ID: 1105500888

View in Genome Browser
Species Human (GRCh38)
Location 13:20970764-20970786
Sequence AGTCAGTAGCCTGGGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 4, 3: 93, 4: 571}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105500882_1105500888 -8 Left 1105500882 13:20970749-20970771 CCATGGACTGGTACCAGTCAGTA 0: 1
1: 3
2: 54
3: 183
4: 579
Right 1105500888 13:20970764-20970786 AGTCAGTAGCCTGGGTGTTGGGG 0: 1
1: 0
2: 4
3: 93
4: 571
1105500873_1105500888 30 Left 1105500873 13:20970711-20970733 CCACTCACCTCTTGCTGTGCAGC 0: 17
1: 258
2: 515
3: 808
4: 898
Right 1105500888 13:20970764-20970786 AGTCAGTAGCCTGGGTGTTGGGG 0: 1
1: 0
2: 4
3: 93
4: 571
1105500877_1105500888 8 Left 1105500877 13:20970733-20970755 CCCCATTCCTAACAGGCCATGGA 0: 9
1: 47
2: 445
3: 905
4: 1507
Right 1105500888 13:20970764-20970786 AGTCAGTAGCCTGGGTGTTGGGG 0: 1
1: 0
2: 4
3: 93
4: 571
1105500879_1105500888 6 Left 1105500879 13:20970735-20970757 CCATTCCTAACAGGCCATGGACT 0: 12
1: 23
2: 37
3: 51
4: 165
Right 1105500888 13:20970764-20970786 AGTCAGTAGCCTGGGTGTTGGGG 0: 1
1: 0
2: 4
3: 93
4: 571
1105500874_1105500888 23 Left 1105500874 13:20970718-20970740 CCTCTTGCTGTGCAGCCCCATTC 0: 1
1: 6
2: 50
3: 331
4: 1023
Right 1105500888 13:20970764-20970786 AGTCAGTAGCCTGGGTGTTGGGG 0: 1
1: 0
2: 4
3: 93
4: 571
1105500878_1105500888 7 Left 1105500878 13:20970734-20970756 CCCATTCCTAACAGGCCATGGAC 0: 20
1: 253
2: 512
3: 793
4: 794
Right 1105500888 13:20970764-20970786 AGTCAGTAGCCTGGGTGTTGGGG 0: 1
1: 0
2: 4
3: 93
4: 571
1105500881_1105500888 1 Left 1105500881 13:20970740-20970762 CCTAACAGGCCATGGACTGGTAC 0: 97
1: 334
2: 624
3: 858
4: 1193
Right 1105500888 13:20970764-20970786 AGTCAGTAGCCTGGGTGTTGGGG 0: 1
1: 0
2: 4
3: 93
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105500888 Original CRISPR AGTCAGTAGCCTGGGTGTTG GGG Intergenic
900635681 1:3663952-3663974 AATCAGTACCCTGGGGGTCGTGG + Intronic
901578752 1:10222964-10222986 ACTCTGTAGGCTGGGTGTGGTGG + Intronic
901885990 1:12223394-12223416 ATTCAGTTGGCTGGGTGTGGTGG - Intergenic
902066608 1:13693387-13693409 GGTCTGTGGCCTGGGGGTTGAGG + Intergenic
902380304 1:16049466-16049488 AGGCAGGAGCCTGGTTGTGGGGG + Intronic
902536960 1:17124817-17124839 GGTCCATAGCCTGGGGGTTGGGG + Intergenic
902594335 1:17498047-17498069 AGTCATTAGGCTGGGTGCTGTGG - Intergenic
902609559 1:17589066-17589088 GGTTAGGAGCCTGGATGTTGGGG + Intronic
903893337 1:26585326-26585348 AGTTACTAGGCTGGGTGTGGTGG + Intergenic
904288105 1:29466529-29466551 AGTCAATGGCCTGGGGGTTGGGG + Intergenic
904553643 1:31342731-31342753 AGTCTGTGGCCTGGGGGTTAGGG + Intronic
905123487 1:35700880-35700902 AGTCCGTGGCCCAGGTGTTGGGG - Intergenic
906089853 1:43169714-43169736 GGTCTGTGGCCTGGGAGTTGAGG - Intronic
906647862 1:47488843-47488865 AATCAGTTGGCAGGGTGTTGTGG + Intergenic
907127412 1:52063074-52063096 GGTCAGTGGCCTGGGGGTTGGGG + Intronic
908015924 1:59835939-59835961 AGTCCATGGCCTGGGGGTTGGGG + Intronic
908611727 1:65868656-65868678 GGTCTGCAGCCTGGGGGTTGGGG - Intronic
909592441 1:77365783-77365805 AGTCTGTGGCCTGGGACTTGGGG + Intronic
909660517 1:78076684-78076706 AGTCTGCAGCCTAGGGGTTGGGG + Intronic
910322854 1:85968282-85968304 AGTCCATGGCCTGGGGGTTGGGG + Intronic
910562510 1:88606565-88606587 AGTGAATAGGCTGGGTGTGGTGG - Intergenic
911014811 1:93320873-93320895 GGTCTGTGGCCTGGGGGTTGAGG + Intergenic
911250257 1:95568384-95568406 AGTCAGTGGCCAGGGACTTGGGG + Intergenic
911625989 1:100125015-100125037 AGTAAGTGGCCAGGGGGTTGGGG + Intronic
912063950 1:105712239-105712261 AGTCTGTGGCCTGGGGGTTGGGG - Intergenic
912347669 1:108979860-108979882 AGTCAGTGGCCTGGGGCTTGGGG - Intronic
912557255 1:110525151-110525173 GGTCAGCAGGCTGGGTGTGGGGG + Intergenic
912684569 1:111752155-111752177 AGGCAGAAGCCTGGGTGATTGGG + Intronic
913554630 1:119952742-119952764 GGTCTGTAGCCTGAGGGTTGAGG + Intronic
914350750 1:146837792-146837814 AGTCTGTGGCCTGGGGGTTGGGG - Intergenic
914945082 1:152057967-152057989 AGGCACTATCCTAGGTGTTGAGG - Intergenic
914960715 1:152204090-152204112 AGTCTGTAGCCCAGGGGTTGGGG + Intergenic
915164304 1:153940134-153940156 AGTGAGAAGCCTGGGTGGGGAGG - Exonic
915599478 1:156913459-156913481 AGTCAGCAGGCAGGGTGGTGTGG - Exonic
916960481 1:169883358-169883380 AGTCTGCAGCCTAGGGGTTGGGG + Intronic
917205584 1:172567886-172567908 GGTCTGTGGCCTGGGGGTTGGGG - Intronic
917348131 1:174049945-174049967 AGTCTGTGGCCTGGGGGTTGGGG - Intergenic
917364020 1:174209244-174209266 AGTCTGTGGCCTGGGGGTTGGGG + Intronic
917527773 1:175804268-175804290 AGACAGGAGGCTGGGTGTGGTGG + Intergenic
918483091 1:185000754-185000776 CAGCAGTAGCCTGGGTGCTGTGG - Intergenic
918551545 1:185747981-185748003 AGTGAGAAGCATGGGTGATGGGG + Intronic
919682226 1:200447008-200447030 GGTCAGTGGCCTGGTGGTTGAGG + Intergenic
920085330 1:203411395-203411417 AGTCCACAGCCTGGGGGTTGGGG + Intergenic
920318805 1:205101077-205101099 GGTCTGTGGCCTGGGGGTTGGGG + Intronic
920369974 1:205472771-205472793 AGTCAGGAGGCTGGGGGTGGAGG + Intergenic
920394620 1:205635246-205635268 AGGCAGTAGGCTGGTTGTGGTGG + Intergenic
921151825 1:212408881-212408903 GGTCTGTGGCCTGGGGGTTGGGG - Intronic
921413200 1:214858854-214858876 GGTCTGTGGCCTGGGGGTTGGGG + Intergenic
922126184 1:222726424-222726446 AGCCAGTTGGCTGGGTGTGGTGG + Intronic
922170596 1:223151196-223151218 CTTCAGTTGCCTGGGTCTTGGGG + Intergenic
922328932 1:224556807-224556829 AGTCAGTGGCCTGCGGGTTGGGG + Intronic
922581045 1:226698185-226698207 AGGCAGTAGGCTAGGTGCTGTGG - Intronic
922942136 1:229476634-229476656 GGTAAGTAGGCTGGGTGTGGTGG + Intronic
924059855 1:240161977-240161999 AGTAAATGGGCTGGGTGTTGTGG + Intronic
924233228 1:241979339-241979361 GGTCTGTGGCCTGGGGGTTGGGG + Intergenic
924528253 1:244871071-244871093 AGTGAGCAGGCTGGGTGTGGTGG + Intergenic
1063283994 10:4662868-4662890 AGTCTGTAGCCTGGGGATTGGGG + Intergenic
1063472795 10:6301925-6301947 AGTCACTAACCTGTGTGGTGGGG - Intergenic
1063834988 10:10002373-10002395 AGTCCATGGCCTGGGGGTTGGGG - Intergenic
1064339749 10:14475267-14475289 AGTCTGTGGCCCGGGGGTTGGGG - Intergenic
1064962799 10:20984725-20984747 AGTCCGTGGCCTGGGGGTTGGGG - Intronic
1064988284 10:21232719-21232741 AGTCAGTGGCCTGGGTTTGGGGG + Intergenic
1065284311 10:24172980-24173002 AGTCCATGGCCTGGGGGTTGGGG - Intronic
1065866800 10:29921502-29921524 AGTCCATGGCCTGGGGGTTGGGG - Intergenic
1065960278 10:30728264-30728286 AGTCAAGGGCCTGGGAGTTGGGG + Intergenic
1066215958 10:33287810-33287832 AATCAATAGCATGGGTGCTGTGG + Intronic
1066314068 10:34226260-34226282 ACACAATAGGCTGGGTGTTGTGG + Intronic
1066551700 10:36565464-36565486 AGTAACTAGTCTGGGTGTGGTGG - Intergenic
1067122812 10:43489186-43489208 AGTCACTAGGCTGGGTGCAGTGG + Intergenic
1067224619 10:44367571-44367593 GGTCTGCAGCCTGGGGGTTGGGG - Intergenic
1067244417 10:44525311-44525333 AGGCTGTAGCCTGGGTGCTAGGG + Intergenic
1068922596 10:62500298-62500320 AATCAGAAGACTGTGTGTTGTGG + Intronic
1069179825 10:65344410-65344432 ATCCAGTAGACTGGGTGTGGTGG + Intergenic
1069236658 10:66083846-66083868 AGTGAGTTGGCTGGGTGTGGTGG + Intronic
1069557021 10:69405147-69405169 AGTCAGTTTCCTGGGGGTGGGGG - Intronic
1071545880 10:86528971-86528993 AGTAAGCAGGCTGGGTGTGGTGG - Intergenic
1071982051 10:91013228-91013250 GGTCTGTGGCCTGGGGGTTGGGG + Intergenic
1072321399 10:94253640-94253662 AGTGTGTAGGCTGGGTGTGGTGG - Intronic
1072884213 10:99259690-99259712 AGTCTGTGGCCTGGGAGTTGGGG - Intergenic
1073232312 10:101982517-101982539 CGTCCATGGCCTGGGTGTTGGGG - Intronic
1073746855 10:106479127-106479149 AGTCTGTGGCCTGGGGTTTGGGG - Intergenic
1074343412 10:112656654-112656676 AGTTTGTAGGCTGGGTGTGGTGG - Intronic
1074658085 10:115617643-115617665 AGTTAGTTGGCTGGGTGTGGTGG - Intronic
1074821897 10:117185919-117185941 AGTCCATTGCCTGGGGGTTGGGG - Intergenic
1075870006 10:125764991-125765013 TGTTAGTAGGCTGGGTGTGGTGG - Intergenic
1076053738 10:127354727-127354749 GGTGAGTAGCCTGGATGTGGGGG + Exonic
1076450503 10:130554048-130554070 AGTCTGTGGCCTGGGGGTTAGGG + Intergenic
1077643460 11:3902679-3902701 AGTCTGCAGCCTGAGGGTTGGGG + Intronic
1077901548 11:6494041-6494063 AGTCTGTGGCCCGGGGGTTGGGG - Intronic
1078099590 11:8322051-8322073 GGTCCGCAGCCTGGGGGTTGGGG - Intergenic
1078492847 11:11785481-11785503 GGTCTGTTGCCTGGGGGTTGGGG - Intergenic
1078641271 11:13098976-13098998 TGTCAGAAGCCTGGTTGCTGAGG - Intergenic
1078875513 11:15391186-15391208 AGTCTGTAGGCTGGGCGTGGTGG + Intergenic
1079149830 11:17887850-17887872 AGTCTGCAGCCTAGGGGTTGGGG - Intronic
1079385221 11:19972819-19972841 AGGCACTAGCCTGGGTGTTGGGG - Intronic
1080031196 11:27662832-27662854 AATCCATGGCCTGGGTGTTGCGG + Intronic
1083200175 11:61116303-61116325 AGTCATTACCTGGGGTGTTGGGG - Intronic
1083367106 11:62148033-62148055 AGTCATGAGCCAGTGTGTTGTGG + Intronic
1083465608 11:62843688-62843710 AGTCATCAGCCAGGGAGTTGTGG + Intergenic
1083635596 11:64119195-64119217 AGTAAGTAGACCGTGTGTTGGGG + Intronic
1084511449 11:69607091-69607113 AGACACTAGACTGGGTGTGGTGG - Intergenic
1084875989 11:72133937-72133959 AGTTAGTGGGCTGGGTGTGGTGG - Intronic
1085009616 11:73129283-73129305 GGTCCGTGGCCTGGGGGTTGGGG - Intronic
1085193207 11:74647211-74647233 AGTCCGCAGCCCGGGGGTTGGGG + Intronic
1085760992 11:79241386-79241408 ATCCTGTAGCCTGTGTGTTGGGG + Intronic
1085938286 11:81176942-81176964 GGTCTGTAGCCTGGGGGTTGGGG + Intergenic
1087415689 11:97852590-97852612 AGTCAGCAGGTTGGGTGTGGTGG - Intergenic
1088119406 11:106350584-106350606 AGTCACAAGCCTGAGTTTTGAGG - Intergenic
1088306070 11:108409641-108409663 AGTCCATGGCCTGGGGGTTGGGG - Intronic
1088644611 11:111907788-111907810 AGTCCATGGCCTGGGGGTTGGGG - Intergenic
1088786875 11:113190233-113190255 AGTAACCAGCCTGGGGGTTGGGG + Intronic
1088809912 11:113385263-113385285 AGTCAGCAGCCAGTGTGTGGAGG - Intergenic
1088812434 11:113400697-113400719 AGACAGGAACCTGGGTGATGGGG + Intergenic
1090317227 11:125803676-125803698 AGTCTATAGTCTGGATGTTGGGG + Intergenic
1090325793 11:125885673-125885695 TGTCCGTGGCCTGGGGGTTGGGG - Intronic
1091612792 12:2025368-2025390 GGTGAGTACCCTGGGTGTTGTGG + Intronic
1092078434 12:5692715-5692737 TGTCAGTAGCCTAGGTGGTCTGG + Intronic
1092085872 12:5759428-5759450 AGTCTGTGGTCTGGGGGTTGGGG - Intronic
1092173159 12:6385617-6385639 AGGCAGTAGGCCGGGTGTGGTGG + Intronic
1092616439 12:10219984-10220006 AGTCAGTCACCTCAGTGTTGGGG - Intronic
1092766106 12:11854381-11854403 AGTCAGTGACCTGGAGGTTGGGG + Intronic
1092776285 12:11947453-11947475 AGTCAGAAGGATGGGTGCTGTGG + Intergenic
1092887345 12:12936651-12936673 ATTCCATAGCCTGGGTGTGGTGG + Intergenic
1094045543 12:26161973-26161995 AGTCCGTGGCCCGGGGGTTGGGG + Intronic
1094408993 12:30149530-30149552 AATCAGTAGGCTGGGTGCGGTGG + Intergenic
1094645782 12:32322603-32322625 GGTCAGAGGCCTGGGAGTTGGGG + Intronic
1094720353 12:33056446-33056468 AGGCAGCAGCCTGGGGATTGGGG + Intergenic
1094747610 12:33363858-33363880 AGTCTGTACCCTGGGGGTTGGGG - Intergenic
1096845260 12:54403132-54403154 AGACAGAGGCCTGGGTATTGGGG - Intronic
1097032120 12:56097325-56097347 AGTCTGCAGCCCGGGGGTTGGGG - Intronic
1097097614 12:56562093-56562115 AGTCTGTAGGCTGGGCGTGGTGG - Intronic
1097580906 12:61455061-61455083 GGTCCATAGCCTGGGGGTTGGGG + Intergenic
1098915676 12:76254472-76254494 AGTCCATAGCCTGGGGGTTGGGG + Intergenic
1099306707 12:80966119-80966141 AGTCTGTGGTCTGGGGGTTGGGG - Intronic
1099953378 12:89328494-89328516 AGTGAGTATGGTGGGTGTTGAGG - Intergenic
1099972356 12:89513669-89513691 AGTTCGCAGCCTGGGGGTTGGGG - Intronic
1100466453 12:94849705-94849727 AGGCAGCAGCCTGTGTGCTGTGG - Intergenic
1101370236 12:104122416-104122438 AGTCTGCAGCCTGGGGGTTGGGG - Intronic
1101451981 12:104788192-104788214 AGACAGTAGCCTGGGCAATGAGG + Intergenic
1102415126 12:112755044-112755066 AGGCACTAGGCTAGGTGTTGGGG - Intronic
1102522868 12:113490038-113490060 ATTAAGTAGGCTGGGTGTGGTGG - Intergenic
1102583968 12:113910323-113910345 AGTTTGGAGCCTGGGTGTAGTGG - Intronic
1102931980 12:116869267-116869289 AGTCCATAGGCTGGGTGTGGTGG - Intronic
1103753641 12:123185089-123185111 AGGCACTAGGCTGGGTGTGGTGG - Intronic
1104068370 12:125324498-125324520 AGTCCGTGGCCTAGGGGTTGGGG - Intronic
1104735704 12:131134939-131134961 AGTCACTGGCCTGAGTGATGAGG + Intronic
1105064244 12:133182906-133182928 AGTCTGAAGCGTGGGGGTTGGGG - Intronic
