:21682639-21682661 TGAGATTCCATATACATTATAGG - Intergenic
927803808 2:26126615-26126637 TTAGATTCCATATGAATTTTTGG + Intronic
928589180 2:32796650-32796672 TGAGATTCCATTTGAATTTTAGG - Intronic
930306807 2:49684997-49685019 TTTGGTTCCATATGAATTACAGG - Intergenic
931479634 2:62628054-62628076 TGAGGTTCCATATGAATTTTAGG + Intergenic
932350834 2:71030125-71030147 TGTGATTCCACCTGGATGACAGG - Intergenic
932382181 2:71294649-71294671 TGGGATTCCATATGAATTTTAGG + Intronic
933166081 2:79077180-79077202 TGAATTTCCATATGAATGTTAGG + Intergenic
933299169 2:80523380-80523402 AGAAACTCCGTATGAATGACTGG + Intronic
933936231 2:87205843-87205865 TGAGTCTCCAGATGAATGATTGG - Intergenic
934590730 2:95547798-95547820 TGTGATTCCACCTGGATGACAGG - Intergenic
935001074 2:99016152-99016174 TGAGGTTCCATATGAATTTTAGG - Intronic
935683328 2:105658254-105658276 TGAGATTCCATATGAATCTTAGG - Intergenic
936239476 2:110774820-110774842 TGAGATTCCATGTGAATTTTAGG - Intronic
936356918 2:111759986-111760008 TGAGTCTCCAGATGAATGATTGG + Intergenic
936804225 2:116307253-116307275 TGAGAATCCAAATGAATGGAAGG - Intergenic
936936455 2:117843158-117843180 TGAGATTCCATATAAATTTTAGG + Intergenic
937899672 2:127009498-127009520 TGAGATTCCATATGAATTTCAGG + Intergenic
938372098 2:130776445-130776467 TGAGATTCCATATGAATTTTGGG - Intergenic
938844263 2:135192540-135192562 TGAGATTCCATATAAATTTTAGG - Intronic
938977317 2:136492276-136492298 TAAGATTTCATTTGAAAGACAGG + Intergenic
939195869 2:138970882-138970904 TGAAATTCCATATGAATTTGAGG + Intergenic
940344296 2:152613389-152613411 TGAGATTCACAATGAATAACAGG - Intronic
940364487 2:152832799-152832821 TGAAATTCCATATGAATTTTAGG + Intergenic
940551604 2:155165443-155165465 TGAGATTGAATATGAATGGATGG + Intergenic
940630144 2:156228568-156228590 TGAGTTTCCATATGAATCTTAGG - Intergenic
940870358 2:158854808-158854830 TGTGATTCCACCTGGATGACAGG - Intronic
940873066 2:158875902-158875924 TGTGATTCCACCTGGATGACAGG - Intergenic
941104721 2:161340249-161340271 TGAGATGCCATATTGATTACAGG - Intronic
941369714 2:164649337-164649359 TGAGATTCCATATGAATTTTAGG + Intergenic
943778764 2:191797686-191797708 TGAGATTCTATGTGAAGGATAGG + Intergenic
944057627 2:195539935-195539957 TGAGATTACATTTGAATCAGCGG + Intergenic
945289634 2:208114586-208114608 TGAGATTCCAGATGAATTTTAGG - Intergenic
945315331 2:208364659-208364681 TGAGATTCCATATCAATTTTAGG + Intronic
947090265 2:226502339-226502361 TGTGATTCCATATGAATTTTAGG - Intergenic
1169693603 20:8361431-8361453 TCAGATTGCATCTGAATCACTGG + Intronic
1169810010 20:9600338-9600360 TGGGATTCCATATGAATTTTAGG + Intronic
1169833154 20:9847554-9847576 TGAGATTCCATATAAATTTTAGG - Intergenic
1170228300 20:14016846-14016868 TGAGATTCCAAATGAATTTTAGG + Intronic
1170319984 20:15084917-15084939 TGAGTTTCCATATGAATTTTAGG - Intronic
