ID: 1105502876

View in Genome Browser
Species Human (GRCh38)
Location 13:20988331-20988353
Sequence GCCCTCCGCAGCCGGGGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 329}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105502862_1105502876 15 Left 1105502862 13:20988293-20988315 CCGCCCAGCGCCAGGGCATGCTC 0: 1
1: 0
2: 0
3: 25
4: 256
Right 1105502876 13:20988331-20988353 GCCCTCCGCAGCCGGGGCGGGGG 0: 1
1: 0
2: 2
3: 23
4: 329
1105502866_1105502876 5 Left 1105502866 13:20988303-20988325 CCAGGGCATGCTCCTCCTTGGCG 0: 1
1: 0
2: 1
3: 8
4: 192
Right 1105502876 13:20988331-20988353 GCCCTCCGCAGCCGGGGCGGGGG 0: 1
1: 0
2: 2
3: 23
4: 329
1105502861_1105502876 21 Left 1105502861 13:20988287-20988309 CCTGCGCCGCCCAGCGCCAGGGC 0: 1
1: 0
2: 5
3: 42
4: 437
Right 1105502876 13:20988331-20988353 GCCCTCCGCAGCCGGGGCGGGGG 0: 1
1: 0
2: 2
3: 23
4: 329
1105502867_1105502876 -7 Left 1105502867 13:20988315-20988337 CCTCCTTGGCGTCCAAGCCCTCC 0: 1
1: 0
2: 0
3: 11
4: 202
Right 1105502876 13:20988331-20988353 GCCCTCCGCAGCCGGGGCGGGGG 0: 1
1: 0
2: 2
3: 23
4: 329
1105502863_1105502876 12 Left 1105502863 13:20988296-20988318 CCCAGCGCCAGGGCATGCTCCTC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1105502876 13:20988331-20988353 GCCCTCCGCAGCCGGGGCGGGGG 0: 1
1: 0
2: 2
3: 23
4: 329
1105502864_1105502876 11 Left 1105502864 13:20988297-20988319 CCAGCGCCAGGGCATGCTCCTCC 0: 1
1: 0
2: 1
3: 11
4: 234
Right 1105502876 13:20988331-20988353 GCCCTCCGCAGCCGGGGCGGGGG 0: 1
1: 0
2: 2
3: 23
4: 329
1105502868_1105502876 -10 Left 1105502868 13:20988318-20988340 CCTTGGCGTCCAAGCCCTCCGCA 0: 1
1: 1
2: 0
3: 6
4: 78
Right 1105502876 13:20988331-20988353 GCCCTCCGCAGCCGGGGCGGGGG 0: 1
1: 0
2: 2
3: 23
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105502876 Original CRISPR GCCCTCCGCAGCCGGGGCGG GGG Exonic