1105437037 13:20388392-20388414 AGTCAGTATGCTGGGTGGGGCGG + Intergenic
1105500888 13:20970764-20970786 AGTCAGTAGCCTGGGTGTTGGGG + Intergenic
1105786734 13:23757399-23757421 AGTCTGTGGCCTGGGGGTTGGGG + Intronic
1106066259 13:26354485-26354507 GGTCTGTGGCCTGGGGGTTGGGG - Intronic
1106204141 13:27573601-27573623 TGTCAGTGGCGTGAGTGTTGAGG + Intronic
1106623582 13:31395496-31395518 AGTCCGTGGCCTGGGGGTTGGGG + Intergenic
1106641442 13:31588247-31588269 AGGTAGTAGTCTGGGTTTTGTGG - Intergenic
1107874511 13:44778225-44778247 AGTCCATGGCCTGGGGGTTGGGG + Intergenic
1108125868 13:47241693-47241715 AGTCCGTGGCCTGGGGGTTGGGG + Intergenic
1108280632 13:48857622-48857644 ATTCAGTCTCCTGGGAGTTGAGG - Intergenic
1108481914 13:50881261-50881283 AGTCAATAGCCTAAGAGTTGCGG - Intergenic
1109078560 13:57868217-57868239 AGTCCATGGCCTGGGGGTTGGGG + Intergenic
1109549358 13:63873012-63873034 AGTCTGCAGCCTGGGGGTTGTGG + Intergenic
1110552478 13:76824904-76824926 AGCCAGTGGCCCGGGAGTTGGGG + Intergenic
1110745132 13:79043488-79043510 AGTCCGTGGCCTGGGGGTTGGGG + Intergenic
1110763042 13:79251699-79251721 TGTCTGCAGCCTGGGGGTTGGGG + Intergenic
1111046365 13:82819320-82819342 AGTCCGTGGCCTGTGTGTTGCGG - Intergenic
1111454621 13:88464943-88464965 AGTCTGTGGCCCGGGGGTTGGGG - Intergenic
1111823064 13:93236430-93236452 AGTCCATGGCCTGGGGGTTGGGG - Intronic
1112420109 13:99240970-99240992 AGACAGTTGGCTGGGTGTGGTGG + Intronic
1112483049 13:99794877-99794899 AGTATTTAGCCTGGGTGTGGTGG - Intronic
1112922216 13:104627973-104627995 AGTCTACAGCCTGGGGGTTGGGG - Intergenic
1113247241 13:108411180-108411202 AGTTCATGGCCTGGGTGTTGGGG + Intergenic
1113360071 13:109622648-109622670 GGTCTGTGGCCTGGGGGTTGGGG - Intergenic
1114057139 14:18980673-18980695 AGTCTGTGGCCTGGGAGTTGAGG + Intronic
1114105406 14:19421073-19421095 AGTCTGTGGCCTGGGAGTTGAGG - Intronic
1114969301 14:28005648-28005670 AAGCTGTGGCCTGGGTGTTGGGG + Intergenic
1115021022 14:28681963-28681985 GGTCTGCAGCCTGGGGGTTGGGG + Intergenic
1117088836 14:52228970-52228992 GGTCCACAGCCTGGGTGTTGGGG + Intergenic
1117534951 14:56694797-56694819 AGACAGAAGCCTGGGAGTGGGGG - Intronic
1119012118 14:71004295-71004317 AGTCCATGGCCTGGGAGTTGGGG - Intronic
1119098312 14:71855060-71855082 AGGCAGAAGGCTGGGTGTAGTGG - Intergenic
1119205176 14:72788655-72788677 AGTCAGGAGCCAGGGAGGTGGGG - Intronic
1119423717 14:74522993-74523015 AGTCAGTGGCCAGGGTCTAGGGG + Intronic
1119734368 14:76972238-76972260 AATCAGTAGCCTTGGTGCGGTGG - Intergenic
1120578869 14:86221214-86221236 AGTCCCTGGCCTGGGGGTTGGGG + Intergenic
1120633567 14:86923340-86923362 AGTCCGTGGCCTGAGGGTTGGGG - Intergenic
1121966040 14:98306681-98306703 AGTCAGCAGCCTGGCTGGAGTGG + Intergenic
1122050800 14:99058432-99058454 GGTGAGAGGCCTGGGTGTTGGGG - Intergenic
1122233920 14:100321545-100321567 AGCCAGTACCTTGGGTGCTGAGG - Intergenic
1122615975 14:103018248-103018270 TGTCCGTGGCCTGGGGGTTGGGG + Intronic
1123498304 15:20853506-20853528 AGTCTGTGACCTGGGAGTTGTGG - Intronic
1123555535 15:21427134-21427156 AGTCTGTGACCTGGGAGTTGTGG - Intronic
1123591779 15:21864465-21864487 AGTCTGTGACCTGGGAGTTGTGG - Intergenic
1125979581 15:43988194-43988216 GGTCTGTGGCCTGGGGGTTGAGG + Intronic
1127094072 15:55495448-55495470 AGGCAGTAGTCTGGGTGCAGTGG + Intronic
1127568239 15:60214494-60214516 GGTCTGTAGCCTGGGGGTTGGGG + Intergenic
1127730794 15:61800359-61800381 AGGCAGAAGCGTGGCTGTTGTGG - Intergenic
1127826522 15:62708726-62708748 TGTCAGTAGCCTGGTCGTAGCGG - Exonic
1127934725 15:63625975-63625997 AGTCTGTTACCTGGTTGTTGGGG + Exonic
1128705816 15:69836849-69836871 AGGCAGGAGCTTGGGTGCTGGGG + Intergenic
1129016251 15:72471914-72471936 ATTAAGTAGGCTGGGTGTAGTGG + Intergenic
1129325659 15:74799020-74799042 AGTGAGGGGCTTGGGTGTTGGGG + Intronic
1129545221 15:76388671-76388693 AGTCAGTCGGCTGGGCGTGGTGG + Intronic
1129801175 15:78415659-78415681 TCTTAGTAGCCTGGGAGTTGTGG + Intergenic
1130629622 15:85553687-85553709 AGTCTGTAGCCTAGGCGGTGGGG - Intronic
1130942877 15:88525540-88525562 AGACACTGGCCTTGGTGTTGTGG + Intronic
1131158935 15:90091819-90091841 AGTCCATGGCCTGGGAGTTGGGG - Intronic
1131325523 15:91439827-91439849 AGTCCATAGCCTGAGGGTTGAGG + Intergenic
1131486887 15:92828359-92828381 AGTCATTAGGCTGGGTGCAGTGG + Intergenic
1132300481 15:100772457-100772479 AGTCAGCAGTGTGGGAGTTGGGG - Intergenic
1132344124 15:101097430-101097452 AGTCTGTGGCCGGGGGGTTGGGG + Intergenic
1202963879 15_KI270727v1_random:154344-154366 AGTCTGTGACCTGGGAGTTGTGG - Intergenic
1132816589 16:1831654-1831676 AGTCAGTGGCCTGGAGGTTGGGG - Intronic
1132845388 16:1998837-1998859 AGGCAGCAGCCTGGGTCTGGGGG + Exonic
1133441328 16:5823493-5823515 AGTCCGTGGCCTGGGGTTTGGGG - Intergenic
1134146656 16:11770072-11770094 AGAAAGTAGGCTGGGTGTGGTGG - Intronic
1134202200 16:12208500-12208522 AGTCACTTGGCTGGGTGTGGTGG + Intronic
1134390025 16:13811020-13811042 AGTCTCTAGGCTGGGTGTGGTGG + Intergenic
1134690228 16:16186358-16186380 AGTCTGTGGCCTGGGGGTTGAGG - Intronic
1135232338 16:20720581-20720603 GGTCTGTGGCCTGGGTGTTGGGG + Intronic
1135675337 16:24410535-24410557 AGTTAATAGGCTGGGTGTGGTGG + Intergenic
1136929900 16:34409598-34409620 AGTCCATGGCCCGGGTGTTGGGG + Intergenic
1136974674 16:35002207-35002229 AGTCCATGGCCCGGGTGTTGGGG - Intergenic
1137422762 16:48350096-48350118 AGTAAGGAGGCTGGGTGTGGTGG + Intronic
1138437516 16:57012431-57012453 GATCTGTAGCCTGGGGGTTGGGG - Intronic
1138922327 16:61546678-61546700 AGACAGTAGGCTGGATGTGGTGG - Intergenic
1139048561 16:63094865-63094887 AGTCAGTACCATGGGTTATGTGG - Intergenic
1139269477 16:65668502-65668524 AGTCAGTTGGCAGGGTGTTGAGG - Intergenic
1139733445 16:68967455-68967477 AGTCTGCAACCTGGGGGTTGGGG + Intronic
1139983285 16:70877752-70877774 AGTCTGTGGCCTGGGGGTTGGGG + Intronic
1140338704 16:74136486-74136508 AGTCAGTGGCCCAGGAGTTGAGG + Intergenic
1140920348 16:79531819-79531841 GGTCTGTGGCCTGGGGGTTGGGG + Intergenic
1141077361 16:81019503-81019525 TGTAATTAGGCTGGGTGTTGTGG - Intronic
1141194991 16:81853668-81853690 AGTCCATGGCCTGGGGGTTGGGG + Intronic
