ID: 1105495734

View in Genome Browser
Species Human (GRCh38)
Location 13:20929247-20929269
Sequence TCTAAATTTTAGTAGGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105495734_1105495737 24 Left 1105495734 13:20929247-20929269 CCATAGACCTACTAAAATTTAGA 0: 1
1: 0
2: 1
3: 17
4: 208
Right 1105495737 13:20929294-20929316 AATTACCCTTTCTGCCTGACTGG 0: 1
1: 0
2: 0
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105495734 Original CRISPR TCTAAATTTTAGTAGGTCTA TGG (reversed) Intergenic
908110078 1:60888213-60888235 TTTGAATTTGAGTGGGTCTAGGG - Intronic
909119430 1:71582538-71582560 TCTAAATTTTAGTACACATATGG + Intronic
909688353 1:78376624-78376646 AGTAAAATTTAGTAGGTCTGTGG + Intronic
911430500 1:97779855-97779877 TCTAACTTTTACTAGCTGTAGGG + Intronic
916185115 1:162124132-162124154 TTTAAATTTCAGTAGCTTTAGGG + Intronic
918591917 1:186249683-186249705 TCTAAATTTCAGAAGATGTATGG - Intergenic
918739551 1:188110660-188110682 TCTAAATTCTAGAAGGTTCAAGG - Intergenic
919127908 1:193418435-193418457 TAGAAATTTTAGTAGGTATAGGG + Intergenic
919167671 1:193916524-193916546 TCTAAAATTTAGTCAGTCTGAGG - Intergenic
919212862 1:194510655-194510677 CCTAGATTTCAGTGGGTCTATGG + Intergenic
919957828 1:202437155-202437177 TCTAAATTTTAGTAGAGACAAGG - Intronic
920612781 1:207457797-207457819 TCTAAATATTAGAGGGTCTTGGG + Intronic
922307717 1:224358371-224358393 TCTGAGTTTTAGTAGGTTTGGGG + Intronic
1063390076 10:5644319-5644341 TTTAAATTTTTGTAGAGCTAGGG - Intronic
1065108843 10:22420075-22420097 TTTTAATTTTAGTGGGTTTAGGG + Intronic
1065318499 10:24487053-24487075 ACTAAATTGTATTTGGTCTACGG + Intronic
1065487150 10:26246566-26246588 TCTAATTTTTAGTAGGCTTCAGG - Intronic
1066146938 10:32569926-32569948 TTTAAATGTTAGTAGTTCTCTGG + Intronic
1068254787 10:54495593-54495615 TCTAACTTTTATTATCTCTATGG - Intronic
1069151806 10:64971197-64971219 TCTAAGTTTGAAGAGGTCTATGG - Intergenic
1069315077 10:67088570-67088592 TCTGAATTTTGGTAGCTTTATGG - Intronic
1071736952 10:88311641-88311663 TCTAAATTGAAGTTTGTCTAGGG - Intronic
1072258110 10:93640388-93640410 TCTAAAGGTTAGAAGGTCTGTGG - Intronic
1073346059 10:102783792-102783814 TCCAAATGTCAGTAGGGCTAAGG + Intronic
1073672529 10:105608051-105608073 TCTAAAGTTTAGTCAGTCTGAGG - Intergenic
1073818287 10:107231923-107231945 TGTAACTTTTAGTAATTCTAAGG + Intergenic
1073935731 10:108629538-108629560 TTTAAATTTCAGTAAGTTTAAGG - Intergenic
1074336424 10:112580971-112580993 TATAAATGCTAGTAGGTCTTGGG - Intronic
1078349940 11:10584308-10584330 TGTAAATTTTAAAAGGTCTGAGG - Intronic
1078623554 11:12932113-12932135 TCTAAATTTTAGAAGGACATGGG - Intronic
1080630785 11:34073594-34073616 TCTAATTTTTAGTAGGGATGGGG + Intronic
1081068707 11:38581642-38581664 TCTAAGTTTGAGTGGTTCTAAGG - Intergenic
