ID: 1105503098

View in Genome Browser
Species Human (GRCh38)
Location 13:20989116-20989138
Sequence GGGGGCCGACTCCGGGGAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105503083_1105503098 13 Left 1105503083 13:20989080-20989102 CCTTGGGTGGGTGCTGGTGCTGG 0: 1
1: 0
2: 1
3: 54
4: 640
Right 1105503098 13:20989116-20989138 GGGGGCCGACTCCGGGGAAAAGG 0: 1
1: 0
2: 0
3: 3
4: 99
1105503080_1105503098 20 Left 1105503080 13:20989073-20989095 CCGTAGCCCTTGGGTGGGTGCTG 0: 1
1: 0
2: 2
3: 152
4: 1060
Right 1105503098 13:20989116-20989138 GGGGGCCGACTCCGGGGAAAAGG 0: 1
1: 0
2: 0
3: 3
4: 99
1105503082_1105503098 14 Left 1105503082 13:20989079-20989101 CCCTTGGGTGGGTGCTGGTGCTG 0: 1
1: 0
2: 3
3: 27
4: 361
Right 1105503098 13:20989116-20989138 GGGGGCCGACTCCGGGGAAAAGG 0: 1
1: 0
2: 0
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105503098 Original CRISPR GGGGGCCGACTCCGGGGAAA AGG Exonic
901241810 1:7698642-7698664 GTTGGCTGACTCAGGGGAAAGGG - Intronic
902457761 1:16548172-16548194 GACGGCCGGCGCCGGGGAAAAGG - Intergenic
902475207 1:16680513-16680535 GACGGCCGGCGCCGGGGAAAAGG - Intergenic
902494399 1:16859741-16859763 GACGGCCGGCGCCGGGGAAAAGG + Intronic
902709803 1:18230913-18230935 GGGGGCAGGCTGCGGGGAGAGGG - Intronic
902719033 1:18292005-18292027 GCGGGCCGACAGCGGGGGAAGGG + Intronic
903499856 1:23794953-23794975 GGGGCCCGCCTCCAGGGAAATGG - Exonic
911449469 1:98045645-98045667 GGGGGCTGCCTCCGCAGAAAGGG - Intergenic
915704721 1:157833105-157833127 GGGGGTGTACTCTGGGGAAAAGG - Intronic
918001541 1:180502182-180502204 AGGGGACGACTCCGGGGAGGTGG - Exonic
920805731 1:209231877-209231899 GGGGGCCGAGGCCGGGGCCAGGG + Intergenic
923144105 1:231185863-231185885 GGGGGAAGACTTCGTGGAAAAGG + Intronic
923985108 1:239373052-239373074 TGGGGCCTACTCTGGGGTAAAGG - Intergenic
1069680700 10:70283610-70283632 GGGTACCGACTCCGGGGCATGGG - Intronic
1072725044 10:97807487-97807509 GAGGGGCCACTCAGGGGAAAAGG + Intergenic
1073525828 10:104181154-104181176 TGGGGCAGACTCTGGGGGAAGGG - Intronic
1074883884 10:117679768-117679790 GGGGCCAGCCTCTGGGGAAATGG + Intergenic
1075396703 10:122132956-122132978 GGGGGCCGGGACAGGGGAAACGG - Intronic
1076836231 10:133022351-133022373 GAGGGCCGACTCCGGAGAGCAGG - Intergenic
1077371325 11:2182895-2182917 GGGAGCGGGCTTCGGGGAAAGGG - Intergenic
1083166021 11:60888412-60888434 GAGGGCAGACTCCAGGGAGAGGG + Intergenic
1085250736 11:75142045-75142067 GGGGGCTGACTCTGAGGAGATGG + Intronic
1092256180 12:6927925-6927947 GGGAGCCGACTGCCGGGGAAGGG + Intronic
1095923137 12:47551242-47551264 GAGGCCCGACTAAGGGGAAATGG - Intergenic
1096749447 12:53749398-53749420 GGAGGCAGACTAAGGGGAAATGG + Intergenic
1105503098 13:20989116-20989138 GGGGGCCGACTCCGGGGAAAAGG + Exonic
1105773990 13:23639544-23639566 GGTGGGAGACTCCAGGGAAAGGG - Intronic
1109642131 13:65204177-65204199 GGGGTCCTACACTGGGGAAAAGG - Intergenic
1113226977 13:108169505-108169527 GGGGGTCCACTCCAGAGAAATGG - Intergenic
1118514103 14:66508101-66508123 GGGGGCGGACTCGGGGACAAGGG - Exonic
1119466676 14:74863698-74863720 GGGACCTGACTCCAGGGAAACGG + Exonic
1122183416 14:99971746-99971768 GGGGGCCGCCGCCGGGGGATGGG - Intronic
1123216327 14:106812765-106812787 GGGGCTCCACTCCGGGGGAAGGG + Intergenic
1123995259 15:25713698-25713720 GGGGGCCGACTCAGTGGTCATGG - Exonic
1124848199 15:33311456-33311478 GAGGGCCGACCCCGGGGCGAGGG - Intronic
1129385895 15:75195969-75195991 GGGCGCCGAGGCCGGGGGAAGGG + Intronic
1136366033 16:29809700-29809722 GGGGGGCGTCTCCCGGGACAGGG - Exonic
1136873063 16:33825313-33825335 GGGGCTCTACTCCGGGGGAAGGG - Intergenic
1142134284 16:88444504-88444526 GAGGGCCGGCCCCGGGGAAGGGG + Intergenic
1142367387 16:89657388-89657410 GGGGGACGACGACCGGGAAAAGG + Intronic
1203099109 16_KI270728v1_random:1290742-1290764 GGGGCTCTACTCCGGGGGAAGGG + Intergenic
1142604014 17:1071779-1071801 GGAGGCCCACGCCGGGGAAGTGG - Intronic
1143188379 17:5023948-5023970 GGGGGCCGATCCCGGGGAGCGGG + Exonic
1143730391 17:8879398-8879420 AGTGCCCGACTCAGGGGAAATGG - Exonic
1146590385 17:34123428-34123450 GGGGCCAGACTCCTGGGGAATGG + Intronic
1150652064 17:67016704-67016726 GGGGGCTGACCCGGGGGAAGGGG + Intronic
1151766344 17:76135288-76135310 GGGGGCGGACAGTGGGGAAAAGG + Intergenic
1152031376 17:77845583-77845605 GGGGGCTGACTGAGAGGAAAAGG - Intergenic
1152314570 17:79572608-79572630 TGGGGCCACCTCCGGGGAAAGGG - Intergenic
1152911222 17:83005883-83005905 GGGAGCCCACTCCGGGGCAGAGG - Intronic
1153451743 18:5238011-5238033 AGGGGCGGACTCCGCGGACAAGG - Intergenic
1157542474 18:48521521-48521543 GGGTGCTGACACCTGGGAAAAGG + Intergenic
1159045546 18:63366555-63366577 GGGGGCAGACAGCGGGGAAGTGG - Intronic
1160436695 18:78857390-78857412 GGGAGCTGGCTCCGTGGAAAAGG - Intergenic
1160591545 18:79947613-79947635 GGGGGCAGGCTCCGGTGAGAAGG - Intronic
1161312004 19:3600052-3600074 GGGCGCCGAGTCCGGGGACGTGG - Exonic
1161801023 19:6416818-6416840 GGGGGCCGAGGCCGAGGAAGAGG - Exonic
1162915555 19:13872868-13872890 GAGGGCGGGCTCTGGGGAAAGGG + Intronic
1162964367 19:14149055-14149077 AGGGGCCACCTCTGGGGAAACGG + Exonic
1165891193 19:39113327-39113349 GGGAACAGACTCCCGGGAAAAGG - Intergenic
1166125742 19:40714595-40714617 GGGGGCCTACTTCGGGGGACCGG - Exonic
926046368 2:9712429-9712451 GGAGGCCGACTTCGGGGATGTGG + Intergenic
928093987 2:28393000-28393022 GGGAGCGGGCTCCGGGGAAGGGG + Exonic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
