ID: 1105514608

View in Genome Browser
Species Human (GRCh38)
Location 13:21078013-21078035
Sequence GGCTCCCTTTGTTCAGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105514608_1105514612 28 Left 1105514608 13:21078013-21078035 CCGGACTCTGAACAAAGGGAGCC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1105514612 13:21078064-21078086 AGACTACGAAGCCCTTCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 129
1105514608_1105514609 -3 Left 1105514608 13:21078013-21078035 CCGGACTCTGAACAAAGGGAGCC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1105514609 13:21078033-21078055 GCCGACAAATGAGAAAGCAAAGG 0: 1
1: 0
2: 1
3: 4
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105514608 Original CRISPR GGCTCCCTTTGTTCAGAGTC CGG (reversed) Intergenic