ID: 1105505309

View in Genome Browser
Species Human (GRCh38)
Location 13:21004818-21004840
Sequence TTGCTGTTTTTAAGGACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105505304_1105505309 5 Left 1105505304 13:21004790-21004812 CCTTCTAAAACCTACACCAACCA 0: 1
1: 0
2: 2
3: 5
4: 207
Right 1105505309 13:21004818-21004840 TTGCTGTTTTTAAGGACAACAGG 0: 1
1: 0
2: 0
3: 24
4: 222
1105505305_1105505309 -5 Left 1105505305 13:21004800-21004822 CCTACACCAACCAAGACATTGCT 0: 1
1: 0
2: 0
3: 14
4: 168
Right 1105505309 13:21004818-21004840 TTGCTGTTTTTAAGGACAACAGG 0: 1
1: 0
2: 0
3: 24
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105505309 Original CRISPR TTGCTGTTTTTAAGGACAAC AGG Intronic
902099310 1:13972714-13972736 TGGCTGTATTTAAAGAGAACTGG + Intergenic
905054037 1:35077754-35077776 TCAGAGTTTTTAAGGACAACTGG - Intronic
907285812 1:53378780-53378802 CTGCTGTGTTTAAGGGCCACTGG + Intergenic
908079954 1:60566286-60566308 TTGCTGTTTTCCAGGAGCACAGG - Intergenic
908147475 1:61262493-61262515 ATGTTGATTTTAAGGCCAACTGG + Intronic
911507975 1:98777328-98777350 TTGGTGTCTTCAAGAACAACAGG + Intergenic
912984785 1:114416871-114416893 TTGCTGTTTATAAAGAAAAGAGG - Intronic
913271622 1:117099628-117099650 TTGTTGTTTTTAAAGACAAGGGG - Intronic
913562579 1:120036732-120036754 TTGCAGTTTTTATGTACAATTGG - Intronic
913635543 1:120756875-120756897 TTGCAGTTTTTATGTACAATTGG + Intergenic
917623923 1:176826703-176826725 TTGCCATTTTTCAGGTCAACTGG + Intronic
918825805 1:189322586-189322608 TTGCTGTATTTAAAAACATCTGG - Intergenic
918945281 1:191056716-191056738 TTGCTTTTTTTGAGCAGAACTGG - Intergenic
919256626 1:195133426-195133448 CTTATGTTTTTAAGGAGAACAGG + Intergenic
919407104 1:197199404-197199426 TTGCTGTTCTGAATGACCACTGG + Exonic
921358057 1:214305173-214305195 TTTCTGTTTTTAAGGAAAGAAGG + Exonic
921542488 1:216433231-216433253 TTGTTGCTTTCAAGGACAACTGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922619646 1:226981901-226981923 TTGCTGGTTTTATGGACGCCTGG + Intronic
1063400401 10:5738533-5738555 TTGCTGTTTTAAATAAAAACTGG + Intronic
1064096318 10:12427127-12427149 TAGATGTTTCTCAGGACAACTGG + Intronic
1064558961 10:16576929-16576951 TTGCTCTTTTTAAGAAAAAGGGG + Intergenic
1066598014 10:37074107-37074129 TTGCTGTTTTTAGTGATAAATGG - Intergenic
1068572605 10:58646931-58646953 TTTCTGTTTTTAAGTAAAAATGG + Intronic
1070054141 10:72918394-72918416 TGACTGTTTTTAAAGATAACTGG + Intronic
1070766901 10:79061967-79061989 GTGCTGTTTTCAAGGACACACGG - Intergenic
1071240916 10:83703702-83703724 TTGCTGTTTTCCAGGAGCACAGG + Intergenic
1071403242 10:85299372-85299394 CAGCTGTTTTTAAGCATAACTGG + Intergenic
1073530170 10:104223595-104223617 TTGCTCTTAGTAAGGACAATTGG + Intronic
1076560857 10:131362421-131362443 TGGATGTTTCTCAGGACAACAGG + Intergenic
1081801447 11:45862278-45862300 TTGCTGTTGTTATGGCCATCAGG - Intronic
1082769624 11:57196874-57196896 TTGCTCTATTTAAGGTCCACTGG - Intergenic
1085891849 11:80588957-80588979 TTGCTGTTTTTAGTGATAAATGG + Intergenic
1086146401 11:83556919-83556941 TTGCTGGTTTGAAGTACCACTGG - Intronic
1089442079 11:118525794-118525816 TTTTTGTTTTTAAGGAAAAGCGG + Exonic
1090324214 11:125870814-125870836 TAGTTGTTTTTAAGGAAAAAAGG + Intergenic
1090495282 11:127205828-127205850 TTGGTGTTTCCCAGGACAACAGG - Intergenic
1092733031 12:11552307-11552329 TGGGTGTTTTTAAAGAGAACAGG - Intergenic
1092763675 12:11832705-11832727 TTGCTGTATTTCAGGATATCAGG + Intronic
1093325232 12:17766317-17766339 TTGCTGTTTATTGGGACAAATGG + Intergenic
1093425075 12:19019442-19019464 TGGCTGTTTTTCAGGATCACAGG + Intergenic
1094718959 12:33042443-33042465 TTACTGTTTTGAAAGACACCAGG - Intergenic
1095849331 12:46784362-46784384 TTGCTGTTTTTAATTAAAGCAGG + Intronic
1096703571 12:53403866-53403888 TTCCTTTTTTTAAGGAGACCGGG - Intronic
1097755404 12:63401819-63401841 TGGCTGTTTTTCAGGATCACAGG + Intergenic
1098453513 12:70646669-70646691 TTGCTTATTTTAAGGACACTTGG - Intronic
1100413003 12:94340938-94340960 TTGCTGGTTTCAGGGACACCTGG - Intronic
1100901982 12:99251815-99251837 TTCCTATTTTTAAGGATACCGGG + Intronic
1101535371 12:105611677-105611699 TTGCTGTTTTGCAGGACTATGGG + Intergenic
1104585932 12:130047990-130048012 TTTCTTTTTTTAAGGAAAACAGG + Intergenic
1105294655 13:19076987-19077009 TTGATGTTTTTCAGAACAATGGG - Intergenic
1105505309 13:21004818-21004840 TTGCTGTTTTTAAGGACAACAGG + Intronic
1106059898 13:26279552-26279574 GTGCTGTTTTAAATGACCACTGG + Intronic
1106686780 13:32068773-32068795 TTGCTCTTTGTTAGGATAACAGG + Intronic
1107257327 13:38443950-38443972 TTCCTGTTTTTAAGGTCAGCTGG + Intergenic
1111281496 13:86030465-86030487 TTTCTCTTTTTAAGTACATCAGG + Intergenic
1111392716 13:87618940-87618962 TTGCTGTTTTCCAGGAGTACAGG - Intergenic
1111938564 13:94584332-94584354 TTTCTTCTTTTAAGGACACCAGG - Intronic
1112487566 13:99834005-99834027 TTGCTTATTTTGAGGACACCTGG + Intronic
1112995602 13:105571259-105571281 ATGCTATTTTTAAAGTCAACAGG - Intergenic
1113525765 13:110974490-110974512 TTGCTGTTTTAAAAGACAGAAGG + Intergenic
1114162315 14:20182127-20182149 TTGCTGTTAGTAAGGAGAATTGG + Intergenic
1114392294 14:22322876-22322898 TTCCTGTTTTTAAGAAGTACTGG + Intergenic
1115801930 14:37004439-37004461 ATGCTGTGTTTGAGGACACCTGG + Intronic
1118960284 14:70523762-70523784 TTGATGTTTTTGAAGACAACAGG - Exonic
1119663915 14:76470692-76470714 TTGCTGTTTTTAAAGAGACAAGG + Intronic
1119812266 14:77532043-77532065 TTGTTGTTTTTAAGTAAAAGGGG - Intronic
1120879161 14:89401268-89401290 TTTCTGTTTTTAGTGAAAACGGG - Intronic
1124627925 15:31319947-31319969 TTGCTGGCTTTAAAGACAAAGGG - Intergenic
1125234237 15:37493056-37493078 TTGCTGCTTTTAAAGACCACTGG + Intergenic
1125429632 15:39581688-39581710 TTGCTGAAATGAAGGACAACAGG - Intronic
1126361249 15:47848157-47848179 TTGCTTTTTTAAAGGACTAAGGG - Intergenic
1126821890 15:52512819-52512841 TTGCTATTTTTAAAGGCAACTGG - Intronic
1130675807 15:85951006-85951028 TTGCTATTTTCTAGGACCACAGG - Intergenic
1130701848 15:86191566-86191588 ATGCTGTTATCAAGAACAACTGG + Intronic
1131463618 15:92637380-92637402 TTGTAGTTTTTAAGGAGAGCTGG - Intronic
1132063814 15:98714088-98714110 TGGCTGTTTTTATTGACAAAAGG + Intronic
1133943035 16:10326321-10326343 TTGGGGTTTTTAAGGATAATTGG + Intergenic
1141121163 16:81358134-81358156 TAGCTGCTTTTAAGAACTACTGG + Intronic
1141214501 16:82011131-82011153 TTTTTGTTTTTAAGGACATCGGG - Intronic
1141952962 16:87350851-87350873 ATGCTGCTTTTCAGCACAACAGG - Intronic
1142633532 17:1241972-1241994 TTGCTGTTTTTGAGGATTCCAGG + Intergenic
1145769488 17:27482652-27482674 TTGCTGTTTTTAAGTGCCATAGG - Intronic
1148199118 17:45736796-45736818 TTTCTGTGTTGAAGGACAAGTGG + Intergenic
1150739064 17:67765044-67765066 TTGCTGGTGATGAGGACAACAGG - Intergenic
1150998311 17:70344790-70344812 TTTCTTTTTTTAAAGAAAACAGG - Intergenic
1153046314 18:858393-858415 TAGCTATTTTTAATGATAACTGG + Intergenic
1153132491 18:1871963-1871985 TTGCCATTTTTAAAGAGAACTGG - Intergenic
1153816804 18:8797908-8797930 TTGCTGCATTTAAAGACCACAGG - Intronic
1155379138 18:25199196-25199218 TTCCTCTTTTCAAAGACAACAGG - Intronic
1155391722 18:25345527-25345549 TTTTTGTTTTTAAGGCCAAGTGG + Intronic
1155600361 18:27538949-27538971 TTGGAGTGTTCAAGGACAACAGG - Intergenic
1155986982 18:32240072-32240094 CTGCTGTTTTTAAGACCAAATGG - Intronic
1156254188 18:35379240-35379262 TTGCTGGATTAAAGGACAGCAGG + Intergenic
1156363186 18:36402177-36402199 TTTCTGTTTTTAAAAACAAAAGG - Intronic
1157083053 18:44549077-44549099 TTCTTGTTTATAAGCACAACTGG + Intergenic
1157251069 18:46096657-46096679 TTGTTGTTTTTAAGTAAAATTGG - Intronic
1157564929 18:48673435-48673457 TTGTTGTTGTTAAAGAAAACAGG + Intronic
1158371251 18:56807047-56807069 TTGCTGTTATAAATAACAACAGG + Intronic
1158415185 18:57244075-57244097 TTGCTTGTTTAAAGGATAACAGG - Intergenic
1159010130 18:63051219-63051241 TTTCTGTTTTTAAAGGCTACTGG - Intergenic
1159696719 18:71567011-71567033 TTACTTATTTTAAGTACAACAGG - Intergenic
1159952275 18:74493691-74493713 CTGATGATTTTGAGGACAACAGG - Intergenic
1163323270 19:16586874-16586896 TTGTTGTTTTTAAAGTGAACCGG - Intronic
1163581032 19:18138862-18138884 CTGGTGTGTTTAAGGACCACGGG - Intronic
1164720258 19:30426689-30426711 TTCCTGATTTTAAGGACCCCAGG + Intronic
1167581708 19:50348205-50348227 TTGTTGTTTTTATGGGCAGCAGG + Intronic
1167818542 19:51905524-51905546 AGGCTGTTTTTAAGGCCTACTGG + Intronic
925214010 2:2076759-2076781 ATGCTTTTTGTAATGACAACTGG - Intronic
926173985 2:10572738-10572760 TTGCTGCTTTTAAGGAGAAGTGG - Intronic
930445611 2:51467917-51467939 TGGCTGTTTATAAGTACATCTGG - Intergenic
930866522 2:56127278-56127300 TTGCTATTTTTAAGGCTTACAGG + Intergenic
931355185 2:61531343-61531365 TTTTTGTTTGTAAGGACAATAGG - Intronic
931692743 2:64849165-64849187 TTGCTGTTTTTAAGCATATGTGG + Intergenic
934163618 2:89274596-89274618 TTGCTGTTTTTGTGGTCACCTGG + Intergenic
934203655 2:89907928-89907950 TTGCTGTTTTTGTGGTCACCTGG - Intergenic
934747078 2:96766379-96766401 TTGCTGTTCTTAAACACACCAGG + Intronic
935079455 2:99777921-99777943 TTGCTTTTTTTAAGTACCCCAGG - Intronic
935843011 2:107133943-107133965 TTCCTGTTCATAATGACAACAGG - Intergenic
936607397 2:113972292-113972314 TTAGTGCTTTTGAGGACAACAGG - Intergenic
936745043 2:115565654-115565676 TTGATATTTTTAAGGAGTACGGG + Intronic
936771862 2:115923204-115923226 TTGCTGTTTTCCAGGATCACAGG + Intergenic
937633815 2:124133285-124133307 TTGTTTTTTTTAAGGACCAAAGG - Intronic
943199750 2:184805207-184805229 TTTCTGCTTTTAAGAAAAACAGG + Intronic
943382121 2:187163629-187163651 TTGATCTTTTTAAAGACCACTGG + Intergenic
944204042 2:197138428-197138450 TTGCTGTTCTTAATCACATCTGG - Intronic
945266250 2:207894242-207894264 TTGCTGTTTTTGATGACTACAGG + Intronic
1168811673 20:708873-708895 TCGCTGTTTTTCAGGAGCACAGG - Intergenic
1169103966 20:2978344-2978366 TTGCTGTTTTTAGAGCCAATAGG + Intronic
1170695559 20:18654894-18654916 TTGATGCTTTTAAAGACAAAGGG - Intronic
1172545331 20:35756563-35756585 ATGGTGTCTTTAAGGACTACAGG + Intergenic
1174617600 20:51847950-51847972 GTGCTGTCTTTAAAGAGAACTGG - Intergenic
1174926184 20:54762721-54762743 TTGCTGTTTTTAGAGAGTACCGG + Intergenic
1177351433 21:19946942-19946964 TTTCTGTTTTCAAGGCCACCTGG - Intergenic
1178150530 21:29789097-29789119 TTGCTGATATTAAGGAGCACAGG - Intronic
1179199468 21:39203150-39203172 TAGCTGTTTTAAAGGAAAATAGG - Intronic
1184743873 22:46444903-46444925 TTCCTGTTATTAAAGACACCAGG + Intronic
950166886 3:10807787-10807809 TTGCTGGTTTTAGGGGCAACTGG + Intergenic
951189020 3:19747875-19747897 TTGCTTTTGTTAAGGTCACCAGG - Intergenic
951322757 3:21266926-21266948 TTGCTGTTTAAATGTACAACAGG - Intergenic
951602939 3:24396966-24396988 TTGCTATTCTTAAGCACAATTGG + Intronic
951974962 3:28495468-28495490 TTGCCTTTGTTAAGAACAACTGG - Intronic
952215612 3:31275154-31275176 GTGCTCTTTTTCAGTACAACAGG - Intergenic
953685257 3:45073062-45073084 TCTCTATCTTTAAGGACAACTGG - Intergenic
955472016 3:59295785-59295807 CAGGTGTTTTTCAGGACAACAGG - Intergenic
957767514 3:84645524-84645546 TTGCAGTGTTTAAGAACAAAAGG - Intergenic
962511912 3:136110116-136110138 TTGGGGTTTTTAATGAGAACAGG - Intronic
963284807 3:143423974-143423996 TTGATATTTTTAAGGATTACAGG - Intronic
965629422 3:170716439-170716461 TCCATGATTTTAAGGACAACGGG + Intronic
965792433 3:172404180-172404202 TTGTTGTTTTTATGGAGAAGTGG - Intergenic
966996104 3:185282310-185282332 TACCTGTGCTTAAGGACAACTGG - Intergenic
967424621 3:189312408-189312430 TTCCTGCTTTAAAGGACATCTGG + Intronic
967462991 3:189768157-189768179 TTGCTGTTTTTTTGCAAAACGGG + Intronic
968323018 3:197788270-197788292 TTACAATTTTTAAGGAAAACAGG - Intergenic
970019780 4:11555053-11555075 TTGCTGTTTTCCAGGAGCACGGG + Intergenic
970837021 4:20421458-20421480 TTGCTCCTTTTAATGTCAACAGG - Intronic
976557617 4:86467490-86467512 ATGCTGTTTTCCAGGATAACAGG - Intronic
977371741 4:96145658-96145680 TTTCTCTTCTTATGGACAACAGG - Intergenic
980919215 4:139065503-139065525 TTTCTGGTTTTAGGGAAAACAGG + Intronic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
982018368 4:151178223-151178245 TTGCTGTTTGTTAGGAAATCAGG - Intronic
982164204 4:152600406-152600428 TTGCTGTTTTTAACCAGAAGTGG + Intergenic
983604825 4:169571606-169571628 TTGGCATGTTTAAGGACAACAGG + Intronic
984034818 4:174651995-174652017 TTGATGTTTTTAAGGTCCAGGGG - Intronic
984468452 4:180131675-180131697 TTGGTGTTTTTAAATAAAACTGG - Intergenic
985802790 5:2016676-2016698 TGGATGTCTTTAAGGACATCTGG - Intergenic
985866561 5:2518797-2518819 TTGTTATGTTTATGGACAACAGG + Intergenic
986156093 5:5177402-5177424 TTTCTGTCTTCAAGGACAACGGG - Intronic
986521762 5:8627032-8627054 CTGCTGTGTTCAAGGACACCGGG + Intergenic
988211478 5:28210178-28210200 CTGTTGTTATGAAGGACAACGGG - Intergenic
989002194 5:36773124-36773146 TTTTTTTTTTTAAGGACAGCAGG - Intergenic
990205203 5:53421426-53421448 ATGTTGTTGTTAAAGACAACAGG - Intergenic
991100133 5:62783096-62783118 TTGCTGTTCTTAATGACCAGTGG + Intergenic
992317644 5:75574457-75574479 TTTCTATTTTTTATGACAACTGG + Intronic
992788343 5:80191085-80191107 TTTTTGTTTTTAAAGAAAACTGG - Intronic
993218302 5:85054961-85054983 TTTCTGTTTATAAGTACCACTGG + Intergenic
993467517 5:88267614-88267636 TTGCTGTTTTTCAAGATCACGGG - Intronic
993738863 5:91511525-91511547 TAGCTGTCTTCTAGGACAACTGG + Intergenic
993910959 5:93683576-93683598 TGGCCGTTCTTAAGGATAACTGG + Intronic
995767185 5:115631475-115631497 TTGGTGATATTTAGGACAACTGG - Intronic
996840408 5:127842047-127842069 TTGCTTTTTGTAAGGAAAATGGG + Intergenic
997817282 5:137031374-137031396 TTGCTGTTTTTGAAGTCCACTGG - Intronic
998258507 5:140609267-140609289 TTGAGGTTTCTAAGGACAACTGG + Intergenic
998309148 5:141109430-141109452 GTGCTGTTATTAAGGACAAGTGG + Intronic
998608245 5:143659251-143659273 TTGCTGGCTTAAAGGAAAACTGG - Intergenic
1001541504 5:172542928-172542950 TTGCTGTTTCTGAGGACCAGGGG + Intergenic
1001732170 5:173968683-173968705 TTGCAGTTTATAAGGACAAAGGG - Intergenic
1006179912 6:32148594-32148616 TTGCTTTTTTTAAGGACATTTGG - Exonic
1007468068 6:42069079-42069101 TTGCTGTTCTTCAATACAACAGG - Intronic
1008504646 6:52217980-52218002 TTTTTTTTTTTAAGGAAAACTGG - Intergenic
1008845157 6:55953910-55953932 TTGTTGTTTTTAATGATAAAAGG - Intergenic
1009039111 6:58156232-58156254 TTGCTGGTTTTATGGATCACGGG + Intergenic
1009054905 6:58322833-58322855 TTGCTGTTTATAATGATAGCGGG + Intergenic
1009236247 6:61127739-61127761 TTGCTGTTTATAATGATAGCGGG - Intergenic
1009540431 6:64949483-64949505 TTTGTTTTTTTAAGGACAACAGG + Intronic
1010261074 6:73817560-73817582 TTGCCATTTAAAAGGACAACAGG + Intronic
1010332793 6:74644543-74644565 TGCCTGTTTTTAAAAACAACAGG - Intergenic
1010988328 6:82451159-82451181 TTGCTTTTCTTAAGATCAACTGG - Intergenic
1012181071 6:96153340-96153362 TTTGTGATTTTAAGGACAAGAGG - Intronic
1015138785 6:129906424-129906446 TTGCTGGTTTAAAGGAGCACTGG + Intergenic
1015356877 6:132287703-132287725 TTGCTGCTTTTATGGATACCAGG + Intergenic
1015518360 6:134107366-134107388 TTGCTGCCTTTAAAGACAAAGGG - Intergenic
1015868125 6:137748403-137748425 TTGCTGTTTTGCATGACCACAGG - Intergenic
1018328221 6:162697998-162698020 TTGCTGTTTGTAAGGGAAACAGG - Intronic
1019951159 7:4373868-4373890 CTGGTGTTTGTAAGGACAACAGG + Intergenic
1021288419 7:18812678-18812700 TTGCTGTTTTTAATAACAATTGG + Intronic
1021772348 7:24018025-24018047 TTGCTATTTTTTAACACAACAGG + Intergenic
1022872328 7:34492490-34492512 TTTTTTTTTTTAAAGACAACTGG - Intergenic
1023550351 7:41363547-41363569 TGGCTGTTTATAAGGAAAATTGG - Intergenic
1025764474 7:64429741-64429763 TTGTTCTTTCTAAGGAGAACTGG + Intergenic
1028039515 7:86032085-86032107 TTGCCTCTTTTGAGGACAACTGG + Intergenic
1030502608 7:110378889-110378911 TTACTGTTTTTCATGAAAACTGG + Intergenic
1031582785 7:123497953-123497975 TTGCAGTTTTTAAAGTCACCTGG - Intronic
1033248078 7:139735584-139735606 TACCTGTTTTTCAGGTCAACAGG + Intronic
1033523526 7:142186590-142186612 GTCCTGCTTTTAAGGCCAACTGG - Intronic
1034738162 7:153448027-153448049 TTGCTATTTTTAATGAAAAACGG - Intergenic
1036745921 8:11409550-11409572 TTGCTTTTTCTATGGACAATCGG + Intronic
1038861287 8:31391671-31391693 CTGCTGGTGTCAAGGACAACAGG + Intergenic
1040678224 8:49777332-49777354 TTGCTGTTTTTCAAGAGCACAGG - Intergenic
1040870083 8:52091722-52091744 TTACTGTTTTTCAGGAGCACAGG - Intergenic
1042883775 8:73524487-73524509 TTGCTGTATTAAAGGGTAACAGG - Intronic
1043785610 8:84395642-84395664 TTGCTATTTTTAAGGAATATTGG - Intronic
1044830839 8:96246658-96246680 TTTCTGTTTTTAAGTATAAGTGG - Intronic
1045996816 8:108372727-108372749 TTGCTGTTTATAATCACAATTGG - Intronic
1047515799 8:125553876-125553898 TTGCTGCTTTAAAGGAAATCTGG + Intergenic
1047783780 8:128133929-128133951 TTCCTGATTTTAAAGACAAGAGG - Intergenic
1048860666 8:138722509-138722531 TTGCTTTTTTGAAGGACAAGAGG - Intronic
1052820251 9:33132805-33132827 TGGCTGTTTTCAAGGAAGACTGG - Intronic
1053178651 9:35948764-35948786 TTGATGTTTTTGAGGAATACAGG + Intergenic
1054929129 9:70618173-70618195 TTACTGTTTTTAAGGGAAATAGG - Intronic
1055831176 9:80380529-80380551 TGGCTGCTTCTCAGGACAACTGG + Intergenic
1055965771 9:81863676-81863698 TTGCTGTTTATAAAGACATTAGG - Intergenic
1056893527 9:90518588-90518610 TTGCTCTTCTTAAAAACAACTGG + Intergenic
1059566760 9:115390246-115390268 GTGTTTTTTTTAAGGAAAACAGG + Intronic
1060905379 9:127300141-127300163 TTGATGTTATTCAGGAAAACTGG - Intronic
1061509930 9:131054236-131054258 TTGCTCTTTTTGAGGACCTCTGG + Intronic
1185948986 X:4409572-4409594 TTGCTGTTTTTTAGTAAACCAGG - Intergenic
1187956983 X:24528876-24528898 TTGCTGTGTTTAATGACAAAGGG - Intronic
1190416112 X:50182033-50182055 TTGGGATTTTTTAGGACAACTGG + Intergenic
1191040097 X:56069370-56069392 TGGGTGTTTCTCAGGACAACAGG - Intergenic
1193659329 X:84237904-84237926 TTCCTGTTTCTATGGACAACCGG - Intergenic
1193862813 X:86691920-86691942 TTGCTAGTTTTAAGGGCAATGGG + Intronic
1195636307 X:107119455-107119477 TTGCTAGTTTTAAGGAGTACTGG - Intergenic
1195772896 X:108371271-108371293 TTGCTTTTTTAAAGGCCAAAGGG - Intronic
1198161875 X:134016145-134016167 ATGCTGTTTTGAAGGGCAAGTGG + Intergenic
1199990048 X:152982512-152982534 TTGCTGTTTTCAAGGATCACAGG + Intergenic
1201346052 Y:12985821-12985843 TTCTTCTTTTTAAGGAAAACTGG + Intergenic