1142190088 16:88713450-88713472 AGGCAGGGGCCTGGGTGTTCAGG + Intronic
1143316588 17:6037665-6037687 AGTCTGTGGCCTCGGGGTTGGGG - Intronic
1144575719 17:16428196-16428218 AGTCAGCAGCTTTGGTTTTGGGG - Intronic
1146376510 17:32298309-32298331 AGTCAGGAGCCTTGGAGATGAGG - Intronic
1146453000 17:32989643-32989665 AGTCAGGTGGCTGGGTGTGGTGG + Intronic
1146471046 17:33125132-33125154 AGTCTGTGGCCTGGGGGTTGGGG + Intronic
1146496938 17:33330972-33330994 AGTCTGTAGCCCAGGGGTTGGGG - Intronic
1146625451 17:34431774-34431796 GGTCAGAAGCCTGGGTGCAGAGG - Intergenic
1146791283 17:35752116-35752138 AGGCAGAAGGCTGGGTGTGGTGG - Intronic
1147173522 17:38636148-38636170 AGTCTGTGGCCCGGGGGTTGGGG - Intergenic
1147319751 17:39638852-39638874 AGTGAGTTGCCTGGGTGCAGTGG + Intronic
1147911432 17:43858431-43858453 AGGCAGTAGCATGGGAGCTGTGG - Intronic
1148014008 17:44508008-44508030 AGTCATTAGTCTTGGTGCTGGGG - Intergenic
1148332563 17:46821051-46821073 AGCCAGCATCCTGGGTGCTGTGG + Intronic
1149296514 17:55266036-55266058 ACTGCGTAGCCTGGGTTTTGGGG + Intronic
1149314670 17:55427865-55427887 AGTCCACAGCCTGGGGGTTGGGG - Intergenic
1149391765 17:56198541-56198563 AGTCTGCAGCCTGGGGGTTGGGG + Intronic
1149710923 17:58741445-58741467 AGTCCGTGCCCTGGGGGTTGGGG - Intergenic
1150031960 17:61748064-61748086 ATTCTGTGGCCTGGGGGTTGGGG - Intronic
1150181382 17:63124660-63124682 AGTCTGCAGCCTGAGCGTTGGGG - Intronic
1150882259 17:69043387-69043409 AGTCTGTGGCCTGGGGCTTGGGG + Intronic
1151973446 17:77470999-77471021 GCTCAGGAGCCTGGGAGTTGAGG - Intronic
1152591596 17:81216070-81216092 AATTAGTAGGCTGGGTGTGGTGG + Intronic
1152773989 17:82188457-82188479 GGTCTGGGGCCTGGGTGTTGGGG - Intronic
1153342379 18:3988762-3988784 AGTCTGTGGCCTGGGGGCTGGGG + Intronic
1153370883 18:4314647-4314669 AGGCACTGGCCTAGGTGTTGGGG - Intronic
1153395664 18:4617707-4617729 AGTCTGTGGCCTGGGGGTTGGGG - Intergenic
1153533863 18:6079142-6079164 GGTCTGTAGCCTAGGTGTTGGGG + Intronic
1154404682 18:14078245-14078267 GGTCTGCAGCCTGGGGGTTGAGG + Intronic
1155736051 18:29224044-29224066 AGTCTGTGGCCTGAGGGTTGGGG - Intergenic
1155914170 18:31539728-31539750 GGTCTGTAGCCTGGGGGTTGGGG - Intronic
1155965215 18:32029337-32029359 AGTCTGGAGGCTGGGTGTGGTGG + Intronic
1156053057 18:32961832-32961854 TGTCTGCAGCCTGGGGGTTGAGG + Intronic
1156257409 18:35410976-35410998 TGTCAGTAGCTGAGGTGTTGAGG + Intergenic
1156315043 18:35961972-35961994 GGTCAGTGGCCTGGGGATTGGGG - Intergenic
1156432874 18:37094282-37094304 GGTCTGCAGCCTGGGGGTTGGGG + Intronic
1157079264 18:44504951-44504973 AGACTGTAGGCTGGGTGTGGTGG - Intergenic
1157249573 18:46082761-46082783 AATCAGTAGGCTGGGCGTGGTGG + Exonic
1157375680 18:47162147-47162169 GGTCTGTGGCCTGGGGGTTGGGG - Intronic
1158133850 18:54184179-54184201 CGTCTGTGGCCTGGGGGTTGGGG - Intronic
1158326729 18:56320974-56320996 AGTCAGAGGCCTGAGTGTTATGG - Intergenic
1159706585 18:71696900-71696922 AGTCTGTTGCCTGGGTGTGGTGG + Intergenic
1160528124 18:79549008-79549030 AGTCAGTGGCATGGGTGTCAGGG + Intergenic
1161515168 19:4692456-4692478 GGGCAGGAGCCTGGGTCTTGGGG - Intronic
1162059141 19:8084241-8084263 AGCCAGCGGCCTGTGTGTTGTGG - Intronic
1162271024 19:9615617-9615639 AGTAAGTAGGCTGGGTGCAGTGG + Intronic
1162294853 19:9806318-9806340 ACTCAGTAGGCTGGGTGTGGTGG + Intergenic
1162535158 19:11259034-11259056 AGAAAGTAGCCTGGGTATGGTGG - Intronic
1162723912 19:12678480-12678502 AGTAAGTAGGCTGGGTGTGGTGG + Intronic
1162924834 19:13925239-13925261 AGTCAGTACCCTAGCTGCTGGGG - Intronic
1163725589 19:18921557-18921579 AGTCAGGAGCCTGGGGGCTCAGG + Intronic
1163789745 19:19299667-19299689 AGTCAGTAGGCCGGGTGCGGTGG - Intronic
1164090302 19:21945854-21945876 AGGCACTAACCTGGGGGTTGGGG - Intronic
1164250840 19:23473533-23473555 AGTCTGTGCCCTGGGTGTTGAGG - Intergenic
1164323735 19:24174192-24174214 TGTCTGTGCCCTGGGTGTTGGGG + Intergenic
1164955987 19:32385525-32385547 AATCAGTAGCCTGGGCATAGTGG + Exonic
1165285974 19:34841926-34841948 GGTCTGTGGCCTGGGTGTTGGGG - Intergenic
1165479153 19:36051773-36051795 CGTCTGTAGCCTGGGAGTTGGGG - Intronic
1165524739 19:36344565-36344587 GGTCTGTGGCCTGGGGGTTGGGG - Intronic
1165621666 19:37253268-37253290 AGTCAGTGGGCTGGGCGCTGTGG + Intergenic
1166018369 19:40001254-40001276 AGTCAGTGACCTGGGGGTTGGGG + Intronic
1166577646 19:43857544-43857566 AGTCTGTGGCCCGGGGGTTGGGG - Intergenic
1166593131 19:44019058-44019080 AGTAAGTAGGCTGGGGGTGGGGG - Intergenic
1166936810 19:46338902-46338924 AGTTAAAAGCCTGGGTGGTGAGG - Intronic
1167223217 19:48217244-48217266 AGTCCCTAGCCCGGGGGTTGGGG + Intronic
1168392804 19:56024837-56024859 AGTCCATGGCCTGGGGGTTGGGG - Intronic
1168568714 19:57446105-57446127 AGTTTGCAGCCTGGGGGTTGTGG - Intronic
1168622945 19:57893487-57893509 AGTCAGTTGGCTGGGTGTGGTGG + Intronic
925500685 2:4501069-4501091 AGGCAGAAGACTGGGTTTTGTGG - Intergenic
926131707 2:10307074-10307096 AGCCAGGAGCCTGGGGGTGGAGG + Intronic
926179615 2:10630074-10630096 AGTCATTAAGCTGGGTGTGGTGG - Intronic
926341496 2:11908417-11908439 AGTGAGTAGGCTGGGTGCAGTGG + Intergenic
926562195 2:14430124-14430146 AGTCCATGGCCTGGGGGTTGGGG - Intergenic
928075421 2:28260181-28260203 ATTCAGAAGGCTGGGTGTGGTGG - Intronic
928187430 2:29125169-29125191 AGTCCGTAGCCAGGGGGTTCAGG - Intronic
928202052 2:29253738-29253760 AGCAAGCAGCCTGGGTGTGGGGG + Intronic
928208613 2:29306083-29306105 GGTCGGTGGCCTGGGGGTTGGGG + Intronic
928252372 2:29692719-29692741 AGTCTTCAGCCTGGGTGTTAGGG + Intronic
928400508 2:30974826-30974848 AGTCATCATCCTGGGTATTGAGG - Intronic
928930480 2:36619066-36619088 AGTCCGTGGTCTGGGGGTTGGGG - Intronic
928994368 2:37271510-37271532 AGTCTGTGGCCTGGGGCTTGGGG - Intronic
929184609 2:39080441-39080463 AGTCTGTAGCCTGGGGGTTGGGG + Intronic
929762719 2:44819377-44819399 GGTCCGTGGCCTGGGAGTTGGGG + Intergenic
930600974 2:53442914-53442936 AGTCTGTGGCCTGGCGGTTGGGG - Intergenic
932412898 2:71557756-71557778 AGAAAGTAGGCTGGGTGTGGAGG + Intronic
935696788 2:105777231-105777253 AGCCACGAGCCGGGGTGTTGCGG + Intronic
935725662 2:106021792-106021814 AGTCTGTAGCCTGGGGGTTGGGG - Intergenic
936440144 2:112544141-112544163 AGCCAGTCGGCTGGGTGTGGTGG + Intronic
936631740 2:114210705-114210727 AGTCTGCAGCCTAGGGGTTGGGG + Intergenic
936880748 2:117247666-117247688 AGTCAGAAGCTCTGGTGTTGGGG - Intergenic
937362535 2:121239022-121239044 AGTCACTCTCCTGAGTGTTGTGG - Intronic
937470526 2:122170339-122170361 AGCCAGTGCCCTGTGTGTTGGGG + Intergenic
938269402 2:129955900-129955922 TGTCAGTAGCCTCGGGGTTCTGG - Intergenic
938284026 2:130092887-130092909 AGTCTGTGGCCGGGGAGTTGTGG - Intronic
938285167 2:130107459-130107481 AGTCTGTGGCCTGGGAGTTGAGG - Intronic
938316661 2:130334158-130334180 AGTCCTTGGCCTGGGGGTTGGGG - Intergenic
938327588 2:130422244-130422266 AGTCAATAGGCTGGGTGCGGCGG + Intergenic
938334669 2:130481452-130481474 AGTCTGTGGCCTGGGAGTTGTGG - Intronic
938335817 2:130496003-130496025 AGTGTGTGGCCTGGGAGTTGAGG - Intronic
938354007 2:130624661-130624683 AGTGTGTGGCCTGGGAGTTGAGG + Intronic
938355152 2:130639218-130639240 AGTCTGTGGCCTGGGAGTTGTGG + Intronic
938362359 2:130699234-130699256 AGTCAATAGGCTGGGTGCGGCGG - Intergenic
938430433 2:131231434-131231456 AGTCTGTGGCCTGGGAGTTGAGG + Intronic
938431581 2:131246006-131246028 AGTCTGTGGCCGGGGAGTTGTGG + Intronic
938438749 2:131305874-131305896 AGTCAATAGGCTGGGCGTGGTGG - Intronic
938475257 2:131604617-131604639 AGTCTGTGGCCTGGGAGTTGAGG + Intergenic
938608902 2:132925711-132925733 GGTCTGTGGCCTGGGGGTTGGGG + Intronic
938776026 2:134542462-134542484 AGTCTGTGGCCTGGGGATTGCGG - Intronic
940293776 2:152101656-152101678 AGTCTGTGGCCTGGGGGTTGGGG - Intergenic
940641535 2:156349708-156349730 GGTCTGTGGCCTGGGGGTTGGGG - Intergenic
940948882 2:159649444-159649466 AGGCAGTAGTATGAGTGTTGGGG + Intergenic
941277838 2:163513348-163513370 AGGCATTAGCCTAGGTGCTGGGG - Intergenic
942188532 2:173447806-173447828 AATCATTGGTCTGGGTGTTGTGG + Intergenic
943058939 2:183017642-183017664 TGTCTGTGGCCTGGGGGTTGGGG + Intronic
943230365 2:185243040-185243062 TGTCAGTAGCCAGGGGGTGGCGG + Intergenic
943576192 2:189633637-189633659 GGTCCGTGGCCTGGGAGTTGGGG - Intergenic
944106611 2:196085443-196085465 ACTCAGCCGCCTGGGTGTGGTGG - Intergenic
944237964 2:197457231-197457253 AGTCCATGGCCTGGGCGTTGGGG + Intronic
944260400 2:197669773-197669795 AGTCTGCAGCCTGGGGGCTGGGG + Intronic
944901281 2:204219265-204219287 AGTCCATGGCCTGGGGGTTGGGG - Intergenic
945149806 2:206778679-206778701 AGTCCGTGGCCTGGGGGCTGGGG - Intronic
945393288 2:209291047-209291069 GGTCCGTGGCCTGGGTGTTAAGG + Intergenic
946934041 2:224701054-224701076 AGTCAGTGGCCTAGAGGTTGGGG - Intergenic
947854610 2:233314630-233314652 CCTCACTAGCCTGGGTGGTGTGG - Intronic
948082182 2:235215409-235215431 GGTCTGTGGCCTGGGGGTTGAGG + Intergenic
948303939 2:236932691-236932713 AGAGAGTAGCCTGGGGGTGGGGG + Intergenic
948327973 2:237141686-237141708 AGTCAGTGGCCTTGGCCTTGGGG - Intergenic
1169091706 20:2864905-2864927 AGACTGTAGCCTGGGTGAGGAGG + Intronic
1170138998 20:13106533-13106555 AATCAGGAGGCTGTGTGTTGGGG + Intronic
1170914153 20:20606217-20606239 AGTCTGTTGCCTGGGGGATGAGG - Intronic
1171019768 20:21574651-21574673 GGTAAGGGGCCTGGGTGTTGTGG + Intergenic
1171050272 20:21851529-21851551 GGTCTGTGGCCTGGGGGTTGGGG + Intergenic
1172678507 20:36693494-36693516 AGTCTGTGGCCCAGGTGTTGGGG - Intronic
1172688666 20:36775579-36775601 TGTCATTAGGCTGGGTGTGGTGG + Intergenic
1172757135 20:37293578-37293600 GGTCTGTGGCCTGGGGGTTGGGG + Intronic
1174445127 20:50585815-50585837 GGTCTGTGGCCTGGGGGTTGAGG + Intergenic
1174986655 20:55461594-55461616 AGTCCATGGCCTGGGGGTTGGGG - Intergenic
1175077107 20:56385016-56385038 AGTGAGTGTCCTGGGGGTTGAGG - Intronic
1176206600 20:63891978-63892000 AAACAGTAGGCTGGGTGTGGTGG + Intergenic
1176817856 21:13623404-13623426 AGTCTGTGACCTGGGAGTTGTGG + Intronic
1177896980 21:26865025-26865047 AATAAGTAGGCTGGGTGTAGTGG - Intergenic
1178458327 21:32776828-32776850 AGTCTGTGGCCTGGAGGTTGGGG - Intergenic
1178535526 21:33407125-33407147 AGTTAGTTACCTGAGTGTTGAGG + Intronic
1178844740 21:36165511-36165533 GGTCAGCGGCCTGGGGGTTGGGG - Intronic
1178886233 21:36486926-36486948 AGTCATTAGCCAGTGTGATGAGG + Intronic
1179300208 21:40101583-40101605 AGTCCGTAGCCCGGGGGTTGGGG + Intronic
1179800526 21:43809690-43809712 AGGCAGCGCCCTGGGTGTTGTGG + Intergenic
1180475628 22:15703285-15703307 AGTCTGTGGCCTGGGAGTTGAGG + Intronic
1181020171 22:20096122-20096144 AGTCCATGGCCTGGGGGTTGGGG + Intronic
1181035198 22:20166635-20166657 AGTCAGTAGCCTAAGGGTGGAGG - Intergenic
1181508605 22:23378711-23378733 AGTCAGTAGCCTGAGGGTGGAGG + Intergenic
1181624099 22:24111288-24111310 AGTCTGTGACCTGGGGGTTGGGG - Intronic
1182525882 22:30918872-30918894 AGTCCGTGGCCTGAGGGTTGGGG - Intergenic
1185221331 22:49630461-49630483 AGAAAGAAGCCTGGGTGTTGGGG + Intronic
949333824 3:2951510-2951532 TGTCTGCAGCCTGGGGGTTGGGG + Intronic
949592157 3:5505771-5505793 AGACAGTAGCATGGGTGCTGGGG + Intergenic
951095533 3:18625287-18625309 ACTCAGCAGCCTGGGTGTCAAGG + Intergenic
951149089 3:19266089-19266111 AGACAGTAGCATGTGTTTTGTGG - Intronic
952406049 3:33006172-33006194 AGTCTGTGGCCTGGGGTTTGGGG - Intronic
953300303 3:41767922-41767944 GGTCTGTGGCCTGGGGGTTGGGG - Intronic
953391927 3:42538978-42539000 GGTCAGTAGACTGGGTGCCGTGG - Intergenic
953748434 3:45592691-45592713 GGTCAGTAGCCCAGGGGTTGGGG + Intronic
953880827 3:46690527-46690549 AGCCTGTAGCCTGGCTGTGGGGG - Intronic
955101370 3:55853237-55853259 ACTCAGGAGGCTGGGTGTGGTGG + Intronic
955199908 3:56842148-56842170 TGTGATTAGCCTGGGCGTTGGGG - Intronic
955623893 3:60895933-60895955 AGTCTGCAGCCTGGAGGTTGGGG - Intronic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
955904122 3:63789025-63789047 GGTCTGTGGCCTGGGGGTTGGGG - Intergenic
955969265 3:64420658-64420680 AGGCAGAAGGCTGGGTGTTAAGG - Intronic
956438703 3:69259406-69259428 AGCCTGTGGCCTGGGGGTTGGGG + Intronic
957377096 3:79372163-79372185 AGTCCACAGCCAGGGTGTTGGGG + Intronic
958056459 3:88418788-88418810 AGACAGTGGCCTAGGTGTTGGGG - Intergenic
958411536 3:93822512-93822534 TGTCTGTGGCCTGGGGGTTGGGG + Intergenic
959106583 3:102071583-102071605 GGTCTGTGGCCTGGGGGTTGGGG + Intergenic
960828627 3:121819502-121819524 AGTCTGTGGCCTGGGGGCTGGGG + Intronic
