ID: 1105520291

View in Genome Browser
Species Human (GRCh38)
Location 13:21125122-21125144
Sequence TTGTCATTCTTCAGGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105520291_1105520296 2 Left 1105520291 13:21125122-21125144 CCCTTTGTCCTGAAGAATGACAA 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1105520296 13:21125147-21125169 AGTCCACTGTAGGGTCCCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 122
1105520291_1105520295 -7 Left 1105520291 13:21125122-21125144 CCCTTTGTCCTGAAGAATGACAA 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1105520295 13:21125138-21125160 ATGACAAATAGTCCACTGTAGGG 0: 1
1: 0
2: 0
3: 28
4: 355
1105520291_1105520294 -8 Left 1105520291 13:21125122-21125144 CCCTTTGTCCTGAAGAATGACAA 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1105520294 13:21125137-21125159 AATGACAAATAGTCCACTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105520291 Original CRISPR TTGTCATTCTTCAGGACAAA GGG (reversed) Intergenic
905914215 1:41673945-41673967 TTGTCTTTCTTCTGCAGAAAAGG + Intronic
912764240 1:112394519-112394541 TTGTCAGTTTTCAGAACACAAGG + Intergenic
914696343 1:150084501-150084523 TTGTCATTTCTCAGGAAACATGG - Intronic
915627173 1:157121915-157121937 TACCCATTCTTCAGGAAAAAAGG + Exonic
916552065 1:165859036-165859058 TTTTCATTCTTCAAAACACACGG - Intronic
917524263 1:175773367-175773389 TTCTCAGTTTTCAGGACAAAAGG - Intergenic
917623923 1:176826703-176826725 TTGCCATTTTTCAGGTCAACTGG + Intronic
918845191 1:189600729-189600751 TTGTCTTTCTCCAAAACAAAAGG - Intergenic
920268115 1:204742162-204742184 ATGTCATTCCTCAGGTCACAAGG + Intergenic
921105766 1:211976207-211976229 TTGTCATTCTTAAGTAGAAATGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921705515 1:218318429-218318451 TATTCATTCTTCAAGACAACTGG - Intronic
921705518 1:218318463-218318485 TATTCATTCTTCAAGACAACTGG - Intronic
921706314 1:218325655-218325677 TTGTAAAACTTCAGGACAACAGG - Intronic
922903739 1:229158179-229158201 TTGTCAATCTTCAGACCTAAAGG - Intergenic
924466088 1:244300319-244300341 TTGTCATTTCTCAGGAGAAGGGG + Intergenic
1067485431 10:46645258-46645280 TTGTTATTCATGAGGACCAATGG - Intergenic
1067609329 10:47696406-47696428 TTGTTATTCATGAGGACCAATGG + Intergenic
1067817629 10:49494526-49494548 ATCTGATTCTTCAGGAAAAAGGG - Intronic
1068499158 10:57821156-57821178 TTTTCATTGTTCAGGACATCTGG - Intergenic
1069726859 10:70585729-70585751 TTCTCCTTCTGCAGGACAGAGGG - Intergenic
1071624918 10:87158051-87158073 TTGTTATTCATGAGGACCAATGG + Exonic
1071864533 10:89712624-89712646 TTTTCAGTTTTGAGGACAAATGG + Intronic
1074477846 10:113788895-113788917 TTGTGATTCTTCTGGGCAATAGG - Intergenic
1074805084 10:117041610-117041632 ATGTAACTCTTCAAGACAAAGGG - Intronic
1075612185 10:123863230-123863252 TTGTCATTCTTACGGACAATGGG - Intronic
1076623068 10:131805209-131805231 TTGTTATTATTAAGGATAAAGGG + Intergenic
1077268220 11:1662517-1662539 CTGTTATTCTTCACTACAAAAGG - Intergenic
1077272662 11:1689101-1689123 CTGTTATTCTTCACTACAAAAGG + Intergenic
1079250939 11:18787452-18787474 TTCTCATTCTTCAGGTCTATAGG + Intronic
1080885076 11:36360175-36360197 TTGTCATTCTACTAGACACAAGG - Intronic
1082077284 11:47984033-47984055 TTGTTTTGCTTCAGGACAACGGG + Intronic
1084982851 11:72841159-72841181 TTGTATTTTTTCTGGACAAAGGG - Intronic
1086169832 11:83823538-83823560 TTCTGAATCTTCAGGACAGAAGG + Intronic
1087748406 11:101976918-101976940 TATTCATTCTTCTAGACAAATGG + Intronic
1090963010 11:131573766-131573788 TTCTCACTCTTCAAGAGAAAGGG - Intronic
1091199207 11:133760001-133760023 GTGTTATTCTTTAGGACATAAGG - Intergenic
1093048758 12:14483801-14483823 TTTGAATGCTTCAGGACAAAGGG + Intronic
1094253359 12:28392846-28392868 TTCTACTTCTTCAGGTCAAAAGG - Intronic
1096455852 12:51785506-51785528 TTGTCACTCATCAGGACATGTGG - Intronic
1097630037 12:62049609-62049631 TTGTCAATCTTTATGAAAAAAGG - Intronic
1098431930 12:70429117-70429139 TTGTCAATCTTCAGGGAAAATGG + Intronic
1098974774 12:76890990-76891012 TTGTGATTCTGCAGGAGCAAAGG - Intergenic
1099238057 12:80105563-80105585 TTTTCACTCTTCAGGTGAAAAGG - Intergenic
1101014847 12:100489667-100489689 TTCTCACTCTTCAGTATAAAAGG - Intronic
1101863726 12:108504014-108504036 TTGTCTCTTTTCAGGGCAAATGG - Intergenic
1102078544 12:110079597-110079619 GTGACATTCTTCAGCAGAAAAGG + Intergenic
1103464290 12:121129436-121129458 GTGACATTCTTCAGCAGAAAAGG - Intergenic
1105435606 13:20375595-20375617 TTCTCATTGTTCAGGCCAAAAGG - Intergenic
1105520291 13:21125122-21125144 TTGTCATTCTTCAGGACAAAGGG - Intergenic
1106473334 13:30077156-30077178 ATGTCATCCTTCATGGCAAAAGG - Intergenic
1107526619 13:41238966-41238988 GGGACATTCTTCAAGACAAATGG + Intronic
1107658360 13:42614552-42614574 TGGTGATTCTGCAGAACAAAGGG - Intergenic
1107812579 13:44214599-44214621 TTGTCATTGTTCAGAAAAGATGG - Intergenic
1108023559 13:46154657-46154679 TTGTCATACTTCAGGGATAAAGG - Intronic
1108246073 13:48515658-48515680 TAGTTCTTCTTCAGAACAAAGGG + Exonic
1108806666 13:54165474-54165496 TTTTCATTCTACAGCACCAATGG - Intergenic
1108845506 13:54674876-54674898 TTGTCTTTCTTCTGTTCAAATGG + Intergenic
1109288664 13:60445306-60445328 TTGTCTTTCATCAGGAGAAATGG + Intronic
1110538479 13:76680244-76680266 TTGACATACTTTGGGACAAAAGG - Intergenic
1111282015 13:86038913-86038935 TTGGAATTCTTCTGGAAAAAAGG + Intergenic
1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG + Intronic
1114072866 14:19128767-19128789 TTATCATTCTTTAGACCAAAAGG + Intergenic
1114089394 14:19271205-19271227 TTATCATTCTTTAGACCAAAAGG - Intergenic
1115771982 14:36673216-36673238 CTGTCTTTCTGCAGTACAAAGGG + Intronic
1115967458 14:38907550-38907572 ATGTCATTCTTCAGGATGATAGG - Intergenic
1117327605 14:54683716-54683738 TTTTTATTCTTCAAGGCAAAAGG + Intronic
1119198503 14:72735201-72735223 TTTTCATATTTCAGGATAAAAGG + Intronic
1120726913 14:87954016-87954038 TTGTTATTCATGAGGACCAATGG + Intronic
1122556726 14:102584501-102584523 TTGTCACTCTTGTGGACAAGGGG + Intergenic
1122607631 14:102957987-102958009 TGGACATTCTGCAGGACAACTGG + Intronic
1125057036 15:35372645-35372667 TTGTCATTCTTCTGGAGAACTGG + Intronic
1126117747 15:45224405-45224427 TTGTAATTCTACAGAACATACGG + Intergenic
1126192883 15:45897495-45897517 ACATCATTCCTCAGGACAAAGGG - Intergenic
1130447660 15:84018577-84018599 TTCTCATTTTTCTGCACAAATGG - Intronic
1130928683 15:88404583-88404605 TGGTCATGCTTCAGTTCAAAAGG + Intergenic
1132067793 15:98746678-98746700 TTGTCATTGTTCAAGTCACAAGG + Intronic
1202974245 15_KI270727v1_random:273373-273395 TTCTCATTATTCAGGACCCAAGG + Intergenic
1133962339 16:10505528-10505550 TTGTGATTCTTCAGGCCATCTGG - Intergenic
1137266758 16:46875214-46875236 TATTCATTCTTCAGAAGAAACGG - Intergenic
1137446828 16:48537026-48537048 CTGTCAGTCTTCAGGGCACAGGG - Intergenic
1138871689 16:60895758-60895780 TCGGCATTCTTCAGGCCACAGGG - Intergenic
1139247425 16:65459525-65459547 TTATCTTTGTTCAGGACACAGGG - Intergenic
1140156623 16:72435502-72435524 ATGTAATTCTTCAGGATCAATGG + Intergenic
1140968848 16:79993651-79993673 TTTTCAATGTTCAGTACAAATGG - Intergenic
1143886189 17:10066731-10066753 CTGTCATTCTGCAGGACATCAGG + Intronic
1147825420 17:43267239-43267261 TGGTCTTTCTTCAGGAAAACGGG - Intergenic
1148997868 17:51727266-51727288 TTTTAATTCTTCAGGAGGAAAGG + Intronic
1150446063 17:65227769-65227791 TCTTCAATCTTCTGGACAAAGGG + Intergenic
1153096739 18:1415025-1415047 ATGTCAATCTTCATGGCAAAGGG - Intergenic
1153120592 18:1721469-1721491 TTGTCTATCTTCATGACAAATGG + Intergenic
1153378183 18:4405618-4405640 ATGTCAATCTTCAGAACAATAGG - Intronic
1154219510 18:12440017-12440039 TTTTCAGTCATCAGGACAAAAGG + Intergenic
1157801770 18:50626943-50626965 TTGTTAATCTGCAAGACAAATGG + Intronic
1159035268 18:63271324-63271346 TTGTCATTCATCTGGAGAAGGGG - Intronic
1159634437 18:70788281-70788303 TACTCATTCTTCAGGAAGAAAGG - Intergenic
1163578720 19:18125333-18125355 TTGTGAATTTGCAGGACAAAGGG - Intronic
1164519235 19:28965263-28965285 TGGACACTCTCCAGGACAAAAGG + Intergenic
929126535 2:38527583-38527605 TAGTTATTCTACCGGACAAATGG + Intergenic
929300692 2:40300691-40300713 TTGTCATTCTTAGGGCCAGAAGG - Intronic
930357244 2:50336837-50336859 TTGTGATTCTTAAGTACACAGGG - Intronic
930947285 2:57090715-57090737 TTGTCTTACTTGAGGAAAAATGG - Intergenic
931682656 2:64764834-64764856 TTGTTACTCTTCAGTACAATAGG - Intergenic
931976739 2:67651678-67651700 TTGCCATTCTTGAAGCCAAAAGG - Intergenic
932597171 2:73101242-73101264 GTGACAGTCTTGAGGACAAATGG + Intronic
932644991 2:73490847-73490869 TTGGCATTGTTCAAGAGAAATGG - Exonic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
935772030 2:106434315-106434337 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
935795680 2:106639327-106639349 TGGTCAACCTTCAGTACAAAGGG - Intergenic
935908039 2:107861631-107861653 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
935994447 2:108753862-108753884 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936129830 2:109826738-109826760 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936214867 2:110544747-110544769 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
936424004 2:112399310-112399332 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
936963132 2:118098039-118098061 TTATCATTCTCCAAGAGAAAAGG + Intronic
937487087 2:122326467-122326489 TTCTCATCCTTCATGACAGAAGG + Intergenic
937648967 2:124298756-124298778 TTGTCATACTTCAAGACCCAGGG + Intronic
939444130 2:142287098-142287120 TTGGCATTATTCAGGTAAAATGG + Intergenic
940557343 2:155247310-155247332 TTGAAATTCTTCAAGACAAAAGG + Intergenic
942511265 2:176704595-176704617 TAGTAATTCTCCAGGATAAAAGG - Intergenic
943053711 2:182948499-182948521 TTCTCATTCTTGAGAAGAAATGG - Intronic
945422954 2:209661313-209661335 TAGTCATTTTGCAGGAGAAATGG - Intronic
946912016 2:224472658-224472680 TTGTAATTCTACAGTACAGATGG + Exonic
947497182 2:230646348-230646370 TTCTCATTCCTCATTACAAAAGG + Intergenic
948207843 2:236172206-236172228 ATGTCTTTCTCCAGGACAAAAGG + Intergenic
948828134 2:240584032-240584054 ATGTCATTCTTCAGGGCTGAGGG + Intergenic
1171033738 20:21700164-21700186 TTGTCTTTAATCAAGACAAAGGG + Intergenic
1171979611 20:31618324-31618346 TTGACATTCTTCCTGTCAAAAGG - Intergenic
1173698085 20:45039558-45039580 TTGTCATTTTTCATGTAAAATGG + Intronic
1174236614 20:49098658-49098680 TTTTCCTTCTTCAGTTCAAAAGG + Intergenic
1174935099 20:54858789-54858811 TTGCCATTCTTTATCACAAAGGG + Intergenic
1175651534 20:60728867-60728889 CTGGCATTCTTCAGGACAGAAGG - Intergenic
1177040466 21:16103900-16103922 TGGTCATTCTTACGTACAAATGG - Intergenic
1179434139 21:41348577-41348599 TATTCAGTCTGCAGGACAAAGGG - Exonic
1179603926 21:42499760-42499782 TTGTCCTTCTTAAGTATAAATGG + Intronic
1180491312 22:15851142-15851164 TTATCATTCTTTAGACCAAAAGG + Intergenic
1181402160 22:22656522-22656544 TTATCAGCCTTCAGGACAGAAGG - Intergenic
1182581486 22:31315038-31315060 TTGTTTTACTTCAGAACAAAGGG + Intergenic
951073247 3:18357944-18357966 TTATGATTCTTCATGAAAAAAGG - Intronic
951244506 3:20324842-20324864 ATGTCATTCATCAAGACAATGGG - Intergenic
953964196 3:47290218-47290240 GTGTCATTCTTGAGCACAGAGGG + Intronic
957923869 3:86782440-86782462 TTTTCATTTTTCATGTCAAATGG - Intergenic
957963330 3:87289270-87289292 ATGTCATTCTTATGGTCAAATGG - Intergenic
958454303 3:94310069-94310091 TTGTCACTCTAAAAGACAAACGG + Intergenic
959074102 3:101732360-101732382 TTGTCACTTTTCAGAACAAGAGG + Intronic
959231684 3:103662419-103662441 TAGTCATACTTCAGTTCAAAAGG + Intergenic
959941067 3:112081672-112081694 TATTCATTCTTAAGTACAAAAGG + Intergenic
961051457 3:123750590-123750612 CTGTCTTTCTGCAGGATAAAGGG - Intronic
962285364 3:134081379-134081401 ATGTCACCCTGCAGGACAAAGGG + Intronic
962402785 3:135075587-135075609 TTGTGCTTCTTCAGGAATAAGGG + Intronic
963609620 3:147450094-147450116 TTGTCACTATGGAGGACAAATGG - Intronic
964727066 3:159824416-159824438 TTGTCATTTATCTGGACAGAAGG + Intronic
964835195 3:160930321-160930343 TTGTATGTCTTCAGGGCAAAGGG - Intronic
965005330 3:163015192-163015214 TTTTCATTCTTAAGCAGAAATGG + Intergenic
965433368 3:168616822-168616844 TTCTCATTCTTCATGAGAAATGG + Intergenic
966362378 3:179144155-179144177 TTAAAATTCTTCAGGATAAAGGG + Intergenic
967713376 3:192735446-192735468 TTGTGATTCTTCAGAAAGAAGGG - Intronic
967964989 3:194954018-194954040 TTGTCAGTCTAGAGGAGAAAGGG + Intergenic
970589176 4:17544480-17544502 TTGTCATTGTTCCTCACAAAGGG + Intergenic
970739519 4:19218235-19218257 TTGTCATACTCAAGGATAAAAGG - Intergenic
971274886 4:25186431-25186453 TGGTCATTCTTCAGAATTAAGGG - Intronic
972259202 4:37391543-37391565 TTCTCATTTTCCATGACAAAAGG - Intronic
977058820 4:92229999-92230021 TTGTCATTCAGAAGAACAAAAGG + Intergenic
978108617 4:104934173-104934195 TTGACATTCTTCAGGAATATTGG - Intergenic
978417186 4:108488914-108488936 TTGTCATTCCTGAGGACAATTGG + Intergenic
978547386 4:109886265-109886287 TTCTCTTTCTTCTGGACAAATGG + Intergenic
979213318 4:118132822-118132844 TTGACATACTCTAGGACAAAAGG - Intronic
980257816 4:130403971-130403993 TTGTCTTTCTTAAAGTCAAATGG + Intergenic
981421477 4:144555379-144555401 TTGGCATTCTTGTGGACAGATGG + Intergenic
981752739 4:148108423-148108445 ATGTCATTCTTTAGGTCAAAAGG - Intronic
982719549 4:158845916-158845938 GTGTCATTCAGCAGGAAAAAAGG + Intronic
983394242 4:167173137-167173159 CTTTCATTCTTCAGGATGAAAGG + Intronic
984264145 4:177476262-177476284 TTGTCATTCTTCTGGAATCAAGG + Intergenic
984381927 4:179005295-179005317 TTATAATTCTGCAGGTCAAATGG - Intergenic
984613599 4:181869725-181869747 TTGACATTCTTCAGAAAAAAGGG + Intergenic
985203575 4:187508352-187508374 TTCAAATTCTTCAGGCCAAAAGG - Intergenic
986385447 5:7229003-7229025 TTAACATACTTCAGGACTAATGG + Intergenic
986551424 5:8960235-8960257 TTGTCATCATTCAGAAGAAAAGG - Intergenic
986586662 5:9325021-9325043 TTGCCATTCTTCAGGGAAAAAGG + Intronic
988717459 5:33842111-33842133 TTCTCAATCTCCAGAACAAAAGG + Intronic
992518173 5:77518435-77518457 TTATTATTCTGCAGGGCAAATGG + Intronic
992537377 5:77721442-77721464 TTGTCATTCTTTTGTACAAAAGG - Intronic
994991544 5:107003119-107003141 TTATCATTCTTCAGAACATTAGG + Intergenic
995805322 5:116045905-116045927 TTTTAATTCTAAAGGACAAATGG + Intronic
995837759 5:116415263-116415285 TTGTCAAGCCTCAGGACTAAAGG - Intergenic
1001405591 5:171474781-171474803 TAGGCCTTCTGCAGGACAAATGG + Intergenic
1001907632 5:175486230-175486252 GTGTCATACTTCAAGAAAAATGG + Intronic
1002504503 5:179669778-179669800 GTCTCATGCTTCAGGACACAAGG + Intergenic
1005175201 6:23036746-23036768 TTGCAATGCTTCAGGACAGAGGG + Intergenic
1006423545 6:33950034-33950056 TGGCTATTCTTCAGGACAAGGGG + Intergenic
1009389366 6:63127122-63127144 TTGACATTTTTCATGATAAAAGG + Intergenic
1009488953 6:64262910-64262932 TCTTTATTCTTCAGGAAAAAGGG + Intronic
1010063093 6:71646861-71646883 TTGTTATTCATCAAGACAATGGG - Intergenic
1010132988 6:72517201-72517223 GTGTCATTCTTCAGGTCCCAAGG + Intergenic
1011351871 6:86432666-86432688 TTGTGACTCATCAGGACCAAAGG - Intergenic
1011888759 6:92130104-92130126 TTGTGACTCTTCAGAAGAAATGG + Intergenic
1012896477 6:104955380-104955402 TTGTTATTTCTCAGGAAAAAGGG - Intergenic
1014041174 6:116827547-116827569 TTGTCACTCATCAAGAGAAATGG - Intronic
1015343479 6:132129213-132129235 TTGTGATTTTTCAAGAGAAATGG - Intergenic
1015871122 6:137777418-137777440 TTTTTTTTCTTCAGTACAAACGG - Intergenic
1017132075 6:151116096-151116118 TTGTCATTCTCAACCACAAATGG + Intergenic
1017656619 6:156635327-156635349 TTGTCAGTTTTCAGTACTAATGG + Intergenic
1017884707 6:158589057-158589079 TTTTAATTCTAAAGGACAAAAGG + Intronic
1018231672 6:161681844-161681866 TTCTCGTTCTTCATGCCAAAGGG + Intronic
1020502341 7:8939099-8939121 ATGTCATTTTTCAGGAGAATGGG + Intergenic
1022864221 7:34400446-34400468 TTGGCATTCTTCTAAACAAATGG - Intergenic
1024063676 7:45716364-45716386 TTTCCTCTCTTCAGGACAAATGG + Exonic
1025797489 7:64753052-64753074 TTGTCATGCTTTAGGGCACAGGG + Intergenic
1025935626 7:66034073-66034095 TTGTTTCTCTTCAGGACCAACGG + Intergenic
1027447229 7:78288465-78288487 TTTTAATTCTTCAGGAAATACGG + Intronic
1027841871 7:83323069-83323091 TCGTCATTATTCTGTACAAATGG + Intergenic
1028354665 7:89891651-89891673 GTGACATATTTCAGGACAAAAGG + Intergenic
1028451898 7:90994479-90994501 TTGACATTCTTATGTACAAATGG - Intronic
1031485506 7:122318379-122318401 TAGTTACACTTCAGGACAAAAGG + Intergenic
1034145285 7:148865600-148865622 TTCTCATTCTAGAGGAAAAATGG + Intronic
1034237366 7:149582750-149582772 TTGACATTCCTGAGGACAAAAGG - Intergenic
1034237374 7:149582816-149582838 TTGACATTCCTGGGGACAAAAGG - Intergenic
1034239591 7:149599619-149599641 TTGACATTCCTGAGGACAGAAGG - Intergenic
1034240391 7:149606194-149606216 TTGACATTCCTGAGGACAGAAGG - Intergenic
1035293050 7:157851945-157851967 TTGTCAATCTTTAGGAAAACGGG - Intronic
1037408036 8:18564808-18564830 TGGTCATACCACAGGACAAAAGG + Intronic
1041270854 8:56107408-56107430 TTGTGATTCTTCAGGCCATCTGG - Intergenic
1041643517 8:60228346-60228368 TACCCATTCTTCAGGAGAAATGG + Intronic
1042886399 8:73557109-73557131 TTGTTATTATACAGGACTAATGG + Intronic
1043525180 8:81088852-81088874 TTATCATCCTTAAGGAAAAAAGG + Intronic
1043790249 8:84457133-84457155 TTGTCATTCTGAAGCATAAATGG + Intronic
1044165200 8:88973894-88973916 ATGTCTTTCTTCAGAACAAAGGG - Intergenic
1045922004 8:107541481-107541503 TTAACATTTTTCAGAACAAAAGG + