ID: 1105503079

View in Genome Browser
Species Human (GRCh38)
Location 13:20989068-20989090
Sequence TGGCACCGTAGCCCTTGGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105503066_1105503079 26 Left 1105503066 13:20989019-20989041 CCGTAGTGCGCGCCCTGCAGCGG 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1105503079 13:20989068-20989090 TGGCACCGTAGCCCTTGGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1105503073_1105503079 -6 Left 1105503073 13:20989051-20989073 CCCTGCTGCCTCTACGCTGGCAC 0: 1
1: 0
2: 0
3: 6
4: 141
Right 1105503079 13:20989068-20989090 TGGCACCGTAGCCCTTGGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1105503064_1105503079 30 Left 1105503064 13:20989015-20989037 CCGCCCGTAGTGCGCGCCCTGCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1105503079 13:20989068-20989090 TGGCACCGTAGCCCTTGGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1105503074_1105503079 -7 Left 1105503074 13:20989052-20989074 CCTGCTGCCTCTACGCTGGCACC 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1105503079 13:20989068-20989090 TGGCACCGTAGCCCTTGGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1105503072_1105503079 -5 Left 1105503072 13:20989050-20989072 CCCCTGCTGCCTCTACGCTGGCA 0: 1
1: 0
2: 3
3: 27
4: 259
Right 1105503079 13:20989068-20989090 TGGCACCGTAGCCCTTGGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1105503065_1105503079 27 Left 1105503065 13:20989018-20989040 CCCGTAGTGCGCGCCCTGCAGCG 0: 1
1: 0
2: 0
3: 16
4: 50
Right 1105503079 13:20989068-20989090 TGGCACCGTAGCCCTTGGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1105503069_1105503079 14 Left 1105503069 13:20989031-20989053 CCCTGCAGCGGGAAGTGTGCCCC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1105503079 13:20989068-20989090 TGGCACCGTAGCCCTTGGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1105503070_1105503079 13 Left 1105503070 13:20989032-20989054 CCTGCAGCGGGAAGTGTGCCCCT 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1105503079 13:20989068-20989090 TGGCACCGTAGCCCTTGGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105503079 Original CRISPR TGGCACCGTAGCCCTTGGGT GGG Exonic
901068917 1:6507698-6507720 TGGCACCTTAGCCCTCAGCTGGG - Intronic
908190195 1:61695374-61695396 TAGCATCTTAGCTCTTGGGTTGG - Intronic
908249758 1:62255982-62256004 TGGCCCCATGGCCCATGGGTTGG - Intronic
912777070 1:112512395-112512417 TGTTACGGTAGGCCTTGGGTGGG + Intronic
914442280 1:147718174-147718196 TTGAACCGGAGCACTTGGGTGGG - Intergenic
921002382 1:211056565-211056587 GGTCACTGTAGGCCTTGGGTGGG + Intronic
923303832 1:232669893-232669915 TGGCAGGGTAGCCCTCAGGTTGG - Intergenic
1064185279 10:13156799-13156821 TGGCACTGTAGCCCCTCTGTGGG - Intergenic
1065573914 10:27099960-27099982 GGGCTCCGTAGCCCCTGGGACGG - Intronic
1069582933 10:69577625-69577647 TGGCGCAGCAGCCGTTGGGTGGG - Intergenic
1071293215 10:84201950-84201972 TGTCTCCTCAGCCCTTGGGTTGG + Intronic
1079107197 11:17579164-17579186 TGGCACCTTATCCCATGGCTTGG + Intronic
1084347001 11:68559741-68559763 GGGCACTGTATCCCTGGGGTAGG - Intronic
1084347027 11:68559822-68559844 GGGCACCGTACCGCTGGGGTGGG - Intronic
1084347036 11:68559849-68559871 GGGCACCGTACCGCTGGGGTGGG - Intronic
1084347045 11:68559876-68559898 GGGCACCGTACCGCTGGGGTGGG - Intronic
1084347054 11:68559903-68559925 GGGCACCGTACCGCTGGGGTGGG - Intronic
1084347070 11:68559957-68559979 GGGCACCGTACCGCTGGGGTGGG - Intronic
1084372987 11:68756804-68756826 TGGCACAGCTGCCCTTGGGAAGG + Exonic
1084809754 11:71605021-71605043 TGGCACTGTACACCTGGGGTTGG + Intergenic
1086108235 11:83169771-83169793 TGGAACTGTAGTCCTTGGGATGG - Exonic
1094849036 12:34374099-34374121 TGGCACTTTCGCCCGTGGGTGGG + Intergenic
1094872613 12:34606659-34606681 TGGCACTTTCGCCCGTGGGTGGG - Intergenic
1095830976 12:46586236-46586258 TGTCACAGCAGCCCTTGGCTAGG + Intergenic
1096502518 12:52073569-52073591 TTGCAGGGTGGCCCTTGGGTAGG + Exonic
1100235927 12:92660697-92660719 TGGTCCCGTAGGCCATGGGTTGG + Intergenic