1170425369 20:16229839-16229861 TGAGATTCAACATGAATCACTGG + Intergenic
1171221906 20:23405842-23405864 TGAGATTCCATTTATATGACAGG + Intronic
1171470240 20:25364529-25364551 GAAGATTCCTTATGAATGGCTGG - Intronic
1171507094 20:25646120-25646142 TGAGATTTCATATGAATTTTAGG + Intergenic
1172323695 20:34017953-34017975 TGAGATTCCAAAGGCATGAATGG + Intronic
1172378365 20:34465367-34465389 TGAGATTCCATATGAATTTTAGG + Intronic
1173019434 20:39254772-39254794 TCAGATTCCAGAGGAGTGACAGG + Intergenic
1174341277 20:49897723-49897745 TGAGATCCCATATGAATTTTAGG - Intergenic
1174401118 20:50276513-50276535 TGAGATTCCAAATGAACATCGGG + Intergenic
1176627966 21:9110467-9110489 GGAGATTCCATATGAATTTTAGG - Intergenic
1178265185 21:31136502-31136524 GGAGATTTCATATGAATTAAAGG - Intronic
1178986869 21:37312561-37312583 TGTGATCCCATATGAATTATAGG + Intergenic
1179189444 21:39110312-39110334 TGAGCTTCCATAATAATGCCAGG + Intergenic
1180327533 22:11444121-11444143 GGAGATTCCATATGAATCTTAGG + Intergenic
1180418349 22:12790381-12790403 GGAGATTCCATATGAATTTTAGG - Intergenic
1181394823 22:22613621-22613643 TTAGTTTCCATATGAAAGGCAGG + Intergenic
1182181449 22:28353345-28353367 TGAGATTCCATATGAGTTTTAGG - Intronic
1182761188 22:32723627-32723649 TGAAATTCCACATGAATTAAGGG - Intronic
1183866468 22:40708187-40708209 TGAGAGTCCATATTATTGGCCGG - Intergenic
1184547992 22:45185713-45185735 TAAGATTCCATATGTCTGTCTGG + Exonic
1185251986 22:49807279-49807301 TGAGTTTCCATATGAATTTTAGG - Intronic
949885436 3:8689389-8689411 TGTGATTCCACCTGGATGACAGG - Intronic
950951238 3:17001846-17001868 TGGGGTTCCATATGAATGTTAGG + Intronic
951348739 3:21578823-21578845 TGTGGTTCCATATGAATTTCAGG + Intronic
951862754 3:27272308-27272330 TGAGATGCCATCTGGTTGACTGG - Intronic
952415641 3:33088787-33088809 TGAGATTCCATATGAATTTTAGG - Intronic
952603712 3:35117198-35117220 TGAGATTCCATATGAATTTTTGG + Intergenic
952723199 3:36554963-36554985 TGAGATCCATCATGAATGACAGG - Intergenic
953318578 3:41951343-41951365 TGAGATTCTATATGAATTTTCGG - Intronic
953638500 3:44684134-44684156 TGAGAAACCCTATGAATGCCAGG - Intergenic
953812594 3:46127174-46127196 TGAGAGTCCATATGAATTTTAGG - Intergenic
953833174 3:46320132-46320154 TGATAGTCCATATGAATTTCAGG + Intergenic
954470796 3:50693215-50693237 TGAGATTCCATATGAATTTCAGG + Intronic
954722950 3:52581524-52581546 AGAGGTTCCATATACATGACAGG + Intronic
955045559 3:55356480-55356502 CGAGATTCCATATGAATTTTGGG + Intergenic
955172052 3:56576016-56576038 TGAGATTCCATATGAATTTTAGG + Intronic
956987503 3:74719197-74719219 TGAGATTACAAATTAATAACAGG - Intergenic
957075339 3:75598394-75598416 TGTGATTCCACCTGGATGACCGG + Intergenic
957881796 3:86224755-86224777 TGAGATTCCATATGAATTTTAGG - Intergenic
958010620 3:87874647-87874669 TGAGATTCCATATTAATTTTAGG - Intergenic
958966770 3:100567475-100567497 TGCAATTCCATATGAGTTACAGG + Intronic
959981598 3:112523935-112523957 TGTGATTCCACATGGATGACAGG + Intergenic
960410745 3:117320902-117320924 TGAGATTCCATATAAATTTTAGG - Intergenic
960483403 3:118221439-118221461 TGAGATTCCATATGAATTTTAGG - Intergenic
960672189 3:120164911-120164933 TTAGAGTCCACATGAATGAATGG + Intronic
961251276 3:125508220-125508242 TGAGATTCCATATGACTCTTAGG - Intronic
961286174 3:125805941-125805963 TGTGGTTCCATATGAATTTCAGG + Intergenic
961401464 3:126648374-126648396 TGAAATTCCATATGAATTTTAGG - Intronic
961875630 3:130021299-130021321 TGTGATTCCACCTGGATGACAGG + Intergenic
961900582 3:130207001-130207023 TGTGGTTCCATATGAATTTCAGG - Intergenic
961912656 3:130336411-130336433 TGTGGTTCCATATGAGTGTCTGG - Intergenic
962516719 3:136159099-136159121 TGTGATTCCATATGAATTTTAGG - Intronic
962565495 3:136654632-136654654 TGAGATTCCATATAAATTTTAGG - Intronic
962707152 3:138055063-138055085 TGAGATTCCATATGAATTTTAGG - Intergenic
962774042 3:138641735-138641757 TGTGGTTCCATATGAATTATAGG + Intergenic
962838460 3:139211174-139211196 TGAGATTCTATATGAATTTTAGG + Intronic
963636359 3:147801910-147801932 TGAGATTTCATATGAATTTTAGG + Intergenic
963647626 3:147935777-147935799 TAAAATTCAATATGAATGGCTGG + Intergenic
963840579 3:150101290-150101312 TGAGATTCCATATAAATTTTAGG + Intergenic
964055465 3:152450911-152450933 TGAGATTACATGTGAATGTGTGG - Intronic
964614845 3:158652114-158652136 TGAGATTCCAGCTGAATTAAGGG + Exonic
965876508 3:173329029-173329051 TGAGATTCCATCTGAATTTTAGG + Intergenic
965979477 3:174669728-174669750 TGAGATTACATATGAATTGTAGG + Intronic
966261077 3:177980173-177980195 TGAGATTCAGTAAAAATGACGGG + Intergenic
966707165 3:182929173-182929195 TGATATTCCATATGAATTTTAGG - Intergenic
968022847 3:195409926-195409948 TGAGATTTCATATGAATTTTAGG - Intronic
968604590 4:1527561-1527583 TGAGATTCCATATGAATTTTAGG + Intergenic
968792585 4:2677785-2677807 TGAGATTCTATATGAATTTAGGG + Intronic
969011571 4:4068173-4068195 TGTGGTTCCATATGAATTTCAGG - Intergenic
969023620 4:4156223-4156245 TGTGATTCCACCTGGATGACAGG + Intergenic
969064501 4:4467662-4467684 TGAGATAAAATATGAATAACTGG + Intronic
969730187 4:8950849-8950871 TGTGATTCCACCTGGATGACAGG - Intergenic
969742502 4:9041711-9041733 TGTGGTTCCATATGAATTTCAGG + Intergenic
969786359 4:9460478-9460500 TGTGATTCCACCTGGATGACAGG - Intergenic
969789792 4:9484962-9484984 TGTGATTCCACCTGGATGACAGG - Intergenic
969905566 4:10391544-10391566 TGTGGTTCCATATAAATTACAGG + Intergenic
969913163 4:10463558-10463580 TGAGATTCTACTTCAATGACTGG + Intergenic
971005304 4:22367680-22367702 TGAGATTCCATATGAATTTTAGG - Intronic
971291104 4:25340483-25340505 TGCGTTTCCATATGAATGTTAGG + Intronic
971903019 4:32686906-32686928 TGAGATTCCAGATGAATATTAGG + Intergenic
972955497 4:44385223-44385245 TGAGATTCCATCTGAATTTTAGG - Intronic
973215171 4:47659847-47659869 TGTGATTCCATATGAATTTTAGG - Intronic
973363436 4:49186897-49186919 GGAGATTCCATATGAATTTTAGG + Intergenic
973397658 4:49609961-49609983 GGAGATTCCATATGAATTTTAGG - Intergenic
974263296 4:59553038-59553060 TGAAATCCCATATGGATGAGAGG + Intergenic
974285453 4:59860233-59860255 TGTGGTTCCATATGAATTTCAGG + Intergenic
974322805 4:60373806-60373828 TGAGATTCCATAGGAATTCTAGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
974481368 4:62448047-62448069 TGAGTGTCCATATGAATGAATGG + Intergenic
975665329 4:76729152-76729174 TGAGTTTCCTTATCAATGAAGGG - Intronic
977438104 4:97026648-97026670 TGCCATTCCATATCAATGAGTGG - Intergenic
977550818 4:98441125-98441147 TGAGATTCCATATGAATTTTAGG + Intronic
978212928 4:106159779-106159801 TGAGATTCCATATGAATTTTGGG - Intronic
978359933 4:107920685-107920707 TCAGATTCCATATGAATTTTTGG - Intergenic
979142317 4:117192716-117192738 TGTGATTCCATATAAATTTCAGG + Intergenic
979651247 4:123134572-123134594 TGTGATTCCATATGAATTTTAGG + Intronic
980759180 4:137205987-137206009 TGTGATTCCATGTGAATTTCAGG + Intergenic
981705088 4:147650637-147650659 TGAGATTCCATATAAATTTTAGG - Intronic
982136196 4:152276451-152276473 GGAAATACCATGTGAATGACTGG - Intergenic
982966795 4:161918964-161918986 TGTGTTTCCATATGGATGTCAGG + Intronic
983281027 4:165681006-165681028 TAGGATTCCATCAGAATGACTGG + Intergenic
983886033 4:172981687-172981709 TGAGATTCCATAGGAATTTAAGG + Intronic
983887818 4:173000555-173000577 TGAGATTCCATATAAATTTTAGG - Intronic
984337544 4:178412448-178412470 TGAGATTTCATATGAATATTAGG - Intergenic
984406534 4:179338808-179338830 TAAAATTCTACATGAATGACTGG + Intergenic
984730299 4:183062143-183062165 TGAGATTCTATATGAATTTGAGG + Intergenic
984927411 4:184818900-184818922 TTAGTTTCCATATGAAGGGCGGG + Intronic
985485873 5:148725-148747 TGAGATTCCCTATGAATTTCAGG - Intronic
986090812 5:4502876-4502898 TGGGATTCCATATGAATTGTAGG + Intergenic
986374187 5:7113629-7113651 GGAGAGCCCATATGAAAGACAGG - Intergenic
986487833 5:8258010-8258032 TGAGATTCTATATGGATGACGGG - Intergenic
986878370 5:12138955-12138977 TGAGATGACACAGGAATGACTGG + Intergenic
987106183 5:14641853-14641875 TTAGATTCCATATGAATTTTAGG + Intergenic
991239129 5:64437250-64437272 TGTGATTCCATATGAATTTATGG - Intergenic
991523257 5:67525569-67525591 TGAAATTCCATATGAATTTTAGG - Intergenic
993136968 5:83981140-83981162 TGAATTTCCATATGAATTTCAGG - Intronic
993601830 5:89935447-89935469 TGAGATTGAATATGGATGTCTGG - Intergenic
995489270 5:112673278-112673300 TGAAATTCCATATGAATTCTAGG + Intergenic
995539746 5:113173288-113173310 TGAAATTCCAGATGAATAAAAGG - Intronic
995626359 5:114081292-114081314 TGAGATTCCATATAAATTTTAGG - Intergenic
996038193 5:118781978-118782000 TCAGGTTCCATATGATTGAGGGG + Intergenic
996045446 5:118867926-118867948 TGAGATTTCATATGAATTTTAGG - Intronic
996047816 5:118895512-118895534 TGTGGTTCCATATGAATTGCAGG - Intronic
996364630 5:122688086-122688108 TGTGATTCCATATGAATTTTAGG - Intergenic
997143048 5:131403462-131403484 TGAGATTCCATATGCATTTTAGG - Intergenic
997604012 5:135160513-135160535 TGAGATTATCTAGGAATGACTGG - Intronic
997810872 5:136967481-136967503 TTAGATTCCATATGAATTTTGGG + Intergenic
999118676 5:149188866-149188888 TGAAATTCCATATGAATTTTAGG - Intronic
999313032 5:150564976-150564998 TGAAATTCCATATGAATATTAGG - Intergenic
1001800368 5:174538262-174538284 TGAGATTCCATATGAATTTTGGG - Intergenic
1002678931 5:180944973-180944995 TGTGATTCCATATGAATTTAAGG - Intronic
1004353806 6:14914066-14914088 TGAGATTCCATATAAATTTTAGG - Intergenic
1004657616 6:17679516-17679538 TGAGATTCCATATGAATTTTAGG - Intronic
1005272581 6:24181817-24181839 TGAGATTCCATATGACTTATAGG - Intronic
1005611583 6:27530351-27530373 TGTGATTCCATATGAATTTTAGG + Intergenic
1006828274 6:36952786-36952808 TGAGATTCCATATAAATTTTAGG + Intronic
1006895516 6:37466786-37466808 TGAGATTCCATATAAATTTTAGG + Intronic
1010265488 6:73861311-73861333 TGAGATTCCATATAAATTTTAGG + Intergenic
1010394151 6:75371476-75371498 TGAGATTCCATATGAATTTATGG - Intronic
1010875269 6:81096422-81096444 TAAGATTCCATATGAATTTTGGG + Intergenic
1011804496 6:91056250-91056272 TGTGATTCCATATAAATGTTGGG + Intergenic
1011891703 6:92171098-92171120 TGGGCTTCCATATGCAAGACTGG + Intergenic
1012197725 6:96365178-96365200 TGTGATTCCATATGAATTTTAGG - Intergenic
1012855822 6:104500233-104500255 TAATATCCCATTTGAATGACAGG - Intergenic
1015032371 6:128610623-128610645 TGATATTCCATATGAATTTTAGG + Intergenic
1015220611 6:130801319-130801341 TGAGATTCCATATGAATTATAGG + Intergenic
1015357500 6:132296330-132296352 TGAGGTTCCAGATCAAAGACAGG - Exonic
1015469157 6:133583824-133583846 TGAGATTCCAGAGGAATTTCAGG + Intergenic
1015741399 6:136458427-136458449 TGGGGTTCCATATGAATTATAGG - Intronic
1016317566 6:142807529-142807551 TGATATTTCATATAAATGGCTGG + Intronic
1016421459 6:143888384-143888406 TGAGAGTCCATATGAATTTTAGG + Intronic
1016423084 6:143905056-143905078 TGAGATTCCATGTGAATTTTAGG + Intronic
1016928512 6:149378805-149378827 TGAGCTACCAGATGAATGAATGG - Exonic
1017401172 6:154064979-154065001 TAAGATTCCATATGAATTTCAGG + Intronic
1017537160 6:155360620-155360642 TGTGGTTCCATATGAATGTTAGG - Intergenic
1018622058 6:165739139-165739161 TGTGATTCCATATGAATTTTAGG - Intronic
1018636855 6:165869597-165869619 TGTGATTCCATATGAATTTAAGG - Intronic
1019655050 7:2188339-2188361 TGAGATTCCATATGAATTTTAGG - Intronic
1020310727 7:6866399-6866421 TGTGATTCCACCTGGATGACAGG + Intergenic
1021419628 7:20431217-20431239 TGAGTTGTCATAGGAATGACAGG + Intergenic
1022057562 7:26754940-26754962 TAAAATTCCATATGAATAAATGG + Intronic
1022066285 7:26861402-26861424 TGAGCTGCCATATGCATTACAGG - Intronic
1022387093 7:29911426-29911448 TGAGATTCCATATGAATTTTAGG - Intronic
1022721332 7:32943728-32943750 TTAGATTCCATATGAATTTTAGG - Intergenic
1022758517 7:33321226-33321248 TGTGCTTCCATATAAATCACTGG + Intronic
1023693623 7:42821955-42821977 TGAGGTTCCATATGAATTTTAGG - Intergenic
1024177724 7:46858600-46858622 TGTGATTCCATATGAATTTTAGG - Intergenic
1024296655 7:47848860-47848882 TGTGATTCCATATGAATTTTAGG - Intronic
1024490136 7:49972731-49972753 TGAGATTCCATGTGAATTTTAGG - Intronic
1024493032 7:50008521-50008543 TGAGATTTCATATGAATTTGAGG - Intronic
1025149126 7:56533761-56533783 TGAGATTCCATATGAAATTTAGG - Intergenic
1025242993 7:57293694-57293716 TGAGAGTCCAGATGAAGGATGGG - Intergenic
1026080752 7:67217736-67217758 TGAGAATCCATATGAATTTTAGG + Intronic
1026397939 7:69977427-69977449 TGAGATTACATATGAATTTTAGG + Intronic
1026696335 7:72596293-72596315 TGAGAATCCATATGAATTTTAGG - Intronic
1027191410 7:75998093-75998115 TGAGATTCCATATGAATTTTAGG - Intronic
1029070862 7:97896197-97896219 TGTGGTTCCATATGAATTTCAGG - Intergenic
1029077439 7:97946726-97946748 TGTGATTCCACCTGGATGACAGG + Intergenic
1029291602 7:99505687-99505709 TTACATTCCATATAAATAACGGG - Intronic
1029404112 7:100363678-100363700 TCAGATTCCATTTGAATTTCAGG - Intronic
1030250056 7:107433348-107433370 TGAGATTCCATATGAATTTTAGG - Intronic
1030443456 7:109618955-109618977 TGTGATTCCATATGAATTTTAGG + Intergenic
1030673218 7:112359976-112359998 TGAGAGTCCATATGAATTTTAGG - Intergenic
1031273951 7:119693981-119694003 TGAGATTAGATTTGAATCACTGG - Intergenic
1031797234 7:126190475-126190497 TGTGGTTCCATATGAATGGTAGG - Intergenic
1031933940 7:127716198-127716220 TGAGATTCCATATGAATTTTAGG + Intronic
1032099724 7:128964285-128964307 TGAAATTCCATATGAATTTTAGG - Intronic
1032253368 7:130277361-130277383 TGAGATACCATATGAATCAAGGG + Intronic
1032605810 7:133350677-133350699 TGAGATTCTGTATGAATTTCAGG + Intronic
1033462437 7:141559600-141559622 TGAGATTCCATATGAATTTTGGG + Intronic
1035309761 7:157958900-157958922 TGAGATTCCATATAAATTTTTGG - Intronic
1035545175 8:475429-475451 TGAGATTCCATATGAGTTTCAGG + Intergenic
1035564670 8:633539-633561 TGAGATTCCATGTGAATTTAGGG - Intronic
1036143445 8:6229009-6229031 TCAGATATCATATGAATAACTGG - Intergenic
1036193010 8:6688492-6688514 TAATATTCCATATGACAGACAGG + Intergenic
1036247710 8:7133581-7133603 TGTGGTTCCATATGAATTTCAGG + Intergenic
1036253105 8:7180803-7180825 TGTGGTTCCATATGAATTTCAGG - Intergenic
1036364391 8:8106671-8106693 TGTGGTTCCATATGAATTTCAGG + Intergenic
1036819427 8:11928311-11928333 TGTGATTCCACCTGGATGACAGG + Intergenic
1036886550 8:12559455-12559477 TGTGGTTCCATATGAATTTCAGG - Intergenic
