ID: 1105518114

View in Genome Browser
Species Human (GRCh38)
Location 13:21108844-21108866
Sequence GGGCACCGGGAAGCACTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105518114_1105518122 5 Left 1105518114 13:21108844-21108866 CCCTCAAGTGCTTCCCGGTGCCC 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1105518122 13:21108872-21108894 ATAACATACAACTTTCTTACTGG 0: 1
1: 0
2: 1
3: 18
4: 278
1105518114_1105518123 6 Left 1105518114 13:21108844-21108866 CCCTCAAGTGCTTCCCGGTGCCC 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1105518123 13:21108873-21108895 TAACATACAACTTTCTTACTGGG 0: 1
1: 0
2: 0
3: 10
4: 203
1105518114_1105518124 30 Left 1105518114 13:21108844-21108866 CCCTCAAGTGCTTCCCGGTGCCC 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1105518124 13:21108897-21108919 CTTCCTATGTTCTTTATAACTGG 0: 1
1: 0
2: 0
3: 8
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105518114 Original CRISPR GGGCACCGGGAAGCACTTGA GGG (reversed) Intergenic
900100948 1:961798-961820 GGGCACCGAGAGGCAGGTGAGGG - Intronic
900114044 1:1020989-1021011 GGGCTCCCAGAAGCACCTGAAGG - Intronic
900857783 1:5199914-5199936 GGCCAACGGGAAGTACTTGCAGG - Intergenic
901858891 1:12062020-12062042 GGGGATGGGGAAGCACTGGAAGG + Intergenic
903350679 1:22714613-22714635 GGGCAGCAGGGAGCCCTTGAAGG + Intronic
904353746 1:29925263-29925285 GGACAGCGGGGAGGACTTGATGG - Intergenic
905255022 1:36675143-36675165 GGGGACCGGGAAGCATGTGAGGG + Intergenic
905337966 1:37258312-37258334 GGGCACCGGGACACATTTGCTGG - Intergenic
905384874 1:37595685-37595707 GGGCTCCGAGGAGCACTGGAGGG - Intronic
905645926 1:39625158-39625180 GGGCACCTGGAGTCACTTGGGGG + Exonic
905865041 1:41372036-41372058 GGGCCCCGGGAAGGGATTGAGGG + Intronic
906533939 1:46541060-46541082 GAGCACCAGGAAGGACTGGAAGG - Intergenic
906665962 1:47622253-47622275 GGGCAAAGGGCAGCACTTAAAGG - Intergenic
908146180 1:61247118-61247140 GGGCACTGGGAAGAGCTAGATGG + Intronic
912044440 1:105437052-105437074 GGGCACCGGCAAGCATGGGAGGG + Intergenic
913228605 1:116722019-116722041 GTGAAATGGGAAGCACTTGAAGG + Intergenic
913438056 1:118867720-118867742 GGACACTGGGACGCATTTGAGGG - Intergenic
916430102 1:164719745-164719767 GGGCACTGGAAAGCACATGGGGG + Intronic
920352006 1:205343735-205343757 GGGCACGGTGAAGCACTGGCCGG - Exonic
922763590 1:228146667-228146689 AGGCACTTGGCAGCACTTGAGGG + Intronic
1062907209 10:1187151-1187173 TGCCACCGTGAATCACTTGAAGG - Intronic
1063301138 10:4849832-4849854 TGGCGCTGGGAAGCACTTAATGG + Intergenic
1064305756 10:14164525-14164547 GTGCACCGGGAATCACGGGATGG - Intronic
1067257886 10:44661848-44661870 GGGGACCGGGGAGCACATGAGGG - Intergenic
1067431491 10:46248860-46248882 GGGCACAGGGACACACTTGATGG - Intergenic
1067441922 10:46313325-46313347 GGGCACAGGGACACAGTTGATGG + Intronic
1069143892 10:64864062-64864084 AGGCAACAGGAAGCACTTGCTGG + Intergenic
1069901844 10:71710920-71710942 GGGCAGCAGGGAGCCCTTGAGGG + Intronic
1069915981 10:71787095-71787117 GGGCAACAGGAAGGCCTTGAAGG + Intronic
1070794893 10:79210751-79210773 GGGCAATGGGGAGCCCTTGAAGG + Intronic
1072957472 10:99900030-99900052 GGTCACCGGGATGAGCTTGAGGG - Exonic
1073065680 10:100757835-100757857 GGGCACAGGGGAGCTGTTGAGGG + Intronic
1073201112 10:101736661-101736683 GGGCACCGTGAAGCATCAGATGG + Intergenic
1074681526 10:115912062-115912084 GGACATCGGGAAGCATTTGGGGG + Intronic
1076712208 10:132343817-132343839 GAGCACGGGGAAGCACTGCAGGG - Intronic
1077168508 11:1154285-1154307 GGGCATAGGGAAGGGCTTGAGGG - Intergenic
1078081942 11:8210467-8210489 GGGCACTGAGAAGAACTTGGGGG + Intergenic
1079908833 11:26284118-26284140 GTGCAGTGGGAAGCAATTGAAGG + Intergenic
1080362822 11:31535729-31535751 GAGCACCAGGAAACACTTTATGG - Intronic
1081484245 11:43515712-43515734 GGGCCCCGGGCAGGACGTGAAGG - Intergenic
1084731102 11:71074174-71074196 GGGCACCGGGAAGGCCTTGCAGG - Intronic
1086452516 11:86931013-86931035 GGGCAATGGGAAGCCATTGAAGG + Intronic
1088738124 11:112745437-112745459 GGGCAGCGGGGAGCTCTTGAAGG + Intergenic
1089960579 11:122614095-122614117 GGGTCCCGGGAAGCCATTGAAGG + Intergenic
1090397071 11:126425894-126425916 GGAGACAGGGAAGCAGTTGAGGG + Intronic
1091624093 12:2109404-2109426 GGGCAGAGGGAAGAACATGAAGG + Intronic
1092732204 12:11545542-11545564 GGGCACTGGGAAGCCTTGGATGG - Intergenic
1093025046 12:14237970-14237992 GGGCAATGGGAAGCACTCAAAGG - Intergenic
1096224127 12:49853993-49854015 GGACACCGGGGAGCCTTTGAGGG - Intergenic
1098190055 12:67938451-67938473 GGGTACCGGGAAGCAAATGGGGG + Intergenic
1103459619 12:121093578-121093600 GGGCAGGGGGCAGCACTTGTCGG + Intergenic
1105518114 13:21108844-21108866 GGGCACCGGGAAGCACTTGAGGG - Intergenic
1112499064 13:99928509-99928531 TGGCACCTGGAAGCCCTAGATGG - Intergenic
1113871769 13:113564393-113564415 GGGCCGAGGGAAGCACTTGTGGG - Intergenic
1113922543 13:113921657-113921679 GGGCAGGGGGAAGCTGTTGATGG - Intergenic
1118005594 14:61562130-61562152 TGGCTCCAGGAAGCACATGAAGG + Intronic
1118322794 14:64763215-64763237 TGGCCCTGGGAAGCACTTGGGGG - Intronic
1119219626 14:72895214-72895236 GGGCACCGGGAAGCTCTGGGGGG + Intergenic
1119348173 14:73943409-73943431 GGGCACAGGGAAGCCACTGAGGG - Intronic
1119486745 14:74994170-74994192 GGGAACCGGGGAGCGCTTGTAGG + Intergenic
1119676428 14:76558905-76558927 GGACACAGGGATCCACTTGAAGG + Intergenic
1121330356 14:93045888-93045910 GGGCACTGGGGAGCGATTGAAGG - Intronic
1122737196 14:103849578-103849600 GACCAGCGGGAAGGACTTGAGGG - Intergenic
1122870523 14:104636109-104636131 GGGCCCCGGGAAGCAGAAGACGG + Intergenic
1202840208 14_GL000009v2_random:114415-114437 GGGCACTGGCAAGCACAGGAGGG + Intergenic
1202909589 14_GL000194v1_random:104612-104634 GGGCACTGGCAAGCACAGGAGGG + Intergenic
1129377775 15:75145067-75145089 GGGCACCAGCAAGCACCAGAGGG - Intergenic
1136229482 16:28878159-28878181 GGGCTCCGGGAAGAACTGGGGGG + Intergenic
1139486982 16:67263374-67263396 AGGCACTGGGAAGCATTTCAGGG + Intronic
1142690760 17:1605109-1605131 GGGCTGTGGGAAGCACCTGAGGG - Intronic
1147670246 17:42172891-42172913 GGGGACAGGCAAGGACTTGAGGG + Intronic
1147920745 17:43915457-43915479 GGGCACTGGGAAGCACTGTTGGG - Intergenic
1147980680 17:44272245-44272267 TGGCACGGGGGAGCACCTGAAGG + Intergenic
1151336236 17:73441231-73441253 GGGCAGAGGGAAGGATTTGAAGG - Intronic
1152042817 17:77915635-77915657 GGGCACCGGGGAGCCATGGAGGG - Intergenic
1152405500 17:80095885-80095907 GGGCACCGGGGACCAGCTGATGG + Intronic
1157591250 18:48837468-48837490 GGGCTGGGGGAAGCACCTGAAGG + Intronic
1157867010 18:51196604-51196626 GGGCACCGGGACGCACTCGGTGG + Exonic
1160946280 19:1645431-1645453 GGGCAGCGGGGAGCCCTGGATGG - Intronic
1161062768 19:2223336-2223358 GGGCACAGGGGAGCTCTTCAGGG - Exonic
1161714409 19:5867235-5867257 CGGCACCTGGAAGCCCTGGACGG - Exonic
1162914037 19:13865091-13865113 GCGCACCGGGACGCACTCGGGGG - Intronic
1163267330 19:16228912-16228934 GCTCACCGGGAAGGACTTGATGG - Exonic
1164710404 19:30353272-30353294 GGGCTCCGAGGTGCACTTGAAGG + Intronic
925944286 2:8846413-8846435 GGGAAACAGGAAGGACTTGAAGG + Intergenic
927030174 2:19112935-19112957 GGGCAACAGTAAGCATTTGAAGG - Intergenic
927275764 2:21261094-21261116 GGTCACAGGGAAGGACATGAAGG + Intergenic
929585372 2:43110688-43110710 GGGCAGCGGGAGGCAGTTGGAGG + Intergenic
930728964 2:54709499-54709521 GGGCACCGATAAGCCCGTGAGGG + Intergenic
931282214 2:60804492-60804514 GGGCACCGAGGAGCACAGGATGG - Intergenic
932298872 2:70649687-70649709 GGGCACGGGGAAGCCTTTGGGGG - Intronic
932598358 2:73108020-73108042 GGGCACTGGGAGGCACCTGAGGG - Intronic
933769293 2:85733107-85733129 GGGAACAGAGAAGCACTTGTGGG - Intergenic
934843283 2:97645307-97645329 GGGCAACGGGAAGCCATGGACGG + Intergenic
934985376 2:98881255-98881277 GGGCCCCAGGCTGCACTTGAGGG - Intronic
937021469 2:118660710-118660732 GGTTACCAGGAAGCTCTTGAAGG + Intergenic
937856340 2:126674424-126674446 GGGCAACAGGAAGGACCTGATGG + Intronic
940612252 2:156006593-156006615 GGGCACCAAGAAGCACAAGAGGG - Intergenic
940834232 2:158502548-158502570 GGGGACCGGGAAGAAGGTGAGGG - Intronic
943749881 2:191500393-191500415 GGGCATCTGGAAGCACTTAGGGG - Intergenic
944858033 2:203786231-203786253 GTGCACCATGAAGCATTTGAAGG + Intergenic
945062714 2:205923199-205923221 GGGGACCGGGCACCACTTTAAGG + Intergenic
947860335 2:233353779-233353801 AGGCAGCAGGAAGCCCTTGAGGG - Intergenic
948867537 2:240783350-240783372 GGGGACCCGGAAGCATTTCAGGG - Intronic
1168809853 20:698033-698055 GGGCACTGGGAGGCTCTGGAGGG + Intergenic
1170353306 20:15465781-15465803 GGGCACATGGGAGCACTTGTGGG - Intronic
1172170078 20:32924937-32924959 GGGCACAGTGAAGCATTTTAGGG + Intronic
1173790331 20:45824057-45824079 GGCCTCCGGGGAGCACGTGACGG - Exonic
1174343126 20:49910363-49910385 CGGCTCCGGGAAGTCCTTGATGG + Intronic
1175161310 20:57009886-57009908 GGGCAGCGGGGAGCAAGTGAAGG - Intergenic
1175907936 20:62390926-62390948 GGGCACCGAGGTGCACTTGCCGG - Exonic
1176628939 21:9119320-9119342 GGGCACTGGCAAGCACAGGAGGG + Intergenic
1178277416 21:31251809-31251831 GTGCACCAGGAAGTTCTTGACGG + Exonic
1178795906 21:35744183-35744205 AGGCACTGGGAAGCTATTGAAGG - Intronic
1179507513 21:41851685-41851707 GGGCAGCCGGCAGCACTTCAAGG + Intronic
1180605759 22:17057822-17057844 GGGAACCGGGAAGCCACTGAAGG - Intergenic
1181026915 22:20131979-20132001 GGCCACCGGGATGTACTTGGCGG - Exonic
1181316640 22:21974934-21974956 GGGCACCGGGCACCACTTTTGGG + Intronic
1182081105 22:27529378-27529400 GGGCACTGGGAAGCCATGGATGG + Intergenic
1184464285 22:44659725-44659747 GGGCACTGGGAAGGGCTTGGTGG + Intergenic
1184479145 22:44736997-44737019 GGGCGCCGGGGAGGACCTGAAGG - Exonic
950558555 3:13709212-13709234 GGGCACCTGGAGGAAATTGAGGG + Intergenic
952356961 3:32593276-32593298 GGGCAGCTGGAAGCAGTGGAGGG - Intergenic
954717674 3:52534371-52534393 TGGCACCGGGAAGCGCGGGAAGG - Intronic
955216125 3:56986252-56986274 GGGCACTGGGAAGCCTTTGCAGG - Intronic
956191263 3:66610442-66610464 GGGCATCGGGTTACACTTGAGGG + Intergenic
956507680 3:69960176-69960198 AGGGTCCGGGAAGCAGTTGATGG + Intronic
956841257 3:73142238-73142260 GGGCACCGGATAGAAATTGAGGG + Intergenic
961475697 3:127145085-127145107 GGGCACTGGGGAACACATGACGG - Intergenic
961644950 3:128387923-128387945 GGGCACGGGCAGGCACTGGATGG + Intronic
962066781 3:131989930-131989952 GGGCTCTGGGAAGCCATTGAAGG + Intronic
965765254 3:172123919-172123941 GGACACAGGGAATCAATTGATGG + Intronic
967770757 3:193331236-193331258 GGGCAGCTGGCAGCACTGGAGGG + Exonic
969673707 4:8603407-8603429 GGGCTCTGGGAAGTACTTGGGGG - Intronic
974235764 4:59179590-59179612 GGGCACCTACAAGCACTGGAGGG + Intergenic
974507020 4:62788969-62788991 GAGCACTGGGAAGCAGTTGCAGG + Intergenic
977925116 4:102691893-102691915 GGGCACAGAGAAGCATGTGAAGG + Intronic
979934105 4:126670408-126670430 GGGGTCCGGGACCCACTTGAGGG - Intergenic
982181063 4:152748763-152748785 GGGCACCGAGAAGCATGGGAGGG + Intronic
983919841 4:173333901-173333923 GGGCCCCGGGAGCCACTTGCTGG - Intronic
990936984 5:61162123-61162145 CTGCAACGGGTAGCACTTGACGG + Intronic
997322407 5:132989251-132989273 GGGCACAAGGAAGCTCTTGGGGG + Intergenic
998101596 5:139439409-139439431 GGGCAGCGGGGAGCGCTGGACGG - Exonic
1003397533 6:5765824-5765846 GGACACAGAGAAGCACATGAAGG - Intronic
1010790012 6:80053815-80053837 GGGCTCAGGGACCCACTTGAGGG + Intergenic
1011049392 6:83127520-83127542 GAGCACCGGGAAGGCCCTGAAGG + Intronic
1011785271 6:90836643-90836665 GGGCACGGGGATACACTTGCTGG + Intergenic
1012813310 6:103988844-103988866 TGGCACTGGGAAGCAATTGAAGG - Intergenic
1012889884 6:104885794-104885816 GGGCACCGACAAGCACAAGAGGG + Intergenic
1015184439 6:130398133-130398155 AGGCACCGGGGACTACTTGATGG - Intronic
1016310770 6:142731169-142731191 GGGCACAGGGAACAACTTGAAGG + Intergenic
1018655752 6:166034103-166034125 AGGCACCGGCAGACACTTGAAGG - Intergenic
1019379626 7:714053-714075 GGGCCGCGGGGAGCACGTGATGG - Intronic
1019633140 7:2060563-2060585 GGACACAGGGAAACACTGGAAGG + Intronic
1022360132 7:29649545-29649567 GTGCACTGGGGAGCACGTGAGGG + Intergenic
1022360253 7:29650152-29650174 GCGCACTGGGGAGCACATGAGGG + Intergenic
1027254922 7:76425144-76425166 TGGCACCGGGAAGCTCATCAGGG + Exonic
1031901485 7:127415973-127415995 GGGCACCGAGAAGCAGTTGTGGG - Intronic
1035704089 8:1661609-1661631 GGCCACCAGGAAGCAGATGATGG + Intronic
1035783491 8:2246519-2246541 TGGCACTGGGAGGCTCTTGAGGG + Intergenic
1035808632 8:2473067-2473089 TGGCACTGGGAGGCTCTTGAGGG - Intergenic
1038313191 8:26461746-26461768 GGGCACAGGTAAGAACTGGAGGG + Intronic
1039128114 8:34227898-34227920 GGGCACAGGGAAGCCATTGGAGG + Intergenic
1040357091 8:46629230-46629252 AGACACCGGGAACTACTTGAGGG + Intergenic
1042337098 8:67640343-67640365 GGGCACCAACAAGCACTGGAGGG - Intronic
1042566472 8:70117122-70117144 GGCCACCAGGATGCACGTGAAGG + Intronic
1043415078 8:80039637-80039659 GGGCAATGGGAAGCCATTGAAGG - Intronic
1047203263 8:122783181-122783203 GGCCACCGCGAAACAGTTGAAGG - Intronic
1048614166 8:136056340-136056362 GAGCAACAGGAAGCATTTGAAGG - Intergenic
1049020487 8:139954159-139954181 GGGCACAGGGAAGCTTTTGGGGG + Intronic
1049199297 8:141332043-141332065 GGTCACCAGGAAGCAGGTGAAGG - Intergenic
1049255618 8:141612143-141612165 TGGCCCCAGGCAGCACTTGAAGG - Intergenic
1049585665 8:143431332-143431354 GGGCACCGGGAAGCACGGGGCGG + Intergenic
1049683504 8:143930179-143930201 GGGCACCAGGAAGCACACGGAGG + Exonic
1053473035 9:38360321-38360343 AGGCAACGGCAAGCACTTGGTGG - Intergenic
1059406392 9:114100271-114100293 GGGAACCAGGAAGCCATTGAAGG + Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061175972 9:128997362-128997384 GGGCACTGGGAAGCCTTTCAAGG + Intronic
1061759951 9:132843653-132843675 GGGCTCCTGGAAGCAGTGGAGGG + Intronic
1062266919 9:135690751-135690773 GGGCACCGGGAACCACTGCAGGG + Intergenic
1062694312 9:137865343-137865365 GGGCAACGGGCTGGACTTGATGG + Intronic
1203751786 Un_GL000218v1:87001-87023 GGGCACTGGCAAGCACAGGAGGG + Intergenic
1186264955 X:7822522-7822544 CTGCACTGGAAAGCACTTGAGGG + Intergenic
1190193049 X:48293590-48293612 GGGCTCCGGGAACCACCTTATGG + Intergenic
1196871921 X:120120659-120120681 GAGGACCGGGAAGAACTTAATGG + Intergenic
1198166408 X:134062094-134062116 GGGCTCAGAGATGCACTTGAGGG + Intergenic
1198744905 X:139879913-139879935 GGGCACCTGGAAGGACTTCTGGG + Intronic
1201165441 Y:11204621-11204643 GGGCACTGGCAAGCACAGGAGGG + Intergenic