1105503079 13:20989068-20989090 TGGCACCGTAGCCCTTGGGTGGG + Exonic
1108722775 13:53148959-53148981 TGTCTCCTTAGCCCTTGGGAAGG + Intergenic
1109653123 13:65354050-65354072 TGGTGCCTTAGCCCTTGGATGGG - Intergenic
1111954087 13:94738014-94738036 AGACACCGTAGCCCTTGACTGGG + Intergenic
1113720629 13:112553305-112553327 TGGCAGCGTAGCTGGTGGGTAGG - Intronic
1117870761 14:60198119-60198141 TCTCACCATAGGCCTTGGGTGGG + Intergenic
1121423511 14:93832286-93832308 TCACACCCTAGGCCTTGGGTTGG + Intergenic
1121447307 14:93987334-93987356 ATGCACGGCAGCCCTTGGGTTGG - Intergenic
1124054020 15:26225011-26225033 TGCCAGCATAGCCCTCGGGTGGG + Intergenic
1126037222 15:44557993-44558015 TGGCACTGTAGGATTTGGGTTGG + Intronic
1132389122 15:101425999-101426021 TGACTCCGTAGGCCTGGGGTGGG + Intronic
1132665527 16:1079828-1079850 TGGCACCAGAGCCCTTGCGGAGG - Exonic
1132756421 16:1487550-1487572 TGGCACTGCAGCCCTCGGGCCGG - Exonic
1134463038 16:14446346-14446368 TTTCACCGTAGCCCTGAGGTGGG - Intronic
1138543052 16:57699985-57700007 TGGCAGAGCAGCCCTTGGCTGGG - Intronic
1139589976 16:67928168-67928190 TGGACCCGTAGCCCCTGGCTAGG + Exonic
1140472195 16:75222225-75222247 TGGCACCGTGGACCCTGGGTGGG - Intronic
1141361586 16:83400371-83400393 TTGCACAGTAGCCTATGGGTTGG + Intronic
1149667359 17:58374731-58374753 GGGCACCGTAGCCATGGGATTGG - Intronic
1157806742 18:50664027-50664049 TGACACCGAAGCCCAGGGGTTGG - Exonic
1163501358 19:17678440-17678462 CTGCACTGCAGCCCTTGGGTGGG + Intronic
1164725588 19:30463747-30463769 TGCCACCGTAGACTTTTGGTGGG + Intronic
1164863926 19:31588116-31588138 TGGCCCAGTAGCACTTGGGAGGG + Intergenic
925235324 2:2272731-2272753 TGGCAGGGAAGCCCTTGGGAGGG - Intronic
933651028 2:84850437-84850459 TGACAGAGTAGCTCTTGGGTTGG + Intronic
943758559 2:191584527-191584549 TGGTTCCGTAGCCCTATGGTGGG + Intergenic
1170879015 20:20278240-20278262 TGGCAGCATAGACCTTGGGCTGG - Intronic
1172623603 20:36335068-36335090 TGGCACCTGAGCCCCTGGGGTGG + Intronic
1174168124 20:48599224-48599246 TTGCACCGTGGCCCCTGGGTGGG - Intergenic
1176098343 20:63354094-63354116 AGGCACTGTAGCCCTAGGGTGGG + Intronic
1176098443 20:63354401-63354423 AGGCACTGTAGCCCTAGGGTGGG + Intronic
1176663252 21:9660282-9660304 TGGCACAGGAGCCCATGGGGGGG - Intergenic
1178321993 21:31612852-31612874 TGGCACAGTAGCACTTTCGTAGG + Intergenic
1183439475 22:37815292-37815314 TGGCACCTGAGGCCTGGGGTGGG + Intronic
1184492256 22:44816406-44816428 GGGCAGTGTAGCCCTTGGGGCGG - Intronic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
962312735 3:134337601-134337623 TGGCACTGTAGGCCTTGGAGTGG + Intergenic
963843328 3:150130306-150130328 TGTCACTTGAGCCCTTGGGTTGG + Intergenic
970012997 4:11481087-11481109 TGCCACCTTTTCCCTTGGGTTGG - Intergenic
976998193 4:91462604-91462626 TGGCACCGCTTCCCTTGGCTAGG - Intronic
981250797 4:142598507-142598529 TGCCACTGTAGTCCTTTGGTGGG - Intronic
985800946 5:2005070-2005092 AGGCACCAGAGCCCTTGTGTGGG + Intergenic
990818115 5:59807896-59807918 TGTCTCCGTAGGTCTTGGGTAGG - Intronic
991066788 5:62432425-62432447 AGAAACCGTAGCCCTTGGCTGGG + Intronic
993668486 5:90730672-90730694 TGGCAAGGAATCCCTTGGGTGGG + Intronic
997692478 5:135835937-135835959 TGGCACAGATGCCCTTGGGTGGG + Intronic
1005341710 6:24849656-24849678 TGACACAGTAGTCCTGGGGTGGG + Intronic
1014816709 6:125943536-125943558 TCGCACCATTGCACTTGGGTAGG + Intergenic
1017462325 6:154663043-154663065 TGGTACAAGAGCCCTTGGGTTGG - Intergenic
1031125647 7:117770881-117770903 TGTCTCCGTATCACTTGGGTAGG - Intronic
1034617217 7:152428802-152428824 TGACACTTTAGACCTTGGGTTGG - Intronic
1049614459 8:143570053-143570075 TGCCACCATAGCACTGGGGTGGG + Exonic
1057275807 9:93675489-93675511 TGGCATCTTCCCCCTTGGGTGGG + Intronic
1060757494 9:126223865-126223887 TGGCACCGGAGCTCTGGGCTGGG + Intergenic
1060906636 9:127313057-127313079 TGGCAGCTTGGCCCTTGGGCTGG + Intronic
1062403653 9:136383350-136383372 TGGCACTGGACCCCTTGGGAGGG + Exonic
1190478382 X:50850431-50850453 TGGCTCTGTAGCCCTATGGTGGG - Intergenic