ID: 1105514640

View in Genome Browser
Species Human (GRCh38)
Location 13:21078203-21078225
Sequence GACCCCGGGGAGCCTCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105514635_1105514640 -7 Left 1105514635 13:21078187-21078209 CCACGCGCAGCTCCAAGACCCCG 0: 1
1: 0
2: 0
3: 15
4: 108
Right 1105514640 13:21078203-21078225 GACCCCGGGGAGCCTCCGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 179
1105514633_1105514640 7 Left 1105514633 13:21078173-21078195 CCAGGTGTTGATGCCCACGCGCA 0: 1
1: 0
2: 1
3: 0
4: 53
Right 1105514640 13:21078203-21078225 GACCCCGGGGAGCCTCCGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 179
1105514631_1105514640 28 Left 1105514631 13:21078152-21078174 CCAGGCTGGAGACACAGACAGCC 0: 1
1: 0
2: 6
3: 44
4: 471
Right 1105514640 13:21078203-21078225 GACCCCGGGGAGCCTCCGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 179
1105514630_1105514640 29 Left 1105514630 13:21078151-21078173 CCCAGGCTGGAGACACAGACAGC 0: 1
1: 0
2: 0
3: 43
4: 386
Right 1105514640 13:21078203-21078225 GACCCCGGGGAGCCTCCGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 179
1105514634_1105514640 -6 Left 1105514634 13:21078186-21078208 CCCACGCGCAGCTCCAAGACCCC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1105514640 13:21078203-21078225 GACCCCGGGGAGCCTCCGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105514640 Original CRISPR GACCCCGGGGAGCCTCCGCC AGG Intergenic
900645256 1:3706116-3706138 GCCCCCGGCCCGCCTCCGCCTGG + Intronic
901858696 1:12060388-12060410 GACCCAGGGGAGCCACTGCAGGG + Intergenic
902245370 1:15117383-15117405 GACCCCCAGGAGCCTCTGCGAGG + Exonic
904011457 1:27392693-27392715 GGCCGCGGGGAGGCTCCGCTCGG - Exonic
906292951 1:44631841-44631863 GACCCCGGGGAGGCTTCTGCCGG + Intronic
909021315 1:70434371-70434393 GGCCCCTGAGAGCCTCCTCCTGG - Intronic
911817186 1:102368360-102368382 GAGCCTTGGGAGCCTCTGCCTGG + Intergenic
915637053 1:157194834-157194856 GGCCCCGGGGACCCTTCGCCTGG - Intergenic
916542288 1:165768623-165768645 GACCCCGGGGCCCTTCCTCCCGG + Intronic
923018442 1:230145023-230145045 GACCCTTGGGATGCTCCGCCGGG - Intronic
924792973 1:247269983-247270005 GAGGCCTGGGAGCCTCCACCTGG - Intergenic
1065024569 10:21527424-21527446 GAGCCCGGGGAGGCGCCGACGGG - Intergenic
1065099038 10:22316059-22316081 GACCCCGGGGAGACTGCGGACGG - Exonic
1067052346 10:43029146-43029168 GACCCAGCAGGGCCTCCGCCCGG + Intergenic
1067695990 10:48536025-48536047 GACCCAGGCCAGCCTCTGCCGGG - Intronic
1072590804 10:96826964-96826986 GACACCCGGGAGCCTCCTCCTGG - Intergenic
1073190889 10:101650003-101650025 GACTCTGGGGAGCCTCAGCCTGG - Intronic
1075831588 10:125416608-125416630 GACCACGGTGAGCTTCCACCTGG - Intergenic
1075885641 10:125896697-125896719 GTTCCCGGGGAGCCCCAGCCCGG - Intronic
1076878940 10:133230751-133230773 GACCCCGGGGAGCGGCGGCGAGG - Exonic
1076891182 10:133284280-133284302 GACCCCTCGGAGCCCACGCCAGG + Intronic
1077106470 11:844555-844577 GACCCTGGGGAGCCTGGGCCTGG + Exonic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077491443 11:2862704-2862726 GACCTCCGGGAGCCGCGGCCGGG + Intergenic
1079037800 11:17036083-17036105 GACCCCTGGCAGCCACAGCCTGG + Intergenic
1083318007 11:61828177-61828199 GAAGCCAGGGATCCTCCGCCAGG + Exonic
1083638405 11:64132550-64132572 GACCCCGAGGAGCCGCTGACTGG - Intronic
1083671051 11:64300097-64300119 GTGCCCGGGGACCCTCGGCCTGG - Intergenic
1083705424 11:64510928-64510950 GACCCTGGAGAGGCACCGCCTGG + Intergenic
1083741310 11:64712944-64712966 AGCCCCGGGGAGCGGCCGCCCGG - Intronic
1083753628 11:64777843-64777865 CGCCCAGGGGCGCCTCCGCCCGG + Intronic
1083852595 11:65376929-65376951 GCCCCCGGGGCCCCTCCTCCCGG + Exonic
1096231319 12:49898342-49898364 GTCCCCAGGGAGCCCCAGCCGGG - Intronic
1097281301 12:57846626-57846648 CACCCGGGGGAGCCGCTGCCCGG - Exonic
1098018454 12:66130767-66130789 CGCCCCGGGTGGCCTCCGCCCGG - Exonic
1101759328 12:107645973-107645995 GGCCCCTGGGAGCCTCCTGCTGG - Intronic
1102094478 12:110225885-110225907 GAACCCAGGAGGCCTCCGCCTGG + Intergenic
1102228632 12:111247275-111247297 GCCCCGGGAGAGCCTCAGCCGGG - Intronic
1102254059 12:111406027-111406049 GCCCCCGGGCCGCCGCCGCCGGG - Exonic
1103415462 12:120739532-120739554 GTCCCCAGGGAGCCCCCGCCGGG - Exonic
1105514640 13:21078203-21078225 GACCCCGGGGAGCCTCCGCCAGG + Intergenic
1110892274 13:80707167-80707189 CTCGCGGGGGAGCCTCCGCCCGG - Intergenic
1112693018 13:101917048-101917070 GCGCCCGGGGAGCCGCCGGCCGG - Intronic
1113455191 13:110443760-110443782 GACCCAGTGGAGGCTCCGCCGGG - Intronic
1121089362 14:91170523-91170545 GGCTCCGGTGAGCCTCAGCCAGG + Intronic
1122202079 14:100128653-100128675 GACCCCTGGGCTCCTCCGGCTGG - Exonic
1122206402 14:100150069-100150091 GCACACGGGGAGCCTCAGCCAGG + Intronic
1122691407 14:103533612-103533634 GCCCCAGGGGAGGCTCTGCCGGG - Intronic
1122740112 14:103867357-103867379 GGCCCCGGGGAGCTCCAGCCAGG - Intergenic
1123739261 15:23219445-23219467 AATCCCAGGGACCCTCCGCCAGG - Intergenic
1124290480 15:28448401-28448423 AATCCCAGGGACCCTCCGCCAGG - Intergenic
1124292757 15:28469147-28469169 AATCCCAGGGACCCTCCGCCAGG + Intergenic
1126158557 15:45587504-45587526 GAGGCCGGGGAGCCGACGCCTGG + Exonic
1127306102 15:57706965-57706987 GGTCCCGCGGAGTCTCCGCCAGG + Intronic
1127753576 15:62068451-62068473 GGCCCGGGGGCGCCTCCGGCCGG - Exonic
1129052819 15:72796918-72796940 CACCCCGGGGAGGCGCCGGCGGG - Intergenic
1129727016 15:77906514-77906536 GCCCCCGGGGAGCCTCCCTCAGG + Intergenic
1129761457 15:78131367-78131389 GACCCCCGCGCGCCTCCTCCAGG - Exonic
1130002674 15:80060291-80060313 GACACCGGGCTGCCTCCGGCTGG - Intronic
1130531012 15:84748231-84748253 GACCCCGGCCGGCCCCCGCCCGG - Intergenic
1133236610 16:4390195-4390217 GACCCAGGAGAGCCCCAGCCTGG + Intronic
1136129630 16:28211700-28211722 GAGGCCGGGGAGCCCCTGCCTGG - Exonic
1136290436 16:29268331-29268353 GGCCCCGTGGAGACTCAGCCTGG + Intergenic
1136759646 16:32720192-32720214 AATCCCAGGGACCCTCCGCCAGG - Intergenic
1136808458 16:33150194-33150216 AATCCCAGGGACCCTCCGCCAGG + Intergenic
1138581637 16:57945391-57945413 GACCCCAGGAAGCCTCTGGCTGG - Intronic
1139436160 16:66937824-66937846 GGCCCCAAGGAGCCTCAGCCTGG + Intronic
1140048392 16:71457938-71457960 GACCCCAGGGAGGCAGCGCCTGG + Intronic
1142096318 16:88241852-88241874 GGCCCCGTGGAGACTCAGCCTGG + Intergenic
1142156470 16:88534728-88534750 GAGCCCCAGGAGCCGCCGCCCGG + Exonic
1142191973 16:88722272-88722294 GACCCCGGGGAGCGTGAGGCTGG - Exonic
1142232954 16:88908382-88908404 GGCCCCGGGGAGCGGCCTCCAGG - Intronic
1146054344 17:29573752-29573774 GACCCCGGGGAGCCAGCCCCAGG + Exonic
1147650353 17:42058482-42058504 TTCCCCAGGGAGCCTCCACCAGG + Intronic
1151766732 17:76136862-76136884 GGCCCCAGGGAGGCTCTGCCAGG + Exonic
1152924548 17:83081046-83081068 TCCCCCGGGGAGGCTCCGCCGGG - Intronic
1153997433 18:10454519-10454541 GCCCCCGGGCAGCCGCCGCCGGG - Intergenic
1154191804 18:12236374-12236396 GCCCAGGGTGAGCCTCCGCCAGG - Intergenic
1154241395 18:12657390-12657412 GACCCCCGGGAGGATCCGGCGGG - Intronic
1155053244 18:22165760-22165782 GACCGCGCGGAGCCAGCGCCGGG - Intergenic
1155381077 18:25223385-25223407 GCCACAGGGGGGCCTCCGCCAGG + Intronic
1156569735 18:38239654-38239676 CACCCCAGGGAGCCTGCCCCAGG - Intergenic
1160391736 18:78539240-78539262 GACCCTGGGGTGCCGGCGCCCGG + Intergenic
1160465100 18:79069556-79069578 GGCCCCGGGGAGCGTCGGCGGGG - Intronic
1160867233 19:1261316-1261338 GACCGCGGGGAGGCTGGGCCGGG - Intronic
1160871197 19:1278703-1278725 GACCTGGGTGAGCCTCTGCCCGG + Intronic
1161010033 19:1955511-1955533 CACCCCGCGGAGCCTCACCCTGG - Intronic
1162299265 19:9835112-9835134 GCCCCCGGCCAGCCTCAGCCTGG - Intergenic
1162930583 19:13955672-13955694 GTCCCGGGGGAGACTGCGCCAGG - Intronic
1163266649 19:16226202-16226224 GAGCCTGGGGACCCTCAGCCAGG + Intronic
1163799659 19:19356796-19356818 GGCCCCAGGGAGCCTCCGCTGGG + Exonic
1165349209 19:35267392-35267414 GCCCCCGCGGAGCCGCAGCCGGG + Exonic
1165384361 19:35501822-35501844 GACCCAGGGGAGCCACGGCTGGG - Intronic
1165454029 19:35900513-35900535 TCCCCCGCGGAGCCGCCGCCGGG + Exonic
1166252052 19:41577970-41577992 GACCCTGGGGAGCCTGTGCCAGG + Intronic
1166255583 19:41601946-41601968 GACCCTGGGAAGCCTGTGCCGGG + Intronic
1166258998 19:41625203-41625225 GACCCCGGGAAGCCTGTGTCAGG - Intronic
1166270483 19:41710431-41710453 GACTCAGGGGAGCCTGTGCCAGG + Intronic
1166406664 19:42526598-42526620 GACCCTGAGGAGCCTGGGCCAGG - Intronic
1166423490 19:42655911-42655933 GACCCTGGGGAGCCTGTGCCAGG + Intronic
1167337623 19:48896398-48896420 GACCCCTGGGGGCGTTCGCCTGG - Intronic
1168689715 19:58369130-58369152 CAGCCCCGGGAGCCCCCGCCTGG + Exonic
925308958 2:2868343-2868365 GACTCCGGGGAGCTCCCGCGGGG - Intergenic
925318957 2:2947143-2947165 GAGCCCGGGGAGCATGTGCCTGG + Intergenic
927213323 2:20651689-20651711 GGCCCCGGGAGGCCTCCACCAGG - Intergenic
927424872 2:22970758-22970780 GACCCCGGGTAGCCGCTGCCTGG + Intergenic
927692048 2:25215409-25215431 AACCCAGGGGAGGCTCCTCCAGG + Intergenic
934976536 2:98806497-98806519 GATCCCGGGGAGCCAGGGCCGGG + Intronic
937335811 2:121061811-121061833 AACCCCTGGGAGGCCCCGCCGGG + Intergenic
938342953 2:130547536-130547558 GACCTAGGGGAGCCTCCGGCAGG + Intronic
938346880 2:130573186-130573208 GACCTAGGGGAGCCTCCGGCAGG - Intronic
938764335 2:134450352-134450374 GGCCCAGTGGAGCCTCCGCTGGG + Exonic
942317596 2:174709787-174709809 GACCCAGGGCACCCTCCGCAGGG + Intergenic
946157762 2:217818203-217818225 CACCCCGGGGAGTCCCAGCCTGG - Exonic
948467456 2:238159125-238159147 GCCCGCAGGGAGCCGCCGCCCGG + Exonic
948541559 2:238694712-238694734 AGCCCCGGGCAGCCTCCACCAGG - Intergenic
948588638 2:239036086-239036108 GACCCCTGGCTGCCTCCCCCTGG - Intergenic
948831155 2:240598828-240598850 GTCCACGGGAAGCCTCCGTCAGG + Exonic
948903952 2:240969039-240969061 TGCCCTGGGGAGCCTCAGCCAGG - Intronic
1169849633 20:10035172-10035194 CACGCCTGGGCGCCTCCGCCGGG + Exonic
1170244335 20:14204225-14204247 GACACCAGGGAGCCTGCCCCTGG - Intronic
1170890135 20:20369011-20369033 GGCCCCGCGGCGCCTCCACCGGG - Exonic
1170972203 20:21126287-21126309 GGCCCCGGGGAACCTCGGACGGG - Intronic
1172703017 20:36863951-36863973 GGCGCAGGGGCGCCTCCGCCGGG - Intergenic
1175258146 20:57659107-57659129 GACCTGGGGGAGCCTCTGCGAGG - Intronic
1175859408 20:62142606-62142628 GGCCCCGGGAAGGCTCCTCCCGG + Intronic
1175887577 20:62301449-62301471 GACCCCGGGGAGCGCCCGAAGGG + Intergenic
1175899626 20:62354880-62354902 GTCCCTGTGGAGCCTCTGCCTGG - Intronic
1179723130 21:43326728-43326750 CAGCCCGGGGAGCCACTGCCCGG + Intergenic
1180285669 22:10742233-10742255 GTTCCCGGGGAGCCCCAGCCCGG - Intergenic
1180718101 22:17886033-17886055 GGCCCCGAGGAGCTTCCTCCTGG + Exonic
1180733716 22:18000896-18000918 GACCCGGCGGAGCCTCGGCCCGG + Intronic
1181910300 22:26233382-26233404 GACTTCGGGGAGGCTCCTCCAGG - Intronic
1181934544 22:26429382-26429404 GGCGCCGCGGAGCCGCCGCCTGG - Exonic
1182103668 22:27674130-27674152 GTCCCCGGGGGGCCTCCCCCGGG - Intergenic
1182117554 22:27765923-27765945 GCCCCCGGGGTGCCTGTGCCCGG + Intronic
1182429620 22:30292080-30292102 AACCCTGGGGAGCATCCCCCAGG + Exonic
1184285469 22:43468693-43468715 GACCCTGGCGAGGCTCCGCTGGG - Intronic
1185267159 22:49910374-49910396 GACTCAGGGGAGCCCCTGCCCGG + Intronic
1185296236 22:50056693-50056715 CACCCCTGGGGTCCTCCGCCTGG + Intronic
950449138 3:13055828-13055850 CACCCCAGGGCCCCTCCGCCAGG - Intronic
953246565 3:41199287-41199309 CACCCCGGGGAGCGTCCGTGGGG + Intronic
954367431 3:50154178-50154200 CGCCCCTGGGAGCCTCCGCAGGG + Intergenic
968511521 4:997779-997801 GACCCCGGGGTTCCTGGGCCTGG + Intronic
968596570 4:1489112-1489134 GACCCCAGGGCACCTCCACCGGG + Intergenic
968659434 4:1793121-1793143 GACCGCCGGGCGCCCCCGCCCGG + Intergenic
969871885 4:10109765-10109787 GAACCCTGGGAGCCACCCCCAGG - Intronic
974099760 4:57403679-57403701 GACGCCAGAGAGCCTCAGCCAGG + Intergenic
976765238 4:88592282-88592304 CACCTCGGGCAGCCTGCGCCTGG + Intronic
983229457 4:165114436-165114458 GACCCTGGGGAGCCTGAGGCAGG - Intronic
984727761 4:183037722-183037744 GACCCAGGGGAGCCAAAGCCGGG - Intergenic
985363610 4:189202399-189202421 GCCCCAGGGGAGCCGCGGCCTGG + Intergenic
986747968 5:10760928-10760950 CTCCCCGCGGAGCCCCCGCCCGG + Intronic
988497285 5:31756175-31756197 GACCCGGGGGTGCCTGTGCCTGG + Intronic
992611208 5:78510047-78510069 GGCTCCGGGGAGCCCCCGCCCGG + Exonic
994043458 5:95284112-95284134 GAGTCGGGGGAGCGTCCGCCAGG + Exonic
997402034 5:133611262-133611284 GAGCGCGGCGAGCCTCCGCGCGG - Intronic
997990805 5:138543134-138543156 GCCGCCGCGGAGCCGCCGCCGGG - Exonic
999316299 5:150586130-150586152 GGCCGAGGGGAGCCTCTGCCTGG - Intergenic
1001221209 5:169902594-169902616 GGCCCCAGGGAGCCTCAGCGGGG - Intronic
1002601083 5:180354119-180354141 GACCCGGGGGTTCCTACGCCTGG + Intergenic
1002887829 6:1312046-1312068 GCCCCCGCGGAGCCGCCGCAGGG + Intergenic
1004517952 6:16336672-16336694 GACTCAGGGGAGCCTGTGCCAGG - Intronic
1005587196 6:27288354-27288376 GACCCAGGGAAACCTCCGCCTGG - Intronic
1011684782 6:89815468-89815490 GACTCCTGGGAGCTTCCGCCAGG - Intronic
1018229708 6:161663847-161663869 GACCACGAGGAGCAGCCGCCGGG + Intronic
1018679701 6:166253573-166253595 GACCCCGGAGGGCCTTTGCCTGG - Intergenic
1018857441 6:167684834-167684856 CTCCCCGGGGACCCTCCTCCAGG - Intergenic
1018904713 6:168068964-168068986 GACACCTTGGAGCCTCCCCCTGG - Intronic
1018998189 6:168725986-168726008 CACTCCGGGGAGCCTGTGCCTGG - Intergenic
1019399480 7:844114-844136 CACCGCGGGGGGCCTCCTCCTGG + Intronic
1019417812 7:935319-935341 GTCCCCGGGTGGCCTCAGCCCGG - Intronic
1019478659 7:1256087-1256109 GACCCCAGAGAGCCCCCGGCCGG + Intergenic
1019522271 7:1466330-1466352 GACCCCAGTAGGCCTCCGCCAGG - Intergenic
1019592791 7:1844176-1844198 GTCCCCGGGGAGCCCCTGGCAGG - Intronic
1019662617 7:2233051-2233073 CACCCCTGGGAGACTCCGCACGG + Exonic
1020026202 7:4901785-4901807 GAGCCGGGGGAGCCTGCACCTGG + Intergenic
1024594414 7:50919966-50919988 GACCCTGGGGAGTCTTCCCCAGG + Intergenic
1026741990 7:72984619-72984641 GAGACCGCGGAGTCTCCGCCTGG - Intergenic
1026840580 7:73668228-73668250 GGCCCCGCGGAGCCACCCCCGGG + Intronic
1027101745 7:75380458-75380480 GAGACCGCGGAGTCTCCGCCTGG + Intergenic
1029927092 7:104329257-104329279 GACCCCGGGGCGCCCGAGCCGGG + Intronic
1032239652 7:130150746-130150768 GACCTCGGGGAGCCATGGCCCGG - Intergenic
1034275197 7:149820949-149820971 GGCCCCGGGGAGCCAGCACCAGG + Intergenic
1035482553 7:159198880-159198902 GACCCAGGCGAGGCTCTGCCTGG - Intergenic
1035747692 8:1973944-1973966 GACCCCGGGGAGGCAGCGGCGGG + Intronic
1037720468 8:21439348-21439370 AGCCCCGGGGAGCCTACCCCGGG - Intergenic
1042253062 8:66775388-66775410 GCCCCCGGGGTCCCTCCACCTGG - Intronic
1042560497 8:70069914-70069936 GACCCCGGGAAGCTCCCGCGCGG - Intronic
1043568253 8:81571366-81571388 GACCCTGGGGTGGGTCCGCCTGG + Intergenic
1059375341 9:113876450-113876472 GACCCCGGGGGGCCGGGGCCCGG + Intronic
1060152902 9:121299966-121299988 GCCCCTGGGGCGCCCCCGCCTGG - Exonic
1060300324 9:122371251-122371273 GACCCAGGGGCGCCCACGCCAGG + Exonic
1061092759 9:128435827-128435849 GACCCTGCGCAGCCCCCGCCTGG + Exonic
1062037142 9:134387393-134387415 GACCACGGGGAGCCTCGGGGAGG + Intronic
1062229547 9:135474183-135474205 GCCCCTGGGGAACCTCAGCCCGG - Intergenic
1062269541 9:135702282-135702304 GACCCCGGGGGGCGTCTGCCGGG + Exonic
1062649371 9:137567671-137567693 CACCCCGGGGAGCTTCCTCACGG - Intronic
1062649379 9:137567701-137567723 CACCCCGGGGAGCTTCCTCACGG - Intronic
1195269365 X:103215247-103215269 AACCCCAGGGACCCCCCGCCGGG - Intronic
1196444284 X:115737320-115737342 GGACCAGCGGAGCCTCCGCCAGG - Intergenic
1199220537 X:145311154-145311176 GAGGCTTGGGAGCCTCCGCCTGG - Intergenic
1200034275 X:153318095-153318117 CTCCCCGGGGAGCCTCAGGCAGG + Intergenic
1200239632 X:154486781-154486803 GACCCCGGGGGGACTCCTCCCGG - Intergenic