ID: 1105518438

View in Genome Browser
Species Human (GRCh38)
Location 13:21110993-21111015
Sequence GGTTAGATCAGGGTGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105518438 Original CRISPR GGTTAGATCAGGGTGCTGGC AGG (reversed) Intergenic