1036894159 8:12618528-12618550 TGTGGTTCCATATGAATTTCAGG - Intergenic
1036989223 8:13572962-13572984 TGGGATTCCATATGAATTTTAGG + Intergenic
1037124003 8:15323129-15323151 TGAGATTCCATATGAATTTTAGG - Intergenic
1037284481 8:17283816-17283838 TGAGATTCCGTATGAATTTTAGG + Intronic
1038378475 8:27068412-27068434 TGTGGTTCCATATGAATTTCAGG - Intergenic
1039313605 8:36347215-36347237 TGAAATTCCATATGAATTTTAGG - Intergenic
1039716238 8:40112640-40112662 TGAGAGTCCAAATGAAAGAGAGG + Intergenic
1040433714 8:47368956-47368978 TGTGATGCCAGATAAATGACTGG + Intronic
1040656058 8:49509414-49509436 TGAGATTCCATGTGAATTTTAGG - Intergenic
1040967387 8:53097808-53097830 TGAGATTCCATATGAATTTTAGG - Intergenic
1041393746 8:57371435-57371457 TGAGATTCCTTATGAAAGGATGG + Intergenic
1041873204 8:62659013-62659035 TGAATTTCCATATGAATGAGCGG - Intronic
1042286668 8:67120353-67120375 GGAGATTCCATATGAATTATGGG + Intronic
1042881047 8:73489918-73489940 TGAGATTCATTATGAAAGAGAGG + Intronic
1043354635 8:79398233-79398255 TGGGATTCTATATAAAGGACTGG + Intergenic
1043913422 8:85891865-85891887 TGTGATTCCATATGAATTTTAGG - Intergenic
1044476968 8:92638392-92638414 TGAGATTCCAAATGAATTGAGGG + Intergenic
1044920099 8:97160632-97160654 TGAGATTTCATGTGAATTTCAGG + Intergenic
1044943883 8:97372321-97372343 TGAGACTCCATATGAATATTAGG - Intergenic
1045072572 8:98524341-98524363 TGAGAATCCATATGAATTTTAGG + Intronic
1045132295 8:99166715-99166737 TGAGAGTCCATATGAATTTTAGG - Intronic
1046705218 8:117441842-117441864 TGAGACTGCATATTAATGAATGG - Intergenic
1047217696 8:122890449-122890471 TGTGATTCCATATGAATTTTAGG + Intronic
1047704146 8:127480763-127480785 TGAGAGGCCACATGAATAACCGG - Intergenic
1047917513 8:129598416-129598438 TGAAATTCCATATGAATTTCTGG + Intergenic
1048382267 8:133876503-133876525 TGAGATTCCATATTAATTTTAGG + Intergenic
1050152994 9:2635764-2635786 TGATGTTCCATTTAAATGACAGG + Intronic
1050398054 9:5220929-5220951 TGAGATTCCATATGAATATTAGG - Intergenic
1051133421 9:13889724-13889746 TGAGATTCCATATGAATTTTAGG - Intergenic
1051500679 9:17773787-17773809 TGAGATTCCATATGAATTTTAGG + Intronic
1052452022 9:28643189-28643211 TGTGATTCCATATAAATTTCAGG - Intronic
1053115296 9:35495659-35495681 TAAGATTCCATATGAATTTTAGG + Intronic
1053170503 9:35877134-35877156 TGAGATTCCATATGAATCTTAGG + Intergenic
1053344312 9:37366781-37366803 TTATCTTCCATTTGAATGACAGG - Intergenic
1056011001 9:82330334-82330356 AGAGATTCAAAATGAATGAAAGG - Intergenic
1056515860 9:87349319-87349341 TGTGTTTCCATATGAATTATAGG - Intergenic
1056866694 9:90233350-90233372 TGTGATTCCACCTGGATGACAGG - Intergenic
1056916463 9:90750967-90750989 TGTGATTCCACCTGGATGACAGG + Intergenic
1057201343 9:93142031-93142053 TGAGATTCCCTAGGCAGGACAGG - Intergenic
1058269838 9:102957792-102957814 TGAGATTCCATATGCATTTTAGG + Intergenic