1081077677 11:38696513-38696535 CCTAAATTTTAGAAGATGTATGG - Intergenic
1081225330 11:40514374-40514396 TCTATAATTTATTAGCTCTATGG + Intronic
1086002281 11:81997905-81997927 TCTAACATGTAGTAGGGCTATGG + Intergenic
1087468022 11:98534930-98534952 TCTAAACATTAGTAGGAGTATGG - Intergenic
1089768162 11:120783529-120783551 TTTGAAGTTTAGTAGGTTTATGG + Intronic
1090305848 11:125690321-125690343 TCTGATTTTTAGTAGATGTAAGG - Intergenic
1090865913 11:130700338-130700360 ACTAAATTTTTGTATGACTATGG + Intronic
1093323867 12:17748548-17748570 TGTAAATTTTAGTAGGTATATGG + Intergenic
1093977953 12:25443762-25443784 TTTAAATTTCAGTAGCTTTAGGG + Intronic
1094700502 12:32865901-32865923 TATATATTTTAGTTGTTCTATGG - Intronic
1097369215 12:58756057-58756079 GCTAAATTTAAGTTGGTGTAAGG + Intronic
1098724369 12:73944241-73944263 TCAAAATTTTAGTAGGTGAGTGG - Intergenic
1099164170 12:79281650-79281672 TATTTATTTTAGTAGCTCTAGGG - Intronic
1099546928 12:83994934-83994956 TATAAGTTTTTTTAGGTCTATGG - Intergenic
1099655074 12:85479221-85479243 TCTAGATTTTAGAAGATGTATGG - Intergenic
1101009515 12:100435127-100435149 TTTAAATTTTAATAGGTTTTTGG + Intergenic
1101795231 12:107966922-107966944 TCTAAGTTTTAGTAGAAATAAGG + Intergenic
1104456385 12:128916530-128916552 TTTCAATTTTAGTTGTTCTAGGG + Intronic
1105495734 13:20929247-20929269 TCTAAATTTTAGTAGGTCTATGG - Intergenic
1107759204 13:43658691-43658713 TCTAAATTGCAGTAGGTAGAGGG - Intronic
1108141169 13:47423312-47423334 TCTACATTGTACTAGGGCTAGGG + Intergenic
1109418266 13:62073306-62073328 TTTAAATTTCATTAGGTCTATGG + Intergenic
1110487910 13:76068258-76068280 TCTAGATTTTAGAGGGTATATGG + Intergenic
1111200871 13:84934509-84934531 ATTAAATTTTTATAGGTCTAAGG + Intergenic
1111201407 13:84942618-84942640 TCTAAATTATAGCAGGTCCCAGG - Intergenic
1111468734 13:88648619-88648641 TCTAAAATATAGTAGGGCCATGG - Intergenic
1112143350 13:96670991-96671013 TATGAATTTTAGTAGCTTTAGGG + Intronic
1114007281 14:18328689-18328711 TCTAAATGTTAGCAAGTTTATGG - Intergenic
1114564596 14:23620918-23620940 TCAAAATAGAAGTAGGTCTAAGG - Intergenic
1115283636 14:31693202-31693224 TTTAAATATTAGTAGTTGTAAGG + Intronic
1115837012 14:37417645-37417667 TTAAAATCCTAGTAGGTCTATGG + Intronic
1117074304 14:52086655-52086677 TCTAAATTTAAGTAAGCATAGGG - Intergenic
1117773902 14:59162935-59162957 ACTTAATTTGAGTAGGTCCAAGG - Intergenic
1119707688 14:76795337-76795359 ACTAAACTTCAGTTGGTCTATGG + Intronic
1120260475 14:82178267-82178289 TCTATATTTTAGGATGTCTATGG + Intergenic
1120561022 14:85992488-85992510 TCTAAATATTAGGAGCTTTAAGG - Intergenic
1120684376 14:87521234-87521256 TGCATATTTTAGTAGGTCTGGGG - Intergenic
1122471818 14:101973330-101973352 TTTAATTTTTAGTAGGTATAGGG + Intronic