960908999 3:122630019-122630041 AGTCTGTGGCCTGGGATTTGGGG + Intronic
961232681 3:125332204-125332226 AGTCAGTAGCTTTGTTATTGAGG + Intronic
962565555 3:136655474-136655496 AGAAAGTAGGCTGGGTGCTGTGG + Intronic
963356638 3:144216113-144216135 AGTCTGTGGCCTGAGGGTTGGGG + Intergenic
963736703 3:149025460-149025482 GGTCCGTGGCCTGGGGGTTGGGG + Intronic
965431069 3:168589510-168589532 AGGCAGTAGCCTGGAGGTGGCGG + Intergenic
966533600 3:181007335-181007357 AGTCTGTGACCTGGGAGTTGGGG - Intergenic
966813041 3:183865401-183865423 GGTCAGCAGCCGGGTTGTTGGGG - Intronic
967002085 3:185345391-185345413 AGTCAGTGGCCAGGGGGTTGGGG - Intronic
967363916 3:188663991-188664013 AGTCCATAGCCTGGGGATTGGGG + Intronic
967429347 3:189363710-189363732 AGTCAGAAGCCTCGGTCATGGGG + Intergenic
967518453 3:190399757-190399779 GGTCTGTGGCCTGGGGGTTGTGG - Intronic
968315870 3:197724890-197724912 GATCAGTAGACTGGGTGTGGTGG + Intronic
968855728 4:3120423-3120445 ACTCTGCAGCCTGGGGGTTGGGG - Intronic
969432077 4:7161251-7161273 TGTCACTGGCCTGGGTGGTGGGG + Intergenic
969579565 4:8056586-8056608 TGTCTGTAGCCTGGGTGTGGTGG - Intronic
969925975 4:10586190-10586212 GGTTCGTGGCCTGGGTGTTGGGG + Intronic
970235628 4:13955621-13955643 AGTCTGTGGACTGGGGGTTGGGG - Intergenic
970900444 4:21152650-21152672 AGTCTGTGGCCTGGGGATTGGGG - Intronic
971707526 4:30065199-30065221 ATGCAGTAGGCTGGGTGTGGTGG - Intergenic
972510671 4:39765818-39765840 AGTAAGTAGGCTGGGCGTGGTGG + Intronic
973017793 4:45163344-45163366 AGTCTGTGGCCCGGGGGTTGGGG + Intergenic
973941108 4:55911408-55911430 TGTCAGTAGGCTGGGTGCTGTGG - Intergenic
973980286 4:56303055-56303077 AGTCTGGAGGCTGGGTGTGGTGG + Intronic
974137255 4:57834167-57834189 AGTGAGTTGCCTGGGTTTTGAGG + Intergenic
974323326 4:60380920-60380942 AGTCAGTGTCCAGGGTGTTGAGG - Intergenic
975343851 4:73271791-73271813 GATCTGCAGCCTGGGTGTTGGGG + Intergenic
975347864 4:73314430-73314452 AGACAGTAGTCTGGGTGCAGTGG + Intergenic
975646900 4:76554749-76554771 GGTCCGTGGCCTGGGGGTTGGGG - Intronic
976214065 4:82699063-82699085 AGTCCGTGGCCCGGGGGTTGCGG - Intronic
976399016 4:84586662-84586684 GGTCTGTGGCCTGGGGGTTGGGG + Intronic
976787269 4:88835896-88835918 AGTCCATGGCCTGGGGGTTGGGG + Intronic
976811053 4:89101770-89101792 GGTCTGTAGCCTGGGTGTTGGGG - Intronic
976953702 4:90867021-90867043 GGTCAGTGGCCTGGGGATTGAGG + Intronic
977599322 4:98919019-98919041 AGTAAAAAGCCTGGGTGTGGTGG + Intronic
977775407 4:100913851-100913873 TGTCTGTGGCCTGGGGGTTGGGG - Intergenic
977876720 4:102158291-102158313 GGTCAGCAGCCAGGGTGTTGGGG + Intergenic
978213641 4:106170070-106170092 AGTCTGTGGCCTGGGGGTTGGGG + Intronic
978360073 4:107921984-107922006 AGTCTGCAGCCTGGGGGATGGGG + Intergenic
979458872 4:120957289-120957311 AGTTAGTATACTGGGTGATGAGG - Intergenic
979566300 4:122157651-122157673 AGTCTGCGGCCTGGGGGTTGGGG + Intronic
979813257 4:125065613-125065635 AGTCCATTGCCTGGGGGTTGGGG + Intergenic
980017125 4:127662645-127662667 GGTCTGTGGCCTGGGGGTTGGGG - Intronic
980220168 4:129903237-129903259 TCTCAGTAGCCTGTTTGTTGTGG - Intergenic
980910821 4:138992853-138992875 GGTCTGCAGCCTGGGGGTTGGGG - Intergenic
981691050 4:147509486-147509508 AGTCTGCAGCCTGGGGGTTGAGG - Intronic
981728097 4:147868914-147868936 TGTCGGCAGCCTGGGGGTTGGGG + Intronic
981868850 4:149461957-149461979 GGTCTGTGGCCTGGGGGTTGGGG + Intergenic
981985012 4:150843136-150843158 GGTCAGTGGTCTGGGGGTTGGGG + Intronic
982079856 4:151778722-151778744 AGTCTGCGGCCTGGGGGTTGGGG - Intergenic
982359834 4:154507516-154507538 AGGAAGAAGGCTGGGTGTTGTGG - Intergenic
982614868 4:157627957-157627979 AGTTTGTAGGCTGGGTGTGGTGG - Intergenic
983042651 4:162948358-162948380 AGTCTATAGGCTGGGTGTGGTGG + Intergenic
983836486 4:172392853-172392875 AGTCCGCAGCCTGGGAGTTGTGG - Intronic
985636856 5:1039970-1039992 AGTCCACAGCCTGGGGGTTGTGG - Intergenic
986580733 5:9263246-9263268 AGTCCGTGGCTTGGGTGTTGGGG - Intronic
986597970 5:9443085-9443107 TGTCCGTAGCCTGGGTGTCCAGG + Intronic
986740806 5:10703757-10703779 ACACAGCAGCCTGGGTGTGGGGG + Intronic
987641502 5:20617390-20617412 TGGCAGTAGACTGGGTTTTGGGG - Intergenic
988095597 5:26605510-26605532 AGTCTATAGCCTGGGGGTTGGGG - Intergenic
988419440 5:30987566-30987588 AGCCAGGCGGCTGGGTGTTGTGG - Intergenic
988542351 5:32122073-32122095 GGTCCGTGGCCTGGGGGTTGGGG - Intergenic
989743408 5:44798789-44798811 AGTCTGTGGCCTGGGGTTTGAGG - Intergenic
990322185 5:54640770-54640792 AATCAGGAGGCTGGGTGTGGTGG + Intergenic
990442563 5:55861294-55861316 GGTCTGCAGCCTGGGGGTTGGGG - Intronic
990589136 5:57243974-57243996 AGGAAGTAGGCTGGGTGTGGTGG - Intronic
990890685 5:60646648-60646670 AGTCTGTGGCCTGTGGGTTGAGG - Intronic
990972185 5:61520091-61520113 AGTCTGCAGCCTGGGGGTTGGGG + Intronic
991084748 5:62638532-62638554 AATCAGCAACCTGGGTGCTGTGG + Intergenic
991286488 5:64982796-64982818 AGTCTGCAGTCTGGGGGTTGGGG - Intronic
991444656 5:66686083-66686105 GGTCTGTGGCCTGGGTGTCGCGG + Intronic
991701997 5:69325035-69325057 ACTCATTAGGCTGGGTGTGGTGG + Intronic
991719458 5:69481772-69481794 GGTCCGTGGCCTGGGAGTTGGGG + Intergenic
992062589 5:73069694-73069716 AGACTGTGGCCTGGGGGTTGAGG + Intronic
992110093 5:73484641-73484663 AGTTTGTGGCCTGGGAGTTGGGG - Intergenic
994220309 5:97187651-97187673 GGTCCGTGGCCTGGGGGTTGGGG + Intergenic
995746361 5:115408237-115408259 AGTCCACAGCCTGGGGGTTGGGG - Intergenic
996415829 5:123209143-123209165 GGTCAGAAGCCTGGGTCTTGGGG + Intergenic
996432248 5:123394563-123394585 AGTCCGCAGCCTGAGGGTTGAGG + Intronic
996557679 5:124796091-124796113 AGTCTGCAGCCTGGGGGTTGGGG - Intergenic
996769291 5:127068966-127068988 AGTCAGTATCTTTGGAGTTGAGG - Intronic
997030637 5:130123598-130123620 AGTCTGTGGCCTGGGGTTTGAGG + Intronic
997098130 5:130937152-130937174 GGTCTGTGGCCTGGGGGTTGGGG - Intergenic
998017453 5:138743773-138743795 AGTCTGTTGCCTGGGGTTTGGGG + Intronic
998408387 5:141888004-141888026 AGTTGGTAGGCTGGGTGTGGTGG + Intergenic
998674221 5:144389211-144389233 GGTCCGTGGCCTGGGGGTTGGGG - Intronic
998915852 5:147010748-147010770 AATCTGTGGCCTGGGAGTTGGGG + Intronic
999512668 5:152268963-152268985 AGTCCATAGCCTGGGGCTTGAGG + Intergenic
999512811 5:152270569-152270591 AGTCTGTGGCCTGGGGTTTGGGG - Intergenic
999516907 5:152310714-152310736 GGTCTGTGGCCTGGGGGTTGGGG + Intergenic
999702315 5:154239339-154239361 AGTCCGTGGCCTGGGGGTTGGGG - Intronic
1000270131 5:159676586-159676608 AGACAGTTGACTGGGTGTTGGGG + Intergenic
1000270215 5:159677092-159677114 AGACAGTTGACTGGGTGTTGGGG - Intergenic
1000400774 5:160824837-160824859 AGGCACTAGCCTGGGTGTCAAGG + Intronic
1001109398 5:168883414-168883436 AGGCAGCAGCCTGGGTGGGGGGG - Intronic
1001848136 5:174939725-174939747 AGCCAGGAGGCTGGGTGTGGTGG - Intergenic
1002142298 5:177149857-177149879 ATTCTGTGGCCTGGGCGTTGGGG + Intronic
1002516673 5:179764115-179764137 AGTAAGTACCCTGGGAGTTCAGG - Intronic
1003143417 6:3490337-3490359 AGTCCGTGGCCTGGGGGTTGGGG - Intergenic
1003145958 6:3511001-3511023 AGCCAGTAACCTGGGTGGTGAGG + Intergenic
1003615473 6:7651419-7651441 AGCCAGTAACCTGGGAGTTATGG - Intergenic
1003628608 6:7766323-7766345 AATCACTAGGCTGGGTGTGGTGG + Intronic
1004000274 6:11591402-11591424 TGTCTGCAGCCTGGGGGTTGAGG + Intergenic
1004515119 6:16316006-16316028 GGTCTGTTGCCTGGGGGTTGGGG - Intronic
1004821329 6:19371221-19371243 AGACAGTAGGCAGGCTGTTGTGG + Intergenic
1004982300 6:21039048-21039070 AGTCCGTGTCCTGGGGGTTGGGG - Intronic
1005061283 6:21779357-21779379 AGTCAGTAGGCCGGGTGCGGTGG + Intergenic
1005283328 6:24298310-24298332 AGTCCATGGCCTGGGGGTTGGGG + Intronic
1006034176 6:31198760-31198782 AGGCAGTTGGCTGGGTGTGGTGG + Intronic
1007434256 6:41797245-41797267 AGTCAGTCGGCTGGGTGCGGTGG - Intronic
1008908512 6:56707168-56707190 TGTCTGTGGCCTGGGGGTTGGGG + Intronic
1009313558 6:62188824-62188846 TGTCAGTAGGCTGGGTGCGGTGG + Intronic
1009630217 6:66188558-66188580 AGTCTGTGGCCTGGGGGTTGGGG + Intergenic
1009958323 6:70484803-70484825 AGTCCACAGTCTGGGTGTTGGGG + Intronic
1010632141 6:78210438-78210460 AGTTAGCAGCCTGGGGGCTGGGG - Intergenic
1011216339 6:85009745-85009767 AGTCTGTGGCCCGGGGGTTGTGG + Intergenic
1011455931 6:87549065-87549087 AGTCAGGTGGCTGGGTGTGGTGG + Intronic
1011570654 6:88730685-88730707 GGTCTGTGGCCTGGGAGTTGGGG + Intronic
1011577923 6:88825028-88825050 AGACAGAAGGCTGGGTGTGGTGG - Intronic
1011682045 6:89792756-89792778 AGTGGGTGGCCTGGGTGTAGTGG + Intronic
1011838174 6:91459468-91459490 AGACAGTGGCCTTGGTGTTCAGG + Intergenic
1013096297 6:106948351-106948373 AATCAGTAGCCAGGATGTTGGGG - Intergenic
1013740710 6:113280572-113280594 AGTCTGCAGCCTGGAGGTTGGGG + Intergenic
1014153437 6:118085021-118085043 TGTAGGTAGCCTGGGTGGTGGGG + Intronic
1014615208 6:123590098-123590120 GGTCCGTGGCCTGGGGGTTGGGG - Intronic
1014650406 6:124029681-124029703 AGTCTGTGACCTGGGGGTTGGGG - Intronic
1015001295 6:128219571-128219593 AGTTTGCAGCCTGGGGGTTGGGG + Intronic
1017216291 6:151911138-151911160 AGTCTGTGGCCTGGGGGCTGGGG + Intronic
1017464512 6:154682094-154682116 AGTCTGCAGCCTGGGTGCTGGGG - Intergenic
1017474016 6:154770159-154770181 AGAAAGTAGGCTGGGTGTGGTGG + Intronic
1018050058 6:160001071-160001093 AGTCTGTGGCCCGGGGGTTGAGG - Intronic
1018662324 6:166099547-166099569 AGTCTGTCACCTGGGGGTTGGGG + Intergenic
1020131308 7:5560081-5560103 AGTCTGTGGGCTGGGTGTGGTGG + Intronic
1020250814 7:6466972-6466994 AGTCAGTGGCCCAGGGGTTGAGG + Intronic
1020598769 7:10247200-10247222 AGTCTGTGGCCTGGAGGTTGGGG - Intergenic
1020630637 7:10635615-10635637 AGATTTTAGCCTGGGTGTTGTGG + Intergenic
1021214814 7:17902746-17902768 GGTCTGCAGCCTGGGGGTTGGGG - Intronic
1021498930 7:21307890-21307912 GGTCTGTGGCCTGGGGGTTGGGG + Intergenic
1021626942 7:22602870-22602892 AATCTGTAGCCTGGGGGTTGAGG + Intronic
1021652634 7:22846601-22846623 AGTCTGCAGCCTGGGGGTTGGGG + Intergenic
1023332495 7:39133312-39133334 TGTATGTAGCCTGTGTGTTGTGG + Intronic
1023337203 7:39182988-39183010 AGTCTGCAGCTTGGGAGTTGGGG - Intronic
1023408625 7:39863832-39863854 GGTCCGTGGCCTGGGGGTTGGGG - Intergenic
1023440027 7:40175938-40175960 AGTGAGTAGGCTGGGCGTGGTGG + Intronic
1023711417 7:42997281-42997303 ATTCAGTAGGCCGGGTGTGGTGG + Intergenic
1023974533 7:45018272-45018294 AGTCTGTGGCCTGGGGGCTGGGG + Intronic
1024240672 7:47433030-47433052 AGTCAATAACCAGGGTGTGGAGG + Intronic
1024945712 7:54805704-54805726 AATCAGAAGCCCGGGTGTGGTGG + Intergenic
1024984084 7:55180859-55180881 AGTCATTACCCAGGGTGTTCCGG + Intronic
1025137252 7:56428714-56428736 GGTCCGTGGCCTGGGGGTTGGGG + Intergenic
1025625612 7:63218626-63218648 AGGCCATAGCCTGGGGGTTGAGG + Intergenic
1025656504 7:63524545-63524567 AGGCCATAGCCTGGGGGTTGAGG - Intergenic
1025955502 7:66179612-66179634 AGTGAGTAGGCCGGGTGTGGTGG + Intergenic
1026106212 7:67422859-67422881 GGTCCATAGCCTGGGGGTTGGGG + Intergenic
1026369554 7:69685077-69685099 ACTCAGTAGCCTGGCTTTTAAGG + Intronic
1026610533 7:71855615-71855637 AGGCAGCACCCAGGGTGTTGTGG + Intronic
1026641778 7:72132814-72132836 GGTCCGTAGCCTGGGGGTTGGGG - Intronic
1026799521 7:73390732-73390754 AGTCACTTGGCTGGGTGTGGTGG - Intergenic
1028563729 7:92204817-92204839 AGTCCATGGCCTGGGTGTTGGGG + Intronic
1028758428 7:94465402-94465424 AGTAAGTAGGCTGGGCGTGGTGG + Intergenic
1029471454 7:100757276-100757298 ACTAAGTAGGCTGGGTGTGGTGG - Intronic
1029573206 7:101385104-101385126 AGTCAGTGGACTGGGTGAGGAGG - Intronic
1030545491 7:110889620-110889642 AGTCCGTGGCCTGGGGGTTAGGG + Intronic
1031094628 7:117403756-117403778 AGTCTGCTGCCTGGGGGTTGGGG - Intronic
1031430066 7:121657129-121657151 GGTCCATAGCCTGGGGGTTGGGG + Intergenic
1034010448 7:147523733-147523755 AGACAGGAACCTGGCTGTTGAGG - Intronic
1034842567 7:154412849-154412871 AGGCAGATGCCTGGGTGTTCTGG + Intronic
1037053759 8:14409966-14409988 GGTCCGTGGCCTGGGAGTTGGGG - Intronic
1037462815 8:19130439-19130461 AGTTTCTAGCCTGGGTGTTTGGG - Intergenic
1037742470 8:21618524-21618546 AGTCTGTGGCCTGGGGGTTGGGG - Intergenic
1038898811 8:31818724-31818746 AGTCAGTAAGCTGGGAGTTGGGG + Intronic
1039933993 8:42023772-42023794 AGTAAGTAGGCTGGGCGTGGTGG - Intronic
1040029589 8:42812675-42812697 AATCAGGAGGCTGGGTGTGGTGG + Intergenic
1040082764 8:43305309-43305331 AGTCCATGGCCTGGGAGTTGTGG + Intergenic
1040408183 8:47129753-47129775 AGTCTGTGGCCTGGGAGTTGTGG - Intergenic
1040828695 8:51653128-51653150 ACTCAATAGCCTGGGCGTGGTGG + Intronic
1041321855 8:56621779-56621801 AGTCTGCAACCTGGATGTTGGGG + Intergenic
1041425735 8:57718414-57718436 AGGCAGTGGTCTAGGTGTTGGGG - Intergenic
1041712465 8:60906912-60906934 AGTCTGTGGCCTGGGGGTTAGGG + Intergenic
1042315690 8:67423820-67423842 AGTCTGTGGCCTGGGGGTTGGGG - Intronic
1042398448 8:68317751-68317773 GGTCTGTCGCCTGGGGGTTGGGG + Intronic
1043697827 8:83242721-83242743 AGTCCATGGCCTGGGAGTTGGGG + Intergenic
1043736067 8:83745406-83745428 AGTGAGTAGCTTGGGCGTGGTGG - Intergenic
1043935845 8:86141212-86141234 GGTCTGTGGCCTGGGGGTTGGGG + Intronic
1044067134 8:87712806-87712828 GGTCTGTGGCCTGGGAGTTGGGG - Intergenic
1044557125 8:93575120-93575142 AGTCTGTGGCCTGGGGGTTGGGG + Intergenic
1044677884 8:94748113-94748135 AGTGAGTAGCATAGGTGTCGAGG + Intronic
1044686359 8:94829575-94829597 AGTCCATGGCCTGGGGGTTGGGG + Intronic
1044784903 8:95783427-95783449 AGTCCATGGCCTGGGGGTTGGGG - Intergenic
1045934506 8:107663215-107663237 AGTGAATAGCCTGGGTGCAGTGG + Intergenic
1045946752 8:107805140-107805162 AGTCTGTGGCCTGAGGGTTGGGG + Intergenic
1047287877 8:123503924-123503946 AGAAATTAGCCTGGGTGTGGTGG + Intronic
1047309197 8:123677561-123677583 AGTGAGTCACCTGGGTTTTGTGG - Intergenic
1048383367 8:133888309-133888331 GGTCCGTGGCCTGGGGGTTGGGG + Intergenic
1048999986 8:139818967-139818989 AGTCTGTGGCCAGGGGGTTGGGG - Intronic
1049039150 8:140099330-140099352 CGTCAGTAGCCTGCGGATTGCGG - Intronic
1049568312 8:143355031-143355053 ATTCAGCAGCCTGGGAGGTGTGG + Intronic
1049626067 8:143622017-143622039 GGTCCATAGCCTGGGGGTTGGGG + Intergenic
1050000311 9:1070399-1070421 GGTCCATAGCCTGGGGGTTGGGG + Intergenic
1050569105 9:6919136-6919158 AGTGAGTAGGCTGGGCGTGGTGG - Intronic
1051681245 9:19610032-19610054 AGTCCATGGCCTGGGGGTTGGGG + Intronic
1051682058 9:19617313-19617335 AGTCCGTGGTCTGGGGGTTGGGG + Intronic
1051831893 9:21288683-21288705 AGTCTATGGCCTGGGGGTTGGGG - Intergenic
1051900420 9:22032832-22032854 AGTCTGTGGCCTAGGGGTTGGGG - Exonic
1051930070 9:22374251-22374273 AGTTACTAGCCTGGTTGTTTGGG + Intergenic
1052475784 9:28957100-28957122 ATTCAGAAGCCTGGCAGTTGAGG + Intergenic
1052927329 9:34028854-34028876 AGTCTGCAGCCTGGGAGTTGGGG - Intronic
1054757822 9:68976889-68976911 AGTCTATGGCCTGGGGGTTGGGG + Intronic
1056151422 9:83793877-83793899 GGTCAGAAGACTGGGTGTGGTGG + Intronic
1056173680 9:84013139-84013161 GGTCTGTGGCCTGGGGGTTGAGG + Intergenic
1056181276 9:84084906-84084928 AATCAGTAGGCTGGGTGCGGTGG - Intergenic
1056275091 9:84986560-84986582 AGTCCATGGCCTGGGAGTTGGGG + Intronic
1056426506 9:86482735-86482757 AAGCAGAAGCCTGGGTGTGGTGG + Intergenic
1057236854 9:93367790-93367812 AGTAAATAGGCTGGGTGTGGTGG - Intergenic
1057512282 9:95690601-95690623 AGGCAGAAGCCTGGGTTTTGAGG - Intergenic
1057581572 9:96291667-96291689 CTTCAGTAGGCTGGGTGATGTGG + Intronic
1057706496 9:97398740-97398762 AGTGTGTAGGCTGGGTGTGGTGG - Intergenic
1058754414 9:108071103-108071125 AGTCGGTGGCCTGGGAGTTGCGG + Intergenic
1058824830 9:108765924-108765946 AATCAGTAGCCTTGGTTTTGGGG + Intergenic
1059320648 9:113465769-113465791 AGACAGGAGCCTGGGTGGGGTGG + Intronic
1060160876 9:121361996-121362018 CGTCTGTGGCCTGGGAGTTGGGG + Intronic
1060773816 9:126353583-126353605 TGGCAGTAGCGTGAGTGTTGTGG + Intronic
1061041743 9:128144680-128144702 AGGCAGGAGGCTGTGTGTTGTGG + Intergenic
1061467533 9:130793692-130793714 AGTCTGTGGCCTGGGGATTGGGG - Intronic
1061682854 9:132251543-132251565 GGTCTGTGGCCTGGGGGTTGGGG + Intergenic
1203529503 Un_GL000213v1:126097-126119 AGTCTGTGACCTGGGAGTTGTGG - Intergenic
1185837432 X:3358231-3358253 AGTCCATGGCCTGGGGGTTGGGG - Intergenic
1185971507 X:4670653-4670675 AGTCTGTGGCCTGGGGGTTGGGG - Intergenic
1186042275 X:5494102-5494124 AATCAGTAGACTGGGTGATATGG + Intergenic
1186117993 X:6325361-6325383 GGTCTGGAGGCTGGGTGTTGAGG - Intergenic
1186336532 X:8595767-8595789 AGTCAGTGGCCCGGGAGCTGGGG - Intronic
1186511105 X:10130326-10130348 ACGCAGTGGCCCGGGTGTTGTGG + Intronic
1186919567 X:14263080-14263102 AGACAGTAGGCTGGGTGCGGTGG - Intergenic
1188292819 X:28410060-28410082 AATCAGTGGCCTGGGGGTTAGGG - Intergenic
1188765173 X:34081659-34081681 ATAAAGTAGCCTGGGTGTGGTGG + Intergenic
1188818939 X:34749338-34749360 AGTCCGTGGCCTGAGAGTTGGGG + Intergenic
1189213246 X:39302333-39302355 AGTTGGTAGCCTGGAGGTTGAGG - Intergenic
1189364596 X:40378737-40378759 ATTCAGTAGGCTGGGCGTGGTGG - Intergenic
1189749841 X:44209656-44209678 AGCCCGTGGCCTGGGGGTTGGGG - Intronic
1190078797 X:47338767-47338789 AGTCTGTGGCCTGAGTGCTGGGG + Intergenic
1190224204 X:48533174-48533196 AGTCTATAGGGTGGGTGTTGGGG - Intergenic
1190779795 X:53582959-53582981 AGACAATAGTCTGGGTGTGGTGG - Intronic
1192382391 X:70631797-70631819 AATCAGAAGACTGTGTGTTGTGG + Intronic
1192625525 X:72723467-72723489 ACACAGTAGCCAGGGTGTAGAGG - Intergenic
1194425679 X:93734493-93734515 AATTAGTTGGCTGGGTGTTGTGG - Intergenic
1194711531 X:97242229-97242251 AATGAGTAGCCTGGGTTTGGAGG - Intronic
1195229540 X:102832081-102832103 TGTCAGAAGGCTGGGTGGTGGGG + Intergenic
1196402318 X:115329525-115329547 GGTCTGTGGCCTGGGGGTTGGGG + Intergenic
1196872389 X:120125344-120125366 AGACGGTAGCCTTGGTGTTTTGG + Intergenic
1197790226 X:130247393-130247415 AGTCAGTAGGCTGGGCATGGTGG - Intronic
1198390472 X:136168955-136168977 AGGCACTGACCTGGGTGTTGGGG + Intronic
1198670957 X:139080495-139080517 AGACAGGAGCCTGGGAATTGAGG - Intronic
1198691323 X:139288017-139288039 AGTGTGTGGGCTGGGTGTTGTGG + Intergenic
1199156060 X:144550631-144550653 AGTCAGTGGCCTGGGGTTGGGGG + Intergenic
1199236330 X:145498401-145498423 AGACAGTGGACTGGGGGTTGGGG + Intergenic
1199440095 X:147857997-147858019 TGTCCATAGCCTGGGGGTTGGGG - Intergenic
1199601504 X:149543959-149543981 AGTCAGTGGAGTGGGTGGTGGGG + Intronic
1199648873 X:149935525-149935547 AGTCAGTGGAGTGGGTGGTGGGG - Intronic
1199742563 X:150749563-150749585 AGCCAGTAGCTGGTGTGTTGTGG - Intronic
1200170875 X:154073563-154073585 AGTCAGGAGGCTGGGTGCGGTGG + Intronic
1200386441 X:155895761-155895783 GGTCTGCAGCCTGGGGGTTGGGG - Intronic
1201545969 Y:15162412-15162434 AATCAGTAGACTGGGTGATATGG - Intergenic