1059266981 9:113043393-113043415 TGAGAAGCCATATGAATGTAAGG - Exonic
1060082692 9:120666075-120666097 TGTGATTCCATATGAATTTTAGG + Intronic
1061815823 9:133195097-133195119 TGAGATTCCATGTGAATTTTGGG - Intergenic
1062739058 9:138157112-138157134 TGATATTTCGTATAAATGACAGG - Intergenic
1203750810 Un_GL000218v1:78148-78170 GGAGATTCCATATGAATTTTAGG - Intergenic
1185726489 X:2426067-2426089 TGGGTTTGCATATGAAAGACAGG + Intronic
1186123077 X:6383982-6384004 TGAGATTCCACATGCAAGATAGG + Intergenic
1186193080 X:7085084-7085106 TAAGATTCGATGTGATTGACAGG + Intronic
1186977201 X:14920559-14920581 TGAAACTCCATAAAAATGACTGG - Exonic
1187333117 X:18358748-18358770 TGAGATTCCAGACGAGAGACAGG - Intergenic
1187943573 X:24405105-24405127 TGAGCTTCCATATGAATTTTAGG + Intergenic
1188064259 X:25638324-25638346 AGATATTCCATAATAATGACTGG + Intergenic
1188079663 X:25821595-25821617 TGTGGTTCCATATGAATTGCAGG - Intergenic
1188855790 X:35194070-35194092 TGAGTTTCCATATGAATTTGAGG + Intergenic
1188912899 X:35871806-35871828 TGAGATTCCATATGTATGTTAGG + Intergenic
1191029825 X:55957380-55957402 TGAGATTCCACATGAATTTTAGG + Intergenic
1191709055 X:64129082-64129104 TGAGATTCCATATGAATTTTAGG - Intergenic
1191815776 X:65242630-65242652 TGTGATTCCATATAAATTTCAGG - Intergenic
1192242514 X:69344846-69344868 TGAGATTCCATATGAATTTGAGG + Intergenic
1192257412 X:69474069-69474091 TGAGATTCCATATGAAGTTTAGG - Intergenic
1193632193 X:83903687-83903709 TGAGATTCCATATAAATTTTAGG - Intergenic
1193730814 X:85100705-85100727 TGGAATTCCATATGAATGTGAGG - Intronic
1193767814 X:85552565-85552587 TGAGATTCCATACGAATTTTAGG + Intergenic
1193822080 X:86177601-86177623 TAAGATGCCAGGTGAATGACTGG - Intronic
1194609401 X:96022583-96022605 TGAGATTCCATATGAATTTTAGG - Intergenic
1194929736 X:99872064-99872086 TATGATTCCATATAAATTACAGG - Intergenic
1195056827 X:101154233-101154255 TGAAATTCCATATGAATTTTAGG + Intronic
1195253617 X:103072548-103072570 TGAGTTTCCATATGAATTTTAGG - Intergenic
1195304589 X:103568023-103568045 TGAGATTCCATATGAATTTTAGG - Intergenic
1195873397 X:109511785-109511807 TGAGATTCCATATGAATTTTAGG - Intergenic
1196023767 X:111018743-111018765 TGAGATTCCATATAAATTTTAGG - Intronic
1197038954 X:121910990-121911012 TGAAATTCCATATGAATGTGAGG + Intergenic
1197113125 X:122799930-122799952 TGTGATTCCATATAAATATCAGG - Intergenic
1197574147 X:128188345-128188367 TGAAATTCCATATGAATATTAGG + Intergenic
1198315903 X:135465886-135465908 TGTGATTCCATATAAATGTTAGG - Intergenic
1199888864 X:152054277-152054299 TGTAATTCCATATGAATTTCAGG - Intergenic
1200031476 X:153299907-153299929 GCAGATCCCTTATGAATGACTGG + Intergenic
1201121303 Y:10875581-10875603 TGAGATTCCATTGGAATGGAGGG - Intergenic
1201565011 Y:15356521-15356543 TAAGATTCGATGTGACTGACAGG + Intergenic