1122495959 14:102155606-102155628 TCTAAATTCTAGTCAGGCTAAGG - Intronic
1122751843 14:103940751-103940773 TCTTAATATTAGGAGTTCTAAGG + Exonic
1123391199 15:19875349-19875371 TCTAAATGTTAGCAAGTTTATGG - Intergenic
1127869415 15:63058533-63058555 TCTATTTTTTAGTAGATTTAGGG - Intronic
1128033736 15:64504651-64504673 TTTTAATTTTAGTAGGGATAGGG + Intronic
1128522574 15:68385587-68385609 ACTAAATTCTAGTTGGGCTAAGG - Intronic
1131853529 15:96567610-96567632 TCTAAATTTTGCTAGGCCTGAGG - Intergenic
1138840225 16:60493196-60493218 ACTAAATTTTAGTACTTTTATGG - Intergenic
1139181606 16:64754913-64754935 TCTAAATTTAAGTGTGTCAATGG - Intergenic
1139208708 16:65054969-65054991 AACAAATTTTAGTAGATCTAAGG - Intronic
1144504014 17:15814384-15814406 TTTAAATTTTAGTAGGTTTTTGG - Intergenic
1144552521 17:16253772-16253794 TTTAATTTTTAGTAGGGATAGGG - Intronic
1144633756 17:16890011-16890033 TAAAAATTTTAGTAGGTTTTTGG - Intergenic
1145167870 17:20629886-20629908 TAAAAATTTTAGTAGGTTTTTGG - Intergenic
1148360884 17:47010972-47010994 GCTAAATTTTATCAGCTCTAGGG + Intronic
1156177472 18:34563749-34563771 TCTAAATTTTGGTGGATTTAAGG - Intronic
1157236789 18:45972025-45972047 ACTAAATTTTAGAATGTGTATGG + Intergenic
1157664088 18:49470692-49470714 TTTAAATTTCAGTAGTTTTAGGG + Intergenic
1163303083 19:16460100-16460122 TTTTAATTTTTGTAGGGCTAGGG - Intronic
1166572102 19:43803577-43803599 TCTAAAGTTTAGTCGATCTGAGG - Intronic
925710339 2:6732917-6732939 TCCAAATTTTAGTAGGTAGATGG - Intergenic
927304876 2:21559580-21559602 TCTAAATTCTTCTTGGTCTATGG + Intergenic
927547916 2:23971066-23971088 TCTAAATGTTAGTAGAGCTGAGG + Intronic
927585027 2:24295182-24295204 GCAGAGTTTTAGTAGGTCTATGG + Intronic
928566108 2:32551628-32551650 TAGAAATTTTACTAAGTCTAAGG - Intronic
929486983 2:42363425-42363447 TCTAACTTTTAGCAGCACTAAGG + Intronic
930707456 2:54518948-54518970 TCTAAATTTTATTATGTGTATGG + Intronic
931596839 2:63956226-63956248 TCTAAATTATAGGAGATTTAAGG + Intronic
933897423 2:86824429-86824451 TCTAATTTTTAGGAGGCCAAAGG + Intronic
934973007 2:98778434-98778456 TCCCAATTTTAGAAGGTCAAGGG + Intergenic
936630163 2:114193557-114193579 TTTGAATTTTTGGAGGTCTACGG + Intergenic
938175142 2:129119051-129119073 TCTAAATTTTAATAGCTTTAAGG + Intergenic
938529292 2:132166712-132166734 TCTAAATGTTAGCAAGTTTATGG + Intronic
939150331 2:138464896-138464918 TATAAATTTCAGTAGGTTTTTGG - Intergenic
941505200 2:166335508-166335530 TCCAAAATTTAGAAGGTCAACGG - Intronic
941628589 2:167858916-167858938 TCTAAAATTTACAAAGTCTAGGG - Intergenic
942658996 2:178244279-178244301 CCTAAGTTATAGTAGTTCTAGGG - Intronic
942803591 2:179903419-179903441 TCTAGATTTTAGAGGGTGTATGG - Intergenic
945103066 2:206281067-206281089 CCAAAATTTTAGTAGAGCTAGGG - Intronic
1169026613 20:2376938-2376960 TCTAAAGTTTAGTAGGTTCCTGG - Intergenic
1173191398 20:40879044-40879066 TTTAAATTTCAGTAGGTTTGGGG - Intergenic
1177427900 21:20949020-20949042 TCAAATTTTTAGTAGATCTCAGG - Intergenic
1180431788 22:15259496-15259518 TCTAAATGTTAGCAAGTTTATGG - Intergenic
1180514347 22:16127424-16127446 TCTAAATGTTAGCAAGTTTATGG - Intergenic
951242682 3:20305386-20305408 TCTGAAATATAGAAGGTCTAAGG - Intergenic
955954137 3:64270921-64270943 TTTTAATTTTAGTGGATCTATGG - Intronic
957387590 3:79517479-79517501 TTTAAATATTAGTAGGTCCTAGG + Intronic
959029819 3:101285791-101285813 TATAAATTTTGGTAGATTTACGG + Intronic
960203307 3:114864663-114864685 TCCAAATTTTAGGAGGTAGATGG + Intronic
963940437 3:151091379-151091401 TCTAAGATTCAGTAGGTCTGAGG + Intronic
964589678 3:158346583-158346605 TCAAAATTCTAGTAGGTATGTGG - Intronic
965089079 3:164140138-164140160 TCAAAATATTAATAGGTCTGTGG + Intergenic
965773659 3:172207274-172207296 TCTAATTTTGAGTAGGTATCAGG - Intronic
965982305 3:174707955-174707977 ACTAAATATTAGTATGTTTATGG - Intronic
966515053 3:180810277-180810299 TCTAAATTTTAGCTGGTAAATGG - Intronic
967046343 3:185740717-185740739 TCTAACCTTTACTAGGTATATGG - Intronic
969900660 4:10346068-10346090 TCTAAAGTTAAGGAGCTCTAAGG + Intergenic
970754771 4:19412593-19412615 TCTAAATTTCAGTACTTTTAAGG + Intergenic
971659691 4:29396709-29396731 TGTAAATTTAAGCAAGTCTAGGG + Intergenic
972002672 4:34058538-34058560 TCTAAATTTCAGAAGTTGTATGG - Intergenic
972217762 4:36916386-36916408 TCTAAAGTTTAGTAAATCTGAGG + Intergenic
973096880 4:46213373-46213395 TATAATTTTTATTAGTTCTAAGG + Intergenic
974787412 4:66637098-66637120 TCTATTTTTTAGTAGGTTTGTGG + Intergenic
977392388 4:96428269-96428291 TCTAAATATTATTAGTTCAAAGG + Intergenic
978136024 4:105261304-105261326 AGTAAATTTTAGTTGCTCTATGG + Intronic
978554622 4:109966057-109966079 TTTAAATTTTTATAGGTTTAGGG + Intronic
978615436 4:110589052-110589074 TCTAATTTTTCTTAGGTATATGG + Intergenic
979172773 4:117622829-117622851 TGTAAATTTTATTTGGTCTCTGG - Intergenic
980498569 4:133617430-133617452 TATAAATTCTAGTAAGTGTAGGG - Intergenic
981199196 4:141959205-141959227 TCTAAATTTTAATTGGCCTTCGG - Intergenic
981274463 4:142882335-142882357 TCTGAAGTTCAGTAAGTCTAGGG + Intergenic
981594134 4:146400027-146400049 TCTAAATGTTAGAGGGTCTCAGG - Intronic
981873356 4:149512683-149512705 TCAATATTTTAGAAGGTCTGGGG - Intergenic
982028421 4:151275691-151275713 TTTAAATTTTTGTAGATATAGGG + Intronic
982403404 4:154994031-154994053 TCTAAATTTTTGGGGGGCTATGG - Intergenic
983469132 4:168135509-168135531 TCTAAATTTTAGTCAAGCTAAGG + Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984020780 4:174482660-174482682 TTTAAATTTTAATAGCTTTAGGG - Intergenic
984320074 4:178184550-178184572 TACAAATTTTAGTAGGTCTGAGG + Intergenic