938163808 2:129009210-129009232 GGGGGCCGAGCCCGGGGTGAGGG + Intergenic
938261156 2:129895925-129895947 GTGGGCTGACACCTGGGAAAAGG + Intergenic
948393128 2:237626883-237626905 GGGGGCAGACAGCGGGGAGAAGG + Intergenic
949046537 2:241874889-241874911 GGGGGCCAACTGCAGGGACAGGG + Intergenic
1172996254 20:39072343-39072365 GAGGGCCGCCTCCAGGGAAGAGG - Intergenic
1176306784 21:5127964-5127986 GGGAGCTGACCCGGGGGAAAGGG + Intronic
1178707846 21:34889603-34889625 GGGGGCCGCTTCCGGGGAGCCGG - Intronic
1179850273 21:44134066-44134088 GGGAGCTGACCCGGGGGAAAGGG - Intronic
1180662101 22:17476705-17476727 GGGAGCAGACTCTTGGGAAATGG + Intronic
1183377252 22:37472448-37472470 GGGGTCCTCCTCCGGGGAGAAGG + Exonic
1183975042 22:41507083-41507105 GGGTGGGGCCTCCGGGGAAATGG + Intronic
962360746 3:134740807-134740829 GAGGGCCGACCCCAGGGAAGAGG + Intronic
964789624 3:160441116-160441138 GGGGACCTAATCTGGGGAAAAGG - Intronic
968834089 4:2949998-2950020 AGAGGCAGACTCCTGGGAAAGGG - Exonic
972396543 4:38663783-38663805 GGGCGCGGACTCCGGGGAGGAGG + Intergenic
972670884 4:41213732-41213754 GGGGACCGACTCCAGGAAACTGG - Intronic
980991350 4:139741065-139741087 GGGGGCCGAGGGTGGGGAAAAGG - Intronic
985988350 5:3535878-3535900 GGCGGCCGCCTGCGGGGAACAGG + Intergenic
999768230 5:154756224-154756246 GGGGGCCTCTTCCGGGGACATGG + Intronic
999914078 5:156238358-156238380 GGATGCCCACTCCAGGGAAAGGG - Intronic
1004720524 6:18264446-18264468 GGCGGCCGACGCCGAGGAGAAGG + Exonic
1006327505 6:33365304-33365326 GGGGCCCGCCTCCAGGGAAATGG + Intergenic
1014947592 6:127516065-127516087 CGGCGGCGGCTCCGGGGAAAGGG - Exonic
1015335085 6:132027730-132027752 GGGGGCTGAATCCTGTGAAAAGG + Intergenic
1026025398 7:66740515-66740537 GAGGGCGGCCTCCGGGGTAAAGG - Intronic
1030598000 7:111562333-111562355 CGGGGCCGACTCCCAGGGAAGGG + Intronic
1033426074 7:141245289-141245311 GTGGGCTGCCTCCTGGGAAAGGG + Intronic
1035260614 7:157659332-157659354 GGGGGACGACTGCGGGGATGGGG + Intronic
1035260624 7:157659354-157659376 GGGGGACGACTGTGGGGAAGGGG + Intronic
1035571109 8:673391-673413 GGGTGCAGACTCCGGGGAGGAGG - Exonic
1038002617 8:23404185-23404207 GGCGGCCGCCTTCGGGGAAGGGG - Exonic
1041648878 8:60281566-60281588 CGGGGGCGACCCCGGGGGAAGGG - Intergenic
1052184575 9:25576785-25576807 GGGGTCAGAATCCGGGGGAAAGG - Intergenic
1055508466 9:76971258-76971280 GGGGCCTGCCTCCAGGGAAATGG - Intergenic
1061790577 9:133056979-133057001 GGGGACCCATTCCTGGGAAATGG + Intronic
1191899984 X:66030973-66030995 GGGGTCAGACTCAGGGGACAAGG + Intronic
1192510257 X:71717093-71717115 GGTGGCCGGCTCCGGGGGAGCGG + Exonic
1192516440 X:71764460-71764482 GGTGGCCGGCTCCGGGGGAGCGG - Exonic
1196918164 X:120560785-120560807 GGGGGGCTACACCGGGGGAATGG + Intronic