ID: 1105505717

View in Genome Browser
Species Human (GRCh38)
Location 13:21008080-21008102
Sequence TCCCCACGGTGGAGCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 190}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105505717_1105505729 28 Left 1105505717 13:21008080-21008102 CCACTCTGGCTCCACCGTGGGGA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1105505729 13:21008131-21008153 GAGCTGACAGGCCAGTAGGATGG 0: 1
1: 0
2: 3
3: 23
4: 260
1105505717_1105505723 -3 Left 1105505717 13:21008080-21008102 CCACTCTGGCTCCACCGTGGGGA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1105505723 13:21008100-21008122 GGAGCCAGGTATGAGGGCAGAGG 0: 1
1: 0
2: 3
3: 50
4: 535
1105505717_1105505728 24 Left 1105505717 13:21008080-21008102 CCACTCTGGCTCCACCGTGGGGA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1105505728 13:21008127-21008149 CGAGGAGCTGACAGGCCAGTAGG 0: 1
1: 0
2: 3
3: 42
4: 308
1105505717_1105505722 -9 Left 1105505717 13:21008080-21008102 CCACTCTGGCTCCACCGTGGGGA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1105505722 13:21008094-21008116 CCGTGGGGAGCCAGGTATGAGGG 0: 1
1: 0
2: 1
3: 4
4: 140
1105505717_1105505724 0 Left 1105505717 13:21008080-21008102 CCACTCTGGCTCCACCGTGGGGA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1105505724 13:21008103-21008125 GCCAGGTATGAGGGCAGAGGTGG 0: 1
1: 0
2: 2
3: 51
4: 509
1105505717_1105505720 -10 Left 1105505717 13:21008080-21008102 CCACTCTGGCTCCACCGTGGGGA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1105505720 13:21008093-21008115 ACCGTGGGGAGCCAGGTATGAGG 0: 1
1: 0
2: 0
3: 9
4: 153
1105505717_1105505727 16 Left 1105505717 13:21008080-21008102 CCACTCTGGCTCCACCGTGGGGA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1105505727 13:21008119-21008141 GAGGTGGACGAGGAGCTGACAGG 0: 1
1: 0
2: 2
3: 23
4: 278
1105505717_1105505726 6 Left 1105505717 13:21008080-21008102 CCACTCTGGCTCCACCGTGGGGA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1105505726 13:21008109-21008131 TATGAGGGCAGAGGTGGACGAGG 0: 1
1: 0
2: 2
3: 24
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105505717 Original CRISPR TCCCCACGGTGGAGCCAGAG TGG (reversed) Intronic
900316539 1:2059988-2060010 TCCCAACAATGGAGCCAGTGTGG - Intronic
900613220 1:3553194-3553216 TCCTCAGGCTGGAGCCAGGGAGG - Intronic
901639210 1:10684929-10684951 TGCCCACGGGGGAGCCCAAGAGG + Intronic
903271566 1:22191803-22191825 TCCCCACTGCAGATCCAGAGAGG - Intergenic
903499028 1:23791710-23791732 TCCCCACGGTGGAGAAGGAAGGG + Intronic
904044093 1:27600003-27600025 TCCCCTCCCTGGAGCCAGAGAGG - Intronic
904083386 1:27886219-27886241 TCCCACCGGTGGATGCAGAGGGG + Exonic
904674113 1:32187752-32187774 TCCCTACGGTGGAGCCTTTGGGG + Intronic
904956962 1:34292653-34292675 TCTCCACATTGCAGCCAGAGAGG - Intergenic
905754698 1:40499107-40499129 TCCCAAACCTGGAGCCAGAGAGG + Intergenic
905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG + Intergenic
906649936 1:47505756-47505778 TCTCCTGGGTGGATCCAGAGGGG + Intergenic
908766826 1:67561821-67561843 ACCAGACGGTGGCGCCAGAGAGG + Intergenic
908999925 1:70205855-70205877 TCGCCACGGTGGAAGCACAGAGG - Intronic
912784773 1:112590484-112590506 TTCCCACGGTGGAGCAAAAATGG - Intronic
914253702 1:145943461-145943483 TCCCCACAGTGGAAACAAAGAGG + Intronic
914876033 1:151513180-151513202 ACACCACGGAGGAGGCAGAGGGG - Intronic
915571140 1:156745685-156745707 TCTCCACAATGCAGCCAGAGTGG + Intronic
916002888 1:160633570-160633592 TCCCCCCAGTGGATGCAGAGAGG + Intronic
920202202 1:204266459-204266481 GGGCCACAGTGGAGCCAGAGTGG - Intronic
1069560637 10:69426875-69426897 GGCCCACGTAGGAGCCAGAGTGG - Intergenic
1069741785 10:70689540-70689562 TCCCCACAATGGAGCCACACAGG - Intronic
1069967686 10:72134949-72134971 TTCTGACGGAGGAGCCAGAGAGG + Intronic
1070127173 10:73631876-73631898 TCTCCAAATTGGAGCCAGAGAGG + Exonic
1070717381 10:78732564-78732586 TCCACCCGGTGGTGGCAGAGAGG - Intergenic
1071059047 10:81548421-81548443 TTCCCCTGCTGGAGCCAGAGAGG + Intergenic
1072050282 10:91697576-91697598 TCCCCACTGTGCAGCTAGACTGG - Intergenic
1074780746 10:116800313-116800335 TCCCCATGATGGAGCCAGCCAGG - Intergenic
1075078380 10:119366738-119366760 TCCCCACCGTGGACCCCTAGAGG + Intronic
1075619425 10:123914907-123914929 TCTCCACGCAGCAGCCAGAGGGG + Intronic
1076592255 10:131591656-131591678 CTCACACGGTGGAGACAGAGAGG - Intergenic
1078441386 11:11371610-11371632 TCCCCACGGAGAAGACAGTGGGG + Intronic
1078722368 11:13896893-13896915 TCCCCACTGAAGAGCCAGAGAGG - Intergenic
1082009103 11:47438343-47438365 TCCCCAAAGAGGAGTCAGAGAGG - Intronic
1082802816 11:57426987-57427009 TCCCCGCAGAGGAGCCCGAGGGG + Intronic
1084411527 11:69008885-69008907 TCCCCTCCTTGGAGTCAGAGGGG + Intronic
1084556518 11:69879283-69879305 TCTCCACAGGGCAGCCAGAGTGG - Intergenic
1084592533 11:70098835-70098857 TCCCCATGGTGGATACACAGTGG - Intronic
1085816468 11:79742398-79742420 TCCCCTCTGTGAAGCCAGACTGG + Intergenic
1087212374 11:95457234-95457256 TCACCACGCTGGAGCCACAGCGG + Intergenic
1088004824 11:104927358-104927380 TCCCCCCGCTGGAGCCAGGGAGG + Intergenic
1089686167 11:120148107-120148129 TCCCCAGGGTGGAGGCAGGCAGG - Intronic
1090967469 11:131611470-131611492 TCCACACAGAGGAGCCGGAGAGG - Intronic
1091906080 12:4190081-4190103 TCCACACGGTGTATCAAGAGAGG - Intergenic
1092503426 12:9070544-9070566 TCGCCATGTTGGAGGCAGAGCGG + Exonic
1094059882 12:26302298-26302320 TCCCCACTGTAGAACCTGAGGGG - Intergenic
1101239699 12:102825385-102825407 TCCACAGGGTGGAGCAATAGAGG + Intergenic
1101250511 12:102929622-102929644 TCTCCACCTTGCAGCCAGAGTGG - Intronic
1102819861 12:115898872-115898894 GCCACATGATGGAGCCAGAGAGG + Intergenic
1104581800 12:130016293-130016315 TACCCACGGAGAAGCCAGGGAGG - Intergenic
1105481842 13:20785273-20785295 CCCCAACCATGGAGCCAGAGTGG + Intronic
1105505717 13:21008080-21008102 TCCCCACGGTGGAGCCAGAGTGG - Intronic
1111912629 13:94329148-94329170 TGCCCAAAATGGAGCCAGAGAGG + Intronic
1112562463 13:100526502-100526524 GCCACACGGGGGGGCCAGAGGGG + Intronic
1114375672 14:22144064-22144086 TACCCAGGGTGGACTCAGAGTGG + Intergenic
1115490119 14:33950779-33950801 TCCCCAGCGTGCAACCAGAGAGG + Exonic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1120340913 14:83220282-83220304 TCGCCACCGTGGCCCCAGAGAGG + Intergenic
1121013287 14:90534219-90534241 TGCCCACGCTGCAGCCAGATAGG - Exonic
1121348890 14:93157122-93157144 TCCACACTTTGGAGCCAGATGGG - Intergenic
1121521718 14:94590507-94590529 TCCTTAGGGTGGTGCCAGAGTGG + Intronic
1122096139 14:99374564-99374586 TCCTCACGGTGGAGACAGGGAGG - Intergenic
1124407909 15:29408142-29408164 TCTCCATGGTGGCTCCAGAGTGG + Intronic
1126416612 15:48424399-48424421 TCCCCACGGAGGATCCAGATTGG - Intronic
1129160244 15:73743343-73743365 CCCCCAGGTTGGAACCAGAGAGG - Intronic
1131155877 15:90075126-90075148 TCCCCACCATGAGGCCAGAGAGG - Intronic
1131436329 15:92425688-92425710 TGGGCACGGTGGGGCCAGAGCGG + Intronic
1132783536 16:1641885-1641907 TCCCCACTCTGGAGCCTGGGGGG + Intronic
1133050095 16:3112664-3112686 TCACCGGGGTGGAGGCAGAGGGG - Exonic
1134135391 16:11673636-11673658 TCCCCAGGGTGGGGACACAGTGG + Intronic
1134228183 16:12408332-12408354 GCACCACAGTGGACCCAGAGAGG - Intronic
1135002546 16:18789204-18789226 TCGCCAAGGTGGGGCCAGAAAGG - Intronic
1135733923 16:24915916-24915938 TCTCATCGGTGGAGCTAGAGAGG - Intergenic
1136297425 16:29311662-29311684 TCCACACGGAGGAGACAGGGTGG - Intergenic
1136560461 16:31036125-31036147 TCCTCACTGGGGACCCAGAGAGG - Intronic
1137714635 16:50591278-50591300 TGCCCACAGGGGAGCCACAGTGG - Intronic
1138100280 16:54246691-54246713 ACCCCAGGCTGGAGGCAGAGTGG + Intronic
1141133667 16:81451844-81451866 GCCCCATGGTGGAGGAAGAGAGG + Intronic
1141271804 16:82547655-82547677 TCCCCAAAGTGCAGCCAGGGTGG - Intergenic
1145252833 17:21305729-21305751 TGTCCACAGGGGAGCCAGAGCGG - Intronic
1145323742 17:21782187-21782209 TGTCCACAGGGGAGCCAGAGCGG + Intergenic
1149429786 17:56588560-56588582 TCCCCAGTGCGGAGCCAGATGGG + Intergenic
1150623391 17:66824701-66824723 TCCCCCCGGGGGGGCCACAGAGG + Intergenic
1151090818 17:71438402-71438424 TCCTCACGATGGATTCAGAGAGG - Intergenic
1151523078 17:74645045-74645067 TCGCCACTGTGCAGCCAGAATGG + Intergenic
1152320947 17:79608679-79608701 TCCCCAGGAGGGAGACAGAGCGG - Intergenic
1152529272 17:80907524-80907546 ACGCCACGCTGGACCCAGAGAGG - Intronic
1152590825 17:81211176-81211198 TCTCCACGCTGGGGCCACAGAGG + Intronic
1152693979 17:81734685-81734707 ACCCCACGCTGGAGACAGAGGGG + Intergenic
1153742008 18:8138878-8138900 TCCGCACGGAGCAGCCAGAGAGG - Intronic
1156291836 18:35754577-35754599 TCCCCAAGGTGGTTCCTGAGGGG + Intergenic
1160421924 18:78753807-78753829 TCCCCATCGTGGAGCTAGAGAGG - Intergenic
1160566052 18:79787381-79787403 TCTCCAAGGTGGAGCCACAGGGG + Intergenic
1160836001 19:1124690-1124712 TCCCCAGGGTGGGGCCGCAGTGG - Intronic
1161479075 19:4501714-4501736 TCCCCACGCTGGCGCCAGCCAGG - Intronic
1162402528 19:10454544-10454566 CCCCCAAGGAGGAGCTAGAGGGG - Intronic
1162790458 19:13060201-13060223 TCTCCAAGGAGCAGCCAGAGTGG - Intronic
1163654901 19:18539870-18539892 TCCCCACTCTGGTGGCAGAGTGG - Intronic
1165094622 19:33403376-33403398 AGCCCAGGGTGGAGCCAAAGAGG - Intronic
1165113977 19:33518052-33518074 GCCCCACGCTGGAGGCTGAGGGG - Intronic
1165771473 19:38383034-38383056 TCCTCACAGTTGACCCAGAGAGG + Intronic
1166081145 19:40444639-40444661 ACTCCACCGTGGAGCCAGAGGGG + Exonic
1166703665 19:44896487-44896509 TCCCCATGGAGATGCCAGAGTGG - Intronic
1167172053 19:47839775-47839797 GTCCCACGGAGGGGCCAGAGAGG - Exonic
1168246556 19:55115578-55115600 TGCTTACGATGGAGCCAGAGAGG - Intronic
1168270148 19:55245457-55245479 AACCCACGGTGGCGCCAGGGTGG + Intronic
927574318 2:24189102-24189124 TACCAGCGGAGGAGCCAGAGGGG - Intronic
929600871 2:43203884-43203906 TCCCCATGGTCGGGCCAGACAGG - Intergenic
932318394 2:70801794-70801816 TTCCCACAGTGGAGGCAGGGCGG + Intergenic
935333054 2:101991331-101991353 TCGCCACCGTGGAGTTAGAGAGG - Intergenic
937271720 2:120657074-120657096 TCCCCACAGTTTAGCAAGAGAGG + Intergenic
943611846 2:190044209-190044231 TCCCCAGCTTGGAGGCAGAGAGG + Intronic
949067494 2:242002089-242002111 TCCCAACGGTAGAGCCGCAGAGG - Intergenic
1169980587 20:11379816-11379838 TTCCCCTGCTGGAGCCAGAGAGG + Intergenic
1170132212 20:13032757-13032779 TCAGCAAGGTGCAGCCAGAGTGG - Intronic
1170620344 20:17990495-17990517 TCCCCAGGGTTCACCCAGAGGGG + Exonic
1170645117 20:18190953-18190975 TCCCCAAGGCTTAGCCAGAGCGG - Intergenic
1170773975 20:19359394-19359416 TCCCCACTGAGGAGCCATACTGG + Intronic
1172029806 20:31973878-31973900 TCCCCACCCAGCAGCCAGAGTGG - Intronic
1172591559 20:36121699-36121721 TCCCCACACTGAAGCCCGAGGGG + Intronic
1173248199 20:41350359-41350381 TTCCCACCGGGCAGCCAGAGAGG + Exonic
1173570864 20:44075181-44075203 TCCCCATGGAGGAGAAAGAGAGG - Intergenic
1175196191 20:57244829-57244851 TCCCCCCAGAGCAGCCAGAGAGG + Intronic
1175684946 20:61021994-61022016 TCCCCATGGTGAAGGCAGACTGG - Intergenic
1176290664 21:5042916-5042938 TCTTCACGGTGGAGGCAGAGAGG - Intergenic
1176662123 21:9646892-9646914 TCCCTATGATGGATCCAGAGTGG - Intergenic
1176857189 21:13982205-13982227 TGCCCACGGTGCAGGAAGAGGGG + Intergenic
1177532117 21:22373985-22374007 TAGCCATGCTGGAGCCAGAGTGG + Intergenic
1177815767 21:25974832-25974854 TCCCCACAGAGCAGCCAGACAGG - Intronic
1177956600 21:27606239-27606261 TGCCCATGCTGGAGCCAGGGAGG - Intergenic
1179595205 21:42438588-42438610 TGAGTACGGTGGAGCCAGAGGGG + Intronic
1179866591 21:44220725-44220747 TCTTCACGGTGGAGGCAGAGAGG + Intergenic
1180073324 21:45449534-45449556 CCCCCACGGTGGGGGCAGGGTGG - Intronic
1181744323 22:24945289-24945311 TCTCCACCCAGGAGCCAGAGTGG - Intronic
1182061665 22:27402744-27402766 TCCCCAAGCAGGAGCCAGTGAGG - Intergenic
1183107206 22:35622936-35622958 CACCCATGCTGGAGCCAGAGTGG - Intronic
1183301119 22:37059644-37059666 TCCCCAGGGTGCAGCCGGCGTGG + Intronic
1185285705 22:49999220-49999242 TCCTCATGGTGGAGTCAGACTGG + Intronic
1185346797 22:50313939-50313961 GCCCCACAGAGGAGCCAGGGTGG + Intronic
949412586 3:3782123-3782145 TCCCCAGGGTGGATTCATAGTGG - Intronic
951462260 3:22963855-22963877 CCCCCACTGTGGAGCCATATGGG - Intergenic
952904551 3:38131144-38131166 TCCCCACCTTGGAACCAGTGTGG - Intronic
956466503 3:69525347-69525369 TCCAGAGGGAGGAGCCAGAGTGG - Intronic
957040860 3:75334397-75334419 TCCCCATTTTGGAGGCAGAGTGG + Intergenic
960413723 3:117359026-117359048 TTCCCCTGCTGGAGCCAGAGGGG + Intergenic
961045652 3:123705978-123706000 TCCCCATTTTGGAGGCAGAGTGG + Intronic
961537206 3:127577357-127577379 TGCGCATGGTGGAGCCAGATGGG + Intronic
961863601 3:129937713-129937735 TCCCCACACAGTAGCCAGAGAGG + Intergenic
964007780 3:151852122-151852144 TTCCCCTGGTGGAGCCAGGGAGG - Intergenic
965496531 3:169405056-169405078 TCCCCTGGGAGAAGCCAGAGTGG - Intronic
968092461 3:195907776-195907798 TCCCCAGGGTGGGGCCACAGAGG + Intronic
968455979 4:700007-700029 CTCCCACGGAGCAGCCAGAGGGG + Intergenic
972661733 4:41122945-41122967 GCCCCCAGGTGGAGCCAGTGCGG - Intronic
977368397 4:96102187-96102209 TCCCCACTGTGGAGGGAGGGAGG + Intergenic
981023425 4:140052284-140052306 TCCACAAGGTGGAGCCACTGCGG + Intronic
982072935 4:151711249-151711271 TTCCCACAGAGCAGCCAGAGCGG + Intronic
984807419 4:183764406-183764428 TCACCATGTTGGAGCCAGTGAGG - Intergenic
985913303 5:2899198-2899220 TTCCCACCGTGGACCCAGATGGG + Intergenic
990203674 5:53406132-53406154 TCCTCATGGTGGAGAGAGAGAGG - Intergenic
995123085 5:108555921-108555943 TCCCCACTTGGCAGCCAGAGAGG - Intergenic
997293256 5:132752971-132752993 GCCCCGGGGTGGAGGCAGAGGGG - Exonic
997975674 5:138440160-138440182 CCCCAACGGTGGAGGCCGAGGGG - Intronic
1001666135 5:173435144-173435166 GCCCTACAGTAGAGCCAGAGGGG + Intergenic
1003629914 6:7777471-7777493 TCCCCATACTGGAGCCAGAGGGG - Intronic
1003989963 6:11476490-11476512 TTCCCACGCAGCAGCCAGAGAGG - Intergenic
1008741556 6:54615072-54615094 TCCCAATGCTGGAGCCAGGGAGG + Intergenic
1010176207 6:73031006-73031028 ACTTCAGGGTGGAGCCAGAGTGG - Intronic
1010177220 6:73043117-73043139 TCCCTATGGTGGGGGCAGAGTGG + Intronic
1010941346 6:81921466-81921488 CCACCAGGGTGGAGTCAGAGAGG + Intergenic
1014048115 6:116917655-116917677 TCCTCATGGTGGACCCAGAGAGG + Intronic
1015358179 6:132305168-132305190 TTCCCCTGCTGGAGCCAGAGAGG + Intronic
1016809685 6:148247845-148247867 TTCCCAGGGAGGGGCCAGAGTGG - Intergenic
1019597568 7:1865248-1865270 TCCCCAAGGAGGAGCCACTGTGG - Intronic
1020525247 7:9251120-9251142 TTCCCCTGCTGGAGCCAGAGAGG + Intergenic
1021940911 7:25678253-25678275 GCCCCCCAGTGGAGCCACAGTGG - Intergenic
1022328118 7:29351757-29351779 TGTCTACGGTGGAGTCAGAGAGG + Intronic
1022380140 7:29851824-29851846 TCCCCACTGTGGGGCCTGAAGGG - Intronic
1023509638 7:40937869-40937891 TCCACAGGCAGGAGCCAGAGGGG + Intergenic
1023995283 7:45155935-45155957 TCCCCACTGCAGAGCCAGGGTGG + Intergenic
1024926219 7:54618403-54618425 TCCCCAAGGTGGAGCCTGGTGGG - Intergenic
1034212450 7:149375898-149375920 TCCACACTCTGGAGACAGAGTGG - Intergenic
1039469590 8:37804976-37804998 TACCCGAGGTGGTGCCAGAGAGG - Intronic
1039469820 8:37806435-37806457 TACCCGAGGTGGTGCCAGAGAGG - Intronic
1039806290 8:41002440-41002462 TCCCCACAGTGGAGTCAGATGGG - Intergenic
1043993857 8:86788661-86788683 TCCCCACCCTGCAGCCAGGGAGG - Intergenic
1044797971 8:95923333-95923355 TCCCCACGAAGCAGCCAGGGTGG + Intergenic
1048201035 8:132374018-132374040 ACCCCACAGGGCAGCCAGAGGGG + Intronic
1049595526 8:143481591-143481613 GCCACACGGTGGAGCCGGCGAGG + Intronic
1050618318 9:7426406-7426428 TTCCCCTGCTGGAGCCAGAGAGG - Intergenic
1053076396 9:35138317-35138339 TGCACACTGTGGAGCCACAGTGG + Intergenic
1057781506 9:98054587-98054609 ACCCCATGGTGGAGCTACAGAGG + Intergenic
1059395736 9:114032953-114032975 TCTCCATGGGGGAGACAGAGAGG - Intronic
1059554551 9:115266276-115266298 TCCCCAGGCTGTAGCCAGAATGG - Intronic
1059964536 9:119600877-119600899 TCTCCACCATGCAGCCAGAGGGG - Intergenic
1060758597 9:126230060-126230082 TCTCCACTCTGCAGCCAGAGTGG - Intergenic
1061888602 9:133605939-133605961 TCCCCATGGTGCAGCCAGAGAGG + Intergenic
1062341159 9:136094608-136094630 TCCCCAGGCTGGGGCCCGAGTGG + Intronic
1203639686 Un_KI270750v1:148735-148757 TCCCTATGATGGATCCAGAGTGG - Intergenic
1185846295 X:3441059-3441081 TCCCCCTGTTGGAGCCAGGGAGG - Intergenic
1186260072 X:7768106-7768128 TCCCCAGGGTGGAGGGAGTGGGG + Intergenic
1186448864 X:9655399-9655421 TCCCCACGGTAAAGACAGATTGG + Intronic
1189487099 X:41442420-41442442 TCCCCAGGGTGGGGCCGGGGTGG + Intergenic
1190745063 X:53317645-53317667 TCCCCCTGGTGGAGGAAGAGGGG - Intronic
1192224964 X:69221717-69221739 TCCCCACGTGGGAGCCAGGTGGG - Intergenic
1192930268 X:75799327-75799349 TTCCCCTGCTGGAGCCAGAGAGG - Intergenic
1195147162 X:102029324-102029346 TTCCCCTGCTGGAGCCAGAGAGG + Intergenic
1195617034 X:106920634-106920656 ACCCCATGGTGGAGCCAGGCTGG + Intronic
1197192739 X:123666406-123666428 GCCCCACTGTGGAGTCACAGGGG + Intronic
1200100459 X:153687400-153687422 TGCCCACTGTGGAGACACAGAGG + Intronic