985165242 4:187087019-187087041 TCTAATTTTTAGGAGCTCCATGG + Intergenic
985365050 4:189221292-189221314 TCTCCATTTTAGAAGTTCTATGG - Intergenic
986603143 5:9494327-9494349 TCAAAAATTGAGTAGGTATATGG + Intronic
987395611 5:17420354-17420376 ACTAAATTTTACTAGATTTATGG + Intergenic
987482972 5:18482432-18482454 TATAAATTTTAGTATATTTAAGG - Intergenic
988346039 5:30039226-30039248 TGTAAATTTTTGTAGGGATAAGG - Intergenic
994775085 5:104029984-104030006 TCTAACATGTAGTAGGCCTATGG - Intergenic
994892587 5:105656831-105656853 TCTAAATTATTGTAGTTTTATGG - Intergenic
996081388 5:119261891-119261913 TCTAAATTTTAGAATCTCTATGG - Intergenic
996907350 5:128616167-128616189 TCTTATTTTAAGTAGGTCAAAGG + Intronic
999350598 5:150867024-150867046 TTTAAATTTCAGTAGGTTTTTGG + Intronic
999406891 5:151314544-151314566 TCTCAATTTTAGTAATTCTGAGG + Intergenic
999549819 5:152674369-152674391 CCTCAATTTTTGTAGGTTTATGG + Intergenic
999952961 5:156669876-156669898 TTTAAATTTAAGTAGGTATTGGG + Intronic
1001212080 5:169819446-169819468 TTTAATTTTTTGTAGGTGTAGGG - Intronic
1004929426 6:20447477-20447499 TCTAAACTTGAGCAGGTCTTGGG + Intronic
1007259359 6:40552328-40552350 ATTCAAATTTAGTAGGTCTAGGG + Intronic
1008064357 6:47031675-47031697 TCCAAGATTTAGTAGGTTTAGGG - Intronic
1008781790 6:55115715-55115737 TGTAGATTTTAGTAGATTTAGGG + Intronic
1009307691 6:62111707-62111729 TCTAATTTTTTGTAGATATAGGG - Intronic
1009313318 6:62185719-62185741 TCAGAATTTTAGTGGGTTTAGGG - Intronic
1009682196 6:66910303-66910325 TCCAACTTTTATTAGGTTTAAGG + Intergenic
1010100776 6:72105104-72105126 TTTAAATTTTTGTAGTTATAGGG + Intronic
1010561915 6:77361486-77361508 TCTACAACTTAGAAGGTCTAAGG - Intergenic
1010879845 6:81153847-81153869 CCTAGATTTTAGTAGGTGTATGG - Intergenic
1012170208 6:96007747-96007769 TCTAATTTTTTATAGGACTAGGG + Intergenic
1012589655 6:100965266-100965288 GCTAATTTTTAATAGGTTTAAGG + Intergenic
1012616104 6:101282057-101282079 TCTAAATGTTAGTATGTCTGGGG - Intergenic
1012762085 6:103315432-103315454 TTTAATTTTTATTAGGTGTAAGG + Intergenic
1014991348 6:128081740-128081762 TATAAACTTTAGTAGATTTAGGG + Intronic
1015505067 6:133976586-133976608 ACTAAATATTAGTAGTTCAAAGG - Intronic
1016707686 6:147131485-147131507 TCTTAATTTTAGTAAGAATATGG - Intergenic
1017237123 6:152128307-152128329 TCTAATTTTAAGAAGTTCTAGGG + Intronic
1020542202 7:9471536-9471558 TTTACATTTTCATAGGTCTAAGG + Intergenic
1020721668 7:11752581-11752603 CATAAATTTTAGTACCTCTAGGG + Intronic
1022984023 7:35632583-35632605 TGTAAATTTTAGTAGTTGTTTGG - Intergenic
1023353497 7:39343813-39343835 TCTCAATGTTAGTAGGCCTCTGG + Intronic
1029953667 7:104614172-104614194 TCTAAAGTTTAGTTGGGCTGAGG + Intronic
1029971104 7:104790276-104790298 TCTTGATTTTAGCAGGTATAAGG - Intronic
1033171415 7:139087854-139087876 TTTAAATTTTAGTAGGGACAGGG - Intronic
1035898486 8:3431684-3431706 TCTTAATTTTAGCAAGACTATGG - Intronic
1037103906 8:15081173-15081195 ACTAAATTTTTTTAGGTCTATGG + Intronic
1038921505 8:32090331-32090353 ACTAAATTTTAATATGTCTTAGG + Intronic
1040655447 8:49502347-49502369 TCTTAATTTTAGTATATTTAAGG - Intergenic
1040716866 8:50265720-50265742 TCTAAATTTTTGTAGATCCTAGG - Intronic
1040809901 8:51440413-51440435 TTTAAATTTCAGTAGGTTTTGGG - Intronic
1041034078 8:53769522-53769544 TCTAAATTTTAGATATTCTATGG - Intronic
1042528585 8:69792105-69792127 ACTAAATTATAGTATTTCTAAGG - Intronic
1043124862 8:76379280-76379302 TCTAATTTTTAGAAGGTATTAGG + Intergenic
1046166340 8:110441413-110441435 TCTAATTTCTAGTATCTCTAGGG + Intergenic
1046378963 8:113428380-113428402 TTTAGATTTTGGTAAGTCTATGG + Intronic
1046448044 8:114348856-114348878 TTTAAATTTCAATAGGTTTATGG + Intergenic
1046777933 8:118183681-118183703 TTTTAATTTTAGTAGCTTTAGGG + Intergenic
1048374523 8:133811287-133811309 TTTAAATTTTCGTAGGTTTTTGG - Intergenic
1049019942 8:139949268-139949290 TCTCAATTTTATTATATCTAAGG - Intronic
1053707885 9:40773031-40773053 TCTAAATGTTAGCAAGTTTATGG + Intergenic
1054417794 9:64893820-64893842 TCTAAATGTTAGCAAGTTTATGG + Intergenic
1056034212 9:82586310-82586332 TTTAACTTTTACTAGGACTAGGG + Intergenic
1056133689 9:83609628-83609650 TTTAAATTTCAGTAGGTTTTTGG - Intergenic
1056476333 9:86954844-86954866 TTCACATTTTAGTCGGTCTATGG - Intergenic
1058472562 9:105295992-105296014 TCAAAATTTTAGTACGTATAAGG + Intronic
1059828439 9:118061668-118061690 TTTAAACTTTAGTTGTTCTAGGG + Intergenic
1060271031 9:122141735-122141757 TCTCAATTTCAGTAGGTAAAAGG - Intergenic
1060887506 9:127165714-127165736 GCTGAAGTTTAATAGGTCTAAGG - Intronic
1186026059 X:5313885-5313907 TCTAAATTTTAATAGCTTTTGGG + Intergenic
1186617671 X:11206391-11206413 TCTAAATCTTGGGAGGTCAAGGG - Intronic
1186675796 X:11816045-11816067 TCTAAATTTTAGAAGATCATGGG - Intergenic
1187629035 X:21147878-21147900 TTTTAATTTTAGTATGTCTAAGG - Intergenic
1191712254 X:64162503-64162525 TTTTACTTTTAATAGGTCTAAGG + Intergenic
1191895824 X:65992181-65992203 TCTAATTTTTAGTATGTATGTGG - Intergenic
1192537930 X:71944410-71944432 TCTAAGATTTGGTAGGTCTAAGG + Intergenic
1193138294 X:77997834-77997856 TTTAAATTTTAATATGTCTGTGG - Intronic
1193349763 X:80448393-80448415 TGTAAATTTTAGCAGTTTTAAGG + Intergenic
1193936893 X:87634266-87634288 TCAAAACTTTAGTCTGTCTATGG + Intronic
1195721473 X:107872911-107872933 TCTAACATGTAGTAGGGCTATGG + Intronic
1199015391 X:142808205-142808227 TCTAAATTTCAGAAGATGTATGG - Intergenic
1199559537 X:149147997-149148019 TTTATATTTTTTTAGGTCTATGG + Intergenic
1201930293 Y:19337546-19337568 TTTAAATTTTAGTAGTTTTGGGG + Intergenic