ID: 1105514119

View in Genome Browser
Species Human (GRCh38)
Location 13:21075821-21075843
Sequence CTTGGGGAGAACGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105514119_1105514121 -10 Left 1105514119 13:21075821-21075843 CCGGCGGCGGCGTTCTCCCCAAG 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1105514121 13:21075834-21075856 TCTCCCCAAGGCTGCCCGCTTGG 0: 1
1: 0
2: 2
3: 14
4: 177
1105514119_1105514127 4 Left 1105514119 13:21075821-21075843 CCGGCGGCGGCGTTCTCCCCAAG 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1105514127 13:21075848-21075870 CCCGCTTGGCTGCGCGGCTGAGG 0: 1
1: 0
2: 1
3: 16
4: 126
1105514119_1105514129 14 Left 1105514119 13:21075821-21075843 CCGGCGGCGGCGTTCTCCCCAAG 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1105514129 13:21075858-21075880 TGCGCGGCTGAGGCGAGTTGAGG 0: 1
1: 0
2: 1
3: 4
4: 103
1105514119_1105514125 -2 Left 1105514119 13:21075821-21075843 CCGGCGGCGGCGTTCTCCCCAAG 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1105514125 13:21075842-21075864 AGGCTGCCCGCTTGGCTGCGCGG 0: 1
1: 0
2: 0
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105514119 Original CRISPR CTTGGGGAGAACGCCGCCGC CGG (reversed) Intergenic
903555118 1:24187408-24187430 CCTGGGGACAGCCCCGCCGCGGG + Intronic
903627910 1:24744877-24744899 CTTGGGGAGGTAGCCGCTGCGGG + Intergenic
915589097 1:156860692-156860714 CTCGGGGAGAAGGCTGACGCTGG + Intronic
923385215 1:233459532-233459554 CTTGGGGAGACTGCCGTCCCAGG + Intergenic
1082786891 11:57322253-57322275 CTTGGGTAGGACGGCCCCGCTGG + Intronic
1083316126 11:61816001-61816023 CTTGGGGAGACCGCTGCCTTGGG - Intronic
1090399568 11:126440457-126440479 CATCCGGAGCACGCCGCCGCCGG - Exonic
1096198241 12:49662977-49662999 GTTGGGGAGAAAGGCCCCGCAGG - Intronic
1098819473 12:75209377-75209399 GTGGGGGAGAAAGCCCCCGCCGG + Exonic
1100537000 12:95520857-95520879 CTTAGGGAGAATGCCTCTGCAGG - Intronic
1105514119 13:21075821-21075843 CTTGGGGAGAACGCCGCCGCCGG - Intergenic
1132930010 16:2454271-2454293 CTTGGGGAGGAAGCAGCAGCAGG - Intronic
1144700177 17:17332459-17332481 CTTGGAGAGAGCGCCTCCCCTGG + Intronic
1148698694 17:49575878-49575900 CTGGGCGAGAGCGGCGCCGCTGG + Exonic
1151994120 17:77597899-77597921 CTTGGGGATAAAGCAGCCTCTGG - Intergenic
1153688523 18:7568380-7568402 CACCGGGAGATCGCCGCCGCCGG - Intronic
1161190264 19:2950624-2950646 CTGAGGGAGACGGCCGCCGCGGG + Intergenic
1161563081 19:4984518-4984540 CTTGGGGTCAACGCTGCCTCGGG - Intronic
1166569232 19:43783160-43783182 CTTGGGGAAAGTGCAGCCGCCGG + Intergenic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
926126203 2:10273434-10273456 CATGGGGAGAAGGCTGCAGCCGG - Intergenic
938072709 2:128317062-128317084 TTTGGGGAGAAAGGCCCCGCAGG + Intronic
942491030 2:176490173-176490195 CTTCGGGAGAACTCTGCAGCTGG - Intergenic
947600035 2:231441514-231441536 CTTGGGGAGGAGGCCGAGGCAGG - Intergenic
1169193004 20:3669586-3669608 CATGGGGTGAACGCCGCCCAGGG + Exonic
1175379308 20:58551883-58551905 CATGGGGTGAACGCTGCCACGGG + Intergenic
1180233485 21:46442279-46442301 CATGGGAAGGTCGCCGCCGCCGG + Intronic
950287608 3:11757381-11757403 CCTGGGGAGACGGCCGCCCCTGG - Intergenic
952344092 3:32468037-32468059 CTTGGGGAGAGCCACGCCTCTGG + Intronic
952451884 3:33440429-33440451 CGTGGGGCGAACGCCGGGGCGGG - Intronic
954364846 3:50140244-50140266 CTTGGGGAGGACCCAGCCGGAGG - Intergenic
967845737 3:194041204-194041226 CTTTGGGAGAACGAGGCAGCTGG + Intergenic
967931589 3:194694171-194694193 CCTGGGGAGAATGCTGCCGGTGG + Intergenic
974204972 4:58690067-58690089 CTTGGGGAGGACGAGGCAGCTGG - Intergenic
984472794 4:180197682-180197704 GTTGGGGAGAATTCCGCAGCTGG + Intergenic
1010500456 6:76593622-76593644 CTTGGGGAGGAAACCGCGGCAGG + Intergenic
1027463552 7:78486089-78486111 CCTGGGAAGAAGGCCGCTGCTGG + Intronic
1040693611 8:49969638-49969660 CTTTGGGAGAACGAGGCCGGTGG - Intronic
1057023788 9:91720889-91720911 CTTGTGGAGAAAGCAGCCACAGG + Intronic
1059234578 9:112750935-112750957 CTCGGGGAGCTCGCCGCGGCGGG + Exonic
1060493371 9:124100827-124100849 CTAGGAGAGAAGGCCGCAGCTGG - Intergenic
1200100930 X:153688850-153688872 CTGGGGGAGGAGGCCGCGGCGGG - Intronic
1200952309 Y:8910828-8910850 CTTGGGGAGTACGGGGCAGCTGG + Intergenic
1201765007 Y:17567619-17567641 CTTGGTGAGAAAGCCTTCGCTGG - Intergenic
1201836545 Y:18338370-18338392 CTTGGTGAGAAAGCCTTCGCTGG + Intergenic