ID: 1105512447

View in Genome Browser
Species Human (GRCh38)
Location 13:21061650-21061672
Sequence CGGAGCGGCCGCGGAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105512447_1105512451 -8 Left 1105512447 13:21061650-21061672 CCTGCTCCTCCGCGGCCGCTCCG 0: 1
1: 0
2: 1
3: 44
4: 344
Right 1105512451 13:21061665-21061687 CCGCTCCGCCCAGCCCCGCCCGG 0: 1
1: 2
2: 20
3: 96
4: 728
1105512447_1105512460 11 Left 1105512447 13:21061650-21061672 CCTGCTCCTCCGCGGCCGCTCCG 0: 1
1: 0
2: 1
3: 44
4: 344
Right 1105512460 13:21061684-21061706 CCGGCCGTGCTTCCTGCCTCCGG 0: 1
1: 0
2: 0
3: 21
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105512447 Original CRISPR CGGAGCGGCCGCGGAGGAGC AGG (reversed) Intergenic
900201254 1:1407606-1407628 CGGCGCGGGCGGGGAGGGGCAGG + Intergenic
900349601 1:2228316-2228338 CCGAGGGGCCCGGGAGGAGCGGG - Intergenic
900516693 1:3085559-3085581 CAGAGAGGCCCAGGAGGAGCCGG - Intronic
900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG + Exonic
900928197 1:5719231-5719253 CGCAGCGGTCCCTGAGGAGCCGG + Intergenic
901295069 1:8154891-8154913 CTTAGCTGCCGCGGAGGCGCCGG - Intergenic
901472466 1:9467233-9467255 GGGAGCTGGCGTGGAGGAGCTGG - Intergenic
904467799 1:30718528-30718550 GGGCGGGGCCGGGGAGGAGCCGG - Intronic
905151572 1:35931579-35931601 CGGGGAGGTCGCGGAGGAGCAGG - Intronic
907440401 1:54475016-54475038 CTGGGAGGCGGCGGAGGAGCCGG - Intergenic
908131816 1:61082302-61082324 GCGAGCGGCCGCGGAGGCTCGGG + Intronic
912619517 1:111140562-111140584 CGGAGCGCCGGCGCGGGAGCCGG + Intronic
913044439 1:115062026-115062048 CAGAGAGTCCACGGAGGAGCTGG + Intronic
914197399 1:145454590-145454612 CGGAGCAGCCACGGAGCCGCCGG + Intergenic
914720121 1:150282563-150282585 CGGAGAGACGGCGAAGGAGCTGG + Intronic
916426988 1:164690131-164690153 AGGGGAGGCCGAGGAGGAGCCGG - Intronic
916588019 1:166165524-166165546 CGGAGCGGGCTTGGAAGAGCAGG - Intronic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
919463239 1:197902935-197902957 CGGGGCGGCCGCGGCGGGGCGGG - Intronic
920352170 1:205344308-205344330 CGGAGCCGCCGCCGGGGAGGAGG + Exonic
920655198 1:207869135-207869157 GGAAGCGGCCGCCGCGGAGCCGG - Intergenic
921138738 1:212285682-212285704 GGCAGCGGCCGCTGAGGTGCTGG + Exonic
922116377 1:222618046-222618068 CGGGGCGGGCGCAGAGGGGCGGG - Intergenic
922250719 1:223846271-223846293 CGGAGCCGCCGAGGAGGTGACGG - Intergenic
922295375 1:224245483-224245505 CAGAGCTGCCCAGGAGGAGCAGG - Intronic
922315064 1:224434634-224434656 CGGGGCGGCTGCGGGGGCGCGGG + Intronic
922753522 1:228082117-228082139 CGGAGCAGACGCCGGGGAGCTGG - Intergenic
924052374 1:240092079-240092101 CGGCGCGGCGGCGCAGCAGCGGG + Exonic
1064028861 10:11870165-11870187 CCCAGCGGGCGCGAAGGAGCTGG - Exonic
1066491494 10:35899215-35899237 CAGAGTGGCAGCGGATGAGCAGG + Intergenic
1068767451 10:60778914-60778936 CTGAGCGCCTGCGGAGTAGCAGG + Intronic
1069651633 10:70053521-70053543 TGGAGGGGGCGCGGAGCAGCCGG + Intronic
1069818276 10:71212417-71212439 GGGCGCGGCCGCGGCAGAGCTGG - Intergenic
1071618175 10:87094977-87094999 CGGGGAGGCCGCGGCGGAGGCGG - Intronic
1071695296 10:87863518-87863540 CGGCGCGGCGGCGGAGGGGGCGG + Exonic
1072336493 10:94402835-94402857 CGCGGCGGCCGGGGAGCAGCTGG + Exonic
1072503729 10:96043862-96043884 CGGGGCTCCCGGGGAGGAGCAGG + Intronic
1072562235 10:96586905-96586927 CGAATCGGCCGCGGCGGAGGCGG - Exonic
1073340922 10:102744019-102744041 CGGCGCCGTGGCGGAGGAGCAGG + Exonic
1075031828 10:119029399-119029421 CGGAGCGGCGCCCGAGGCGCCGG + Intergenic
1076374189 10:129972701-129972723 CGGGGCTGCGGCGGAGGCGCGGG - Intergenic
1076554345 10:131311922-131311944 CCGGGCGGCCGCGGAGGACGTGG + Intergenic
1077299533 11:1840660-1840682 CGGGGTGGCCGGGGAGGGGCTGG - Intronic
1077889792 11:6410864-6410886 CGGGGAGGCCGAGGAGGAGGAGG - Exonic
1080802010 11:35618332-35618354 GGGAGCGGAGGCGGAGGAGGGGG + Intergenic
1083430683 11:62612475-62612497 CCGAGCGGCGGCGGCGGAGGAGG + Exonic
1083995225 11:66268452-66268474 GGGAGTGGGCGCGGAGGCGCGGG + Intergenic
1084295677 11:68212638-68212660 CGCAGCGGCCGCGGGGTCGCCGG + Intronic
1084501958 11:69540288-69540310 CGGAGCTGCCCAGGAGGAGCCGG - Intergenic
1085037474 11:73308843-73308865 CGGAGCGGGCGCGGCTGCGCGGG - Exonic
1087117838 11:94543960-94543982 AGCAGCTGCCGCGCAGGAGCAGG - Exonic
1090788273 11:130069281-130069303 CGGAGAGGCCTGGGCGGAGCAGG + Intergenic
1091286572 11:134411774-134411796 CGGGGCGCCCGCGGGGGCGCGGG + Intronic
1092385368 12:8032688-8032710 CGCGGAGGCCGGGGAGGAGCCGG + Exonic
1092743166 12:11649554-11649576 AGGGGCGGCCGCGGGGGCGCGGG - Intergenic
1093958853 12:25251116-25251138 CGGGCCGGCGGGGGAGGAGCGGG + Intergenic
1094564761 12:31590206-31590228 GGTAGCGTCCGCGGAGGAGCCGG - Intronic
1096116925 12:49060332-49060354 TGGAGCGGCCGGAGGGGAGCGGG - Intergenic
1096127661 12:49131424-49131446 AGTAGCGGCTGCGGAGGGGCGGG + Intergenic
1096647611 12:53047260-53047282 CCGAGCGGACGCGGAGGAGGAGG - Intronic
1096788916 12:54033346-54033368 CGGAGCGGCCGCGGCGCTGCAGG - Exonic
1097267543 12:57755032-57755054 CGGGGCGGGCGCCGGGGAGCGGG - Intronic
1097891409 12:64780954-64780976 CGGAGCGGCCGCGGCGCTCCCGG + Intergenic
1098975658 12:76899404-76899426 GGGAGCGGGCTGGGAGGAGCAGG - Intergenic
1099989876 12:89709737-89709759 GGGAGCGGCGGGGGAGGAGGGGG + Intergenic
1100611402 12:96194357-96194379 CGGGGCGGCGGGGGAGGCGCGGG + Intergenic
1101371862 12:104137964-104137986 GGGAGCGGCCTCGCAGGCGCGGG + Intronic
1102084365 12:110124222-110124244 CGGAGCGGACGGGGCGGGGCGGG - Intergenic
1103096417 12:118136299-118136321 CGGGGCGGCGGTGGACGAGCTGG + Exonic
1103363937 12:120369117-120369139 CGGAGCGGCGGCGGCGGCGGCGG + Exonic
1103856556 12:123973836-123973858 CCGGGCGGCTGCGGAGGAGCCGG + Exonic
1103930062 12:124445315-124445337 CGGGGCAGCCGCAGAGGGGCAGG - Intronic
1104787723 12:131460316-131460338 TGGAGAGGGCGGGGAGGAGCAGG - Intergenic
1105203097 13:18195456-18195478 GGGAGCGGCCGGGAAGGAGTAGG - Intergenic
1105512447 13:21061650-21061672 CGGAGCGGCCGCGGAGGAGCAGG - Intergenic
1105578629 13:21674460-21674482 CGGAGCGGAGGCGGGGGCGCGGG - Intronic
1106022337 13:25927202-25927224 TGGAGCAGCCGAGGAGGAGTGGG - Intronic
1106340218 13:28820172-28820194 AGCCGCGGCCGCGGCGGAGCCGG + Intergenic
1107770969 13:43787138-43787160 CGGGGCGGCAGCAGAGGAGGAGG + Intergenic
1107935291 13:45341124-45341146 CGGAGCGAGCGCGGTGCAGCCGG + Exonic
1109506198 13:63306065-63306087 GGGACCGGGCGCGGTGGAGCAGG - Intergenic
1112088209 13:96053535-96053557 CGGAGCCGCCGGGGCGGCGCCGG + Intergenic
1113085619 13:106567412-106567434 CGGAGAGGCGGCGGCGGGGCGGG - Intronic
1113779757 13:112969278-112969300 CGGAGGGGGCGCGGCGGAGGCGG - Exonic
1113847728 13:113402169-113402191 CTGAGTGGCCCCGGAGCAGCTGG - Intergenic
1115028232 14:28766821-28766843 CGGAGCGGCCGCGGCGAGGCTGG - Intergenic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1116657949 14:47674897-47674919 CGCAGACGCCGGGGAGGAGCAGG + Exonic
1117842164 14:59870841-59870863 GGCAGCGGCCGCGGCGGGGCCGG - Exonic
1118285271 14:64465403-64465425 CGGAGCGGGCGGGCAGGGGCGGG - Intronic
1118351001 14:64972368-64972390 CGGGGCGGCGGCGGCGGCGCAGG - Intronic
1119261011 14:73237991-73238013 CGGGGTGGCCGCGCAGGTGCCGG - Intronic
1119519698 14:75277100-75277122 GGGAGCGGCCGCGGCCGGGCCGG + Intergenic
1120765455 14:88323595-88323617 CGGGGAAGCCGCGGAGGGGCGGG + Intronic
1122264153 14:100538937-100538959 CAGCGCGGCCGAGGAGGAGGAGG - Exonic
1122628610 14:103097328-103097350 GGGAGCGGCAGCATAGGAGCCGG + Intergenic
1122658472 14:103278998-103279020 CGGAGCCGGGGCGGAGGAGGCGG - Intergenic
1122920700 14:104878785-104878807 GGGAGGGGCCTGGGAGGAGCCGG + Intronic
1123106967 14:105846184-105846206 CTGAGTGGCTCCGGAGGAGCTGG + Intergenic
1123427911 15:20187788-20187810 CTGAGAGGCCTCGGAGGAGCTGG - Intergenic
1124957224 15:34367313-34367335 CGCGGCGGGCGCGGAGGAGCAGG - Intergenic
1125698516 15:41660034-41660056 GGGCGCGGCCGGGGCGGAGCCGG + Intronic
1126467688 15:48975924-48975946 CGGGGCGGCCGCGGAGCTGGCGG - Intergenic
1128154711 15:65385193-65385215 GGGATGGGCCGCGGGGGAGCAGG + Intronic
1128454950 15:67827104-67827126 GGGAGCGGCGGCGGCGGCGCGGG + Intronic
1129742124 15:77994369-77994391 CAGAGCGGCGGCGGCAGAGCTGG - Intronic
1129843362 15:78757111-78757133 CAGAGCGGCGGCGGCAGAGCTGG + Intergenic
1130305352 15:82709480-82709502 CGGCGCGGCCGGGGCGGGGCCGG + Intronic
1131119620 15:89814396-89814418 CAGAGTGGCCGCGGCCGAGCCGG + Intronic
1132209149 15:100007675-100007697 AGGAGCACCCGGGGAGGAGCTGG + Intronic
1132512787 16:352569-352591 CGGAGCGGGCGGGTGGGAGCTGG - Exonic
1132585789 16:705344-705366 CCCAGCGGCCGCGGGGGAGGTGG + Intronic
1132591525 16:728298-728320 CCGAACTGCGGCGGAGGAGCAGG - Exonic
1132613419 16:828833-828855 CCCAGCGGCCCCGGAGCAGCAGG - Intergenic
1132653145 16:1030625-1030647 CGCAGCGGCCGCCAGGGAGCGGG - Intergenic
1132815909 16:1826522-1826544 CGGAGCGGGCGCGGGGCCGCGGG - Intronic
1135304054 16:21353951-21353973 CGGAGGGGCCACGGAAGAGGCGG - Intergenic
1135517672 16:23149164-23149186 CGGAGCGGCCGCGCTGGCGGCGG - Exonic
1136300788 16:29333088-29333110 CGGAGGGGCCACGGAAGAGGCGG - Intergenic
1136856385 16:33661973-33661995 CTGAGAGGCCTCTGAGGAGCTGG + Intergenic
1137454715 16:48609693-48609715 CGGCGGGGGCGGGGAGGAGCGGG + Intronic
1139451095 16:67028900-67028922 CCGAGTGGCCGCGGGCGAGCAGG + Intergenic
1139778204 16:69330318-69330340 CGTGGCGGCCCCGGTGGAGCGGG - Exonic
1140096928 16:71883721-71883743 AGGAGCGGCCGGGGAGGAATTGG + Intronic
1140354881 16:74297057-74297079 CGCGGCGGCCGCGGACGAGCTGG + Intronic
1140927764 16:79599916-79599938 CGGAGCGGCGGCGGCGGCGGCGG - Exonic
1141480403 16:84302552-84302574 GGGAGAGGCCTCGGAGGAGATGG - Intronic
1142136282 16:88453352-88453374 CCGAGCGGCCGCGGCGGCGGCGG + Exonic
1203117968 16_KI270728v1_random:1510450-1510472 CTGAGAGGCCTCTGAGGAGCTGG + Intergenic
1142863322 17:2776543-2776565 CGGAGAGGGGGCGGAGGGGCGGG - Intergenic
1142958324 17:3535717-3535739 CGGAGCGGGCGGGGACGCGCGGG + Intronic
1142972616 17:3623096-3623118 CTGGGCGGCTGTGGAGGAGCAGG + Intronic
1143099877 17:4499109-4499131 CGGAGCGGCGGCGCCGGCGCCGG + Exonic
1143763428 17:9121295-9121317 GGGAGCGGCCGGGGACGTGCTGG - Intronic
1143830302 17:9645680-9645702 GGGAGCGGCGGCGGCGGGGCCGG - Exonic
1144339741 17:14301673-14301695 CGGCGCGGCGGCGCAGGAGCCGG - Exonic
1145291742 17:21551737-21551759 CGGAGGGGACGAGGCGGAGCCGG + Intronic
1145814171 17:27783578-27783600 CGGAGCTGCCACGGAGGGACTGG - Intronic
1145828165 17:27893065-27893087 CCGGGCGGCCTCGGAGGAGCAGG - Intronic
1146332333 17:31937413-31937435 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1147123979 17:38352818-38352840 CGGAGGGGCCCGGGAGGAGGCGG - Exonic
1147805406 17:43127154-43127176 GGGACCGGGCGCTGAGGAGCAGG - Intergenic
1148206678 17:45784113-45784135 CGGAGGAGGCGAGGAGGAGCTGG + Intergenic
1148437165 17:47693964-47693986 CGGAGCAGCCGGGGAGGAGGAGG + Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148852429 17:50561477-50561499 TGGAGCGGGCGCCGAGGAGTCGG + Exonic
1149490888 17:57084828-57084850 CGGAGGGGCCGGTGAGGAGCAGG - Intergenic
1152111577 17:78360038-78360060 CGAAGCGGCAGCAGCGGAGCAGG + Exonic
1152362488 17:79839129-79839151 CGGAGCGGCCCGCGAGGAGGCGG - Intronic
1152697497 17:81804314-81804336 CGGGGCGGGCGCGGCGGGGCCGG + Intronic
1152699344 17:81811348-81811370 CGGGGCGGCCGCAGAGGACAGGG + Intronic
1152782501 17:82232441-82232463 TGGAGAGGTCCCGGAGGAGCGGG + Intronic
1152885482 17:82846694-82846716 CGGAGCAGCAGCCCAGGAGCGGG + Intronic
1153900605 18:9614495-9614517 CCGGGCGGCCGCGGAGGAGGGGG - Exonic
1154202269 18:12308027-12308049 CGGAGCTGGCGGGGAGGAGACGG - Intronic
1154356074 18:13624131-13624153 CGGTGCTGAGGCGGAGGAGCCGG + Intronic
1155392740 18:25352361-25352383 AGGGGCGGCGGCGCAGGAGCGGG - Intergenic
1155519855 18:26656931-26656953 CGGAGCGGCCGCGGGGAGGCTGG + Intronic
1156213840 18:34976944-34976966 CGGAGCGGCGGCGGCGGCGGCGG + Intronic
1156275780 18:35581677-35581699 GGGGGCGGGCGCGGCGGAGCGGG + Intronic
1157473773 18:48008570-48008592 CGGGCCGGCGGCGGAGGAGGAGG - Intergenic
1157763463 18:50281458-50281480 GGAGGCGGCCGCGGAGGAGGAGG - Exonic
1158695200 18:59697395-59697417 GGCGGCGGCCGCGGAGGAGCAGG - Intergenic
1159045753 18:63367262-63367284 CGGAGGGGAAGAGGAGGAGCCGG + Exonic
1159578192 18:70205523-70205545 GGGAGCGGTCGCGGAGCGGCCGG + Intronic
1160521791 18:79512093-79512115 CAGAGAGGCCCAGGAGGAGCCGG + Intronic
1160750825 19:733613-733635 TGGAGGGGGCACGGAGGAGCCGG + Intronic
1160792558 19:929398-929420 CGTGGGGGCCGCGGGGGAGCCGG - Exonic
1160810035 19:1009308-1009330 CGAAGCGGACGCGGAGGCGGAGG + Exonic
1160867422 19:1262049-1262071 TGGAGCGGCCTGGGAAGAGCTGG + Intronic
1160933194 19:1580408-1580430 CGGAACGGCCAGGGAGGCGCTGG - Intronic
1161207201 19:3047269-3047291 CGGGGCGGCCGCGGCGGGGAGGG + Intronic
1161450669 19:4343733-4343755 CGGTGCGGGCGAGGAGGCGCCGG + Exonic
1161988479 19:7670397-7670419 CGGAGGGGTTGCGGGGGAGCTGG + Exonic
1162118199 19:8445013-8445035 CGAAGCGGCGGCGGAGGTGGCGG + Exonic
1162486041 19:10961126-10961148 CGGAGGGGCGGGGGAGGCGCCGG + Exonic
1164476222 19:28577897-28577919 CGGAGCGGAAGGGGAGGAGTGGG + Intergenic
1164639104 19:29811885-29811907 CCGCGCGGCCGCTGAGGGGCTGG + Exonic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1164726618 19:30469693-30469715 CTGAGCGTCCCCAGAGGAGCAGG - Intronic
1164835581 19:31353139-31353161 AGAAGCGGCCGCGGCGGCGCGGG + Intergenic
1165137252 19:33677483-33677505 GAGACCGGCCGTGGAGGAGCAGG + Intronic
1166688182 19:44808443-44808465 CGAAGCGGCCTAGGAGGACCTGG + Intergenic
1166752468 19:45170859-45170881 GGGAGGGGCCGAGGAGGAGCAGG + Intronic
1167149129 19:47698905-47698927 GGGGGCGGCCGCGGATGCGCAGG - Intronic
1167622691 19:50568131-50568153 CGCAGCGGCGGCGGTGGGGCTGG + Intergenic
1167843417 19:52140106-52140128 CGGAGCCGCGGCGGAGGATGGGG + Intergenic
1168153591 19:54461506-54461528 CGGTGTGGCGGCGGAGGATCTGG - Exonic
925607492 2:5673553-5673575 CCGCGCGGCCGTGGAGGGGCAGG - Intergenic
925709688 2:6726820-6726842 AGGAGGGGTGGCGGAGGAGCAGG + Intergenic
926089993 2:10043517-10043539 CGGGGCGGCCGCGGAGGGAGCGG - Intronic
927938127 2:27086679-27086701 CGCCTCCGCCGCGGAGGAGCAGG - Intergenic
929501209 2:42493372-42493394 CGGAGCGGCAGCCGTGCAGCCGG + Exonic
929778503 2:44942985-44943007 CGGAGCGGCCGCTGAGAGCCAGG + Intronic
929936768 2:46298829-46298851 CTGCGCGGCCGCGCAGAAGCAGG + Intronic
930700737 2:54456455-54456477 CCGCCCGGCCGCCGAGGAGCGGG + Exonic
930872771 2:56184692-56184714 GGGCGGGGCCGCGGACGAGCCGG - Exonic
935746599 2:106194423-106194445 CGGAGGGGCGGGGGCGGAGCCGG - Intergenic
937217774 2:120323580-120323602 AGGAGAGGCCGTGGAGGAGGAGG - Intergenic
938100161 2:128493062-128493084 CGGTGCGCCCGCGGAGGGGGCGG - Intergenic
940962227 2:159798227-159798249 CTGCGCGGCCGGAGAGGAGCGGG + Exonic
941462991 2:165793738-165793760 TGGGGCGGCCCCTGAGGAGCTGG - Intronic
941686837 2:168456295-168456317 AGCAGCGGCCGCGGAGGAGGCGG + Exonic
943060503 2:183037957-183037979 CGGGGAGGCCGCGGCGGAGGCGG - Intronic
944060129 2:195563258-195563280 CGGAGGGGCCGGGGAGGTGTGGG - Intergenic
944743670 2:202635353-202635375 CGGAGCGGCGGCGGCGGCGGCGG + Exonic
946354959 2:219178633-219178655 GGTAACGGCCGCGGAGGAGGGGG + Exonic
947658805 2:231851248-231851270 CGGTGCTGCAGCGGAGGAGATGG + Intergenic
947741725 2:232487824-232487846 CGGCGCGGCGGCAGAGGAGGCGG - Exonic
948725162 2:239929940-239929962 AGCAGGGGCAGCGGAGGAGCAGG - Intronic
948725187 2:239930042-239930064 AGCAGGGGCAGCGGAGGAGCAGG - Intronic
948725212 2:239930144-239930166 AGCAGGGGCAGCGGAGGAGCAGG - Intronic
949019666 2:241734262-241734284 GGGCTCGGCCTCGGAGGAGCGGG + Intergenic
949027829 2:241774633-241774655 GGGAGCAGCCGGGGAGCAGCCGG - Intergenic
949027839 2:241774664-241774686 GGGAGCAGCCGGGGAGCAGCCGG - Intergenic
949027843 2:241774675-241774697 GGGAGCAGCCGGGGAGCAGCCGG - Intergenic
1169048719 20:2558816-2558838 GGGAAGGGCCGCGAAGGAGCGGG - Intronic
1169214726 20:3786509-3786531 CGGGGCGGCGGCGGCGGCGCCGG - Exonic
1170889509 20:20366670-20366692 CGGAACGGCAGCGGAGGTGGGGG + Intergenic
1170912013 20:20582071-20582093 CGGGGAGGCCATGGAGGAGCTGG - Intronic
1171372702 20:24671908-24671930 CGGAAGGGCTGCTGAGGAGCTGG + Intergenic
1172117982 20:32583316-32583338 CCGGGCGGCCGCGGAGGGGGAGG + Intronic
1172764942 20:37346266-37346288 CGGGGGGTCCGCGGAGGGGCGGG - Intronic
1172890506 20:38260658-38260680 AGGAGCGGCCGGGGAGGACAGGG + Exonic
1172951216 20:38724499-38724521 CGGAGCGGCGGCGGCGGCGGTGG - Exonic
1173993258 20:47319041-47319063 GGGAGAGGCCGCTGAGGATCCGG - Intronic
1174246877 20:49188229-49188251 CGGAGTGGCCGTGGAGGAGGCGG + Exonic
1174645871 20:52084965-52084987 CAGGGCGGCCGCGCTGGAGCAGG + Intronic
1174804482 20:53593844-53593866 AGGAGCGGGCGCGGAGGGGAGGG + Intronic
1175429376 20:58891245-58891267 AGGAGCGGCCGCGGCGGCGGCGG - Intronic
1176123800 20:63466198-63466220 GGGACCGGCCGCGGAGATGCCGG - Intronic
1176714863 21:10342549-10342571 GGGAGCGGCCGGGAAGGAGTAGG + Intergenic
1177788237 21:25695504-25695526 CGGGGCGGCCGCGGGGCAGAGGG + Intronic
1178707747 21:34889175-34889197 CTGGGCGGCCGCGCAGGATCTGG - Intronic
1180560385 22:16610246-16610268 AGGAGCGGGCGCGGAGGGGAGGG + Intergenic
1180603485 22:17037389-17037411 GGGAGCGGCCGAGAAGGAGTAGG - Intergenic
1181902679 22:26169319-26169341 TGGAGGGGCCGCGGCGGCGCCGG - Intergenic
1182532317 22:30969662-30969684 TGGAGCGGCCGGGGAGGCGGGGG + Intergenic
1183517026 22:38272715-38272737 CGGTGCGGCCGCGGAGGGAGGGG - Intronic
1183535507 22:38398526-38398548 AGGAGCGGGCGCGGAGGGGAGGG + Intergenic
1183665143 22:39242561-39242583 GGGGGCGGCCGCGGAAGGGCGGG + Intronic
1184629420 22:45764009-45764031 CGGAGAGGCCGGGGAGAAACTGG - Intronic
1185255156 22:49827638-49827660 CGGAGCCGCCGCGGCCGAGAGGG - Intergenic
1185289066 22:50014959-50014981 CGGAGCGGGTGCGGGGGTGCTGG + Intergenic
1185381151 22:50507984-50508006 TGGAGCTGCCGCGGGCGAGCGGG - Intergenic
950487831 3:13283179-13283201 CGGCGCGTCCGCGGGGCAGCGGG - Intergenic
950683474 3:14601368-14601390 CGGAGCTGCCCCCAAGGAGCAGG - Intergenic
953561189 3:43995155-43995177 CGTAGCGGCCGCGGAGGGTGGGG + Intergenic
954186195 3:48918898-48918920 CGAAGCGGCAGCGGAGGCGGCGG - Exonic
954540777 3:51391785-51391807 AGGCGCGGCCGCGGATGAGCCGG - Exonic
955818707 3:62874489-62874511 CGCAGCTGGCGAGGAGGAGCAGG - Intronic
955977041 3:64489509-64489531 CGGAGCGGCCCAGGGCGAGCCGG + Intergenic
959462504 3:106644107-106644129 GGGAGCGGGCGCGGGGGAGCAGG - Intergenic
961408912 3:126704354-126704376 CGGAGTGGACGAGGAGGAGCGGG + Exonic
961551647 3:127673157-127673179 CTGGGCGGCCGCGGAGAGGCGGG + Intronic
963605887 3:147411286-147411308 CAGGGCGGACGAGGAGGAGCTGG + Intronic
966868557 3:184276012-184276034 GGGGGCGGCCGCGGCCGAGCGGG + Intronic
966868637 3:184276250-184276272 GGGGTCGGCCGCGGAGGGGCAGG + Intronic
967904097 3:194486786-194486808 CGCCGCGGGCGCGGAGGAGGAGG - Intronic
968114871 3:196081881-196081903 CGGGGCGGCCGGGATGGAGCGGG - Intronic
968603345 4:1520652-1520674 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603364 4:1520693-1520715 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603403 4:1520775-1520797 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603462 4:1520898-1520920 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603481 4:1520939-1520961 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603519 4:1521021-1521043 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603538 4:1521062-1521084 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603557 4:1521103-1521125 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603576 4:1521144-1521166 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603595 4:1521185-1521207 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968672162 4:1857441-1857463 CTGAGGTGCCGCGGAGAAGCAGG - Intergenic
968701147 4:2058919-2058941 CCGGGCGGCCGCGGAGGAGGAGG + Intergenic
968954444 4:3711054-3711076 AGGAGCTGCAGCTGAGGAGCTGG - Intergenic
969114024 4:4860224-4860246 CCGAGCGGCCGCGGCGAAGAGGG - Exonic
970332942 4:15003490-15003512 CGGCGCCGCCACGGAGGCGCGGG + Exonic
971351841 4:25862704-25862726 CAGAGCGGCCGCCGAGGCCCTGG + Exonic
971451367 4:26804667-26804689 GGGAGCAGCCGCGGAGGCGGCGG + Intergenic
972503424 4:39698280-39698302 CGTAGCGGTGGCGGAGGAGGCGG + Exonic
972686854 4:41360597-41360619 GGGAGCGAGCGCGGAGGCGCCGG - Intronic
973551293 4:52038301-52038323 GGGTGCGGTCGCGGAGGGGCGGG - Exonic
975342638 4:73258800-73258822 CGGAGCGGCGGCGGCGGCGGCGG - Intergenic
979329013 4:119406937-119406959 CGGAGAGGCCGCCGAGAGGCCGG + Intergenic
979523863 4:121697186-121697208 GGGAGCGGCCGCAGAGCTGCTGG + Intergenic
982245327 4:153344897-153344919 CGGAGTGGCTGCGGCGGGGCCGG - Intronic
984973376 4:185209763-185209785 CGGAGCGCCGGCGGGGGACCGGG + Intronic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
985565355 5:612565-612587 CGGAACGGTCGCGGGCGAGCGGG + Intronic
985727109 5:1522390-1522412 CAGAGCGGCGGCAGAGGGGCCGG + Intronic
985727431 5:1523624-1523646 AGGCGCGGCCGAGGAGGGGCCGG - Intronic
986449490 5:7850759-7850781 GCGGGCGGCCGCGGAGGGGCGGG - Intronic
986543664 5:8872862-8872884 CTGAGGGGCCAGGGAGGAGCTGG - Intergenic
989592042 5:43121177-43121199 GGGAGGGGCCGCGCAGTAGCTGG + Intronic
990323120 5:54649044-54649066 GGGACCGGCCGCTGTGGAGCAGG + Intergenic
995106529 5:108382018-108382040 CGGAGCGGCCGGGGAAAGGCCGG + Exonic
995206608 5:109487875-109487897 GGGACCGGGCGCCGAGGAGCAGG + Intergenic
995512484 5:112922413-112922435 CGCAGCGTCCGCGGAGTTGCAGG - Exonic
995853706 5:116572936-116572958 CGGAGGGGCGGCGAGGGAGCGGG + Intronic
996082168 5:119268612-119268634 CGGAGTGGGTGAGGAGGAGCTGG - Intergenic
996082199 5:119268698-119268720 CGGGCAGGCCGGGGAGGAGCCGG - Intronic
1000052695 5:157575905-157575927 GGGAGGGGCCGGGGAGGAGCTGG + Intergenic
1000628537 5:163566317-163566339 CGGACCGGCCGCGGCGCTGCGGG - Intergenic
1001382012 5:171311415-171311437 CGGAGCGGCAGCAGGCGAGCCGG + Exonic
1001636061 5:173211266-173211288 TGGAGTGGACGGGGAGGAGCTGG + Intergenic
1003551836 6:7107691-7107713 CTGAGCGGCCGCGGCGGCGGCGG - Intronic
1003551969 6:7108259-7108281 CGGGGCGGCCAGGGATGAGCGGG + Intronic
1004193999 6:13487769-13487791 GGGCGGGGCCGGGGAGGAGCCGG - Intergenic
1004199498 6:13534630-13534652 AGGAGAGGCCTTGGAGGAGCAGG + Intergenic
1004906236 6:20239286-20239308 CGGAGTGGCGGGGGAGGCGCAGG - Intergenic
1005267379 6:24126246-24126268 CGGAGCGGCGGCGGTGGCGACGG + Exonic
1005825181 6:29628020-29628042 CGGAGGGGAGGAGGAGGAGCAGG + Intronic
1005959887 6:30687132-30687154 GGGAGGGGGTGCGGAGGAGCCGG + Exonic
1006396161 6:33788868-33788890 CGGAGAGGCCGCGGCGGGCCGGG + Exonic
1007072838 6:39049183-39049205 CAGGGCGGCCGCGGGGCAGCGGG - Intronic
1007781403 6:44256975-44256997 CGGAGCTGCAGCGGAGGGGGCGG - Intronic
1009899749 6:69796848-69796870 TGGCGCGGCCTCGGCGGAGCTGG - Exonic
1011640339 6:89411868-89411890 CGGATCGGCGTCGGAGGAGTCGG + Exonic
1012243191 6:96897544-96897566 CCGAGCGGCTGCGGCCGAGCAGG + Intronic
1012625833 6:101402451-101402473 CTGAGCGGCTGCAGAGGAGCAGG - Intronic
1017672068 6:156778042-156778064 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1018653222 6:166008442-166008464 CCAAGCGGGGGCGGAGGAGCGGG + Intergenic
1018876562 6:167826987-167827009 CGGCGCGGCCGCGGAGGCGGAGG + Exonic
1020278130 7:6637006-6637028 CGGGGCGCCCGCTGAGGACCAGG - Intergenic
1022099796 7:27162160-27162182 CGGAGAAGCCCCTGAGGAGCTGG - Intergenic
1023400782 7:39792157-39792179 CGGAGAGGCCGCCGAGAGGCTGG - Intergenic
1023842237 7:44104231-44104253 CGGAGGGGCTGCGGGGGGGCGGG - Intergenic
1024074248 7:45810672-45810694 TGGAGCGGCCGCCGAGAGGCCGG - Intergenic
1025053165 7:55744856-55744878 CGGAGCGGCCGCCGAGAGGCCGG + Intergenic
1026522773 7:71131605-71131627 AAGAGCGGCGGAGGAGGAGCTGG + Intergenic
1028585570 7:92447926-92447948 CGGAGGGGTGGCGGAGGTGCTGG - Exonic
1028762312 7:94509846-94509868 CGGAGCAGCGGCGGCGGGGCTGG + Exonic
1029417201 7:100450668-100450690 CGTGGCGGCCGCGGCGAAGCTGG - Intergenic
1033220373 7:139523591-139523613 GGGAGGAGGCGCGGAGGAGCGGG - Intergenic
1034223059 7:149460356-149460378 CCGAGCGGCGGCGTCGGAGCTGG + Intronic
1034306430 7:150048310-150048332 CGGAGGGGCCGGGGTGGAGGAGG - Intergenic
1034440516 7:151083446-151083468 CCGAGGGGCCGCGATGGAGCTGG - Intronic
1034659902 7:152759950-152759972 GAGCGGGGCCGCGGAGGAGCGGG - Intronic
1034800416 7:154052332-154052354 CGGAGGGGCCGGGGTGGAGGAGG + Intronic
1035049410 7:155990078-155990100 AGGAGCAGCTGGGGAGGAGCTGG + Intergenic
1035049419 7:155990107-155990129 AGGAGCAGCTGGGGAGGAGCTGG + Intergenic
1035049801 7:155992221-155992243 AGGAGCAGCTGGGGAGGAGCTGG + Intergenic
1035049810 7:155992250-155992272 AGGAGCAGCTGGGGAGGAGCTGG + Intergenic
1037582325 8:20253022-20253044 AGGAGCGGCCGCGGCGCTGCAGG - Exonic
1039903109 8:41767100-41767122 GGCTGCGGCCGCGGAGGGGCTGG - Intronic
1040039147 8:42897920-42897942 CGGCGCGGCCGGGGAGGGGGAGG + Intronic
1041094201 8:54333021-54333043 TGGAGTGGCCCCTGAGGAGCAGG - Intergenic
1041281173 8:56211863-56211885 CGAAGCGGCCGCAGAAAAGCGGG + Intronic
1041690374 8:60680362-60680384 CGGGGCGGGCGCGGCGGCGCGGG + Intronic
1041906445 8:63038617-63038639 CGCAGCAGACGGGGAGGAGCTGG - Intronic
1043502750 8:80873687-80873709 CCGAGGGGGCGCGGAGGAGGAGG - Intronic
1044340498 8:91041018-91041040 AGGAGCAGCAGTGGAGGAGCGGG + Exonic
1044819463 8:96145725-96145747 CGGAGCTGACGCGAAGGAGGGGG - Intronic
1044988716 8:97776510-97776532 CGGAGCGGTCGCGGAGGTGACGG + Intronic
1045489201 8:102656126-102656148 CGGAGGGGACGGGGCGGAGCGGG - Intergenic
1045582962 8:103499888-103499910 CGGAGGGGCGGAGGAGGTGCTGG + Intergenic
1045737922 8:105318458-105318480 CGGAGCGGCGGCGGCGGCGCCGG + Intronic
1046547417 8:115669073-115669095 CGGGGCGGCGGCGGCGGCGCGGG - Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049581203 8:143411869-143411891 TGGAGCTGCCCCGCAGGAGCAGG + Intergenic
1049756783 8:144314326-144314348 CCTAGAGGCCCCGGAGGAGCTGG + Exonic
1051079690 9:13279657-13279679 CGGGGCTGCCGCGGAGGCGGTGG + Intergenic
1051621012 9:19049482-19049504 TGGAGAGGCCGCGGACGGGCTGG - Exonic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1057448652 9:95137339-95137361 CGGGGAGACTGCGGAGGAGCTGG + Intronic
1058508849 9:105694546-105694568 TGGAGCCGGCGCGGAGGAGCGGG + Exonic
1060200970 9:121651649-121651671 CCGAGCGGCCGCCGAGGCCCTGG - Intronic
1060222729 9:121773153-121773175 CAGCACTGCCGCGGAGGAGCTGG + Exonic
1060263166 9:122093181-122093203 CGGAGCGGCGGCGGCGGCGGCGG - Exonic
1060916905 9:127397328-127397350 CGGAGCGGACGCGGAGGGGCGGG - Intronic
1061540738 9:131276925-131276947 CGCCGCGGCCGCCGAGGACCTGG + Intergenic
1061725943 9:132582150-132582172 GAGAGCTGCCGCCGAGGAGCAGG + Intergenic
1062022523 9:134326237-134326259 CGGGGCGGCGGCGGCGGAGGGGG + Intronic
1062403011 9:136380628-136380650 CTGAGGGGCTGCGGTGGAGCGGG + Intronic
1062479494 9:136744788-136744810 GGGAGGGGCCGGGGAGGGGCTGG + Intronic
1062507670 9:136886464-136886486 CGGAGCGGCGGCGGCGGCGGCGG + Intronic
1062548934 9:137077274-137077296 CGGACCGGACGCGGGGGGGCTGG + Intergenic
1062676959 9:137752336-137752358 CGGGGAGTCCGAGGAGGAGCAGG + Exonic
1062696215 9:137877648-137877670 CGGAGGGGCCGGGGCGGGGCGGG + Intergenic
1062696282 9:137877835-137877857 CGGAGCAGCCACGGAGCCGCCGG - Exonic
1186459932 X:9739962-9739984 AGGAGGGGACGGGGAGGAGCTGG + Intronic
1186768032 X:12791350-12791372 AGGAGCGGAGGGGGAGGAGCCGG - Intronic
1189310318 X:40013705-40013727 CGGAGCGGGAGCGGGGGAGGGGG - Intergenic
1190274553 X:48891648-48891670 AGGCGCAGCCTCGGAGGAGCCGG + Intergenic
1192214666 X:69150174-69150196 CTGGTCGGCCGCGGAGGGGCGGG + Intergenic
1192224915 X:69221589-69221611 CGGGTCGGCCGCGGAGGGGCGGG - Intergenic
1198312069 X:135433758-135433780 CGAAGCGGCCCTGGAGAAGCAGG + Intergenic
1198369286 X:135974440-135974462 CCGAGGGGGCGCGGAGGAGTGGG + Intergenic
1199760102 X:150898644-150898666 AGGGGAGGCCGAGGAGGAGCGGG + Exonic
1200291706 X:154881584-154881606 CGGAGCGGGGGCGGGGGAGGGGG + Intronic
1200338544 X:155377323-155377345 CGGAGCGGGGGCGGGGGAGGGGG + Intergenic
1200347925 X:155463369-155463391 CGGAGCGGGGGCGGGGGAGGGGG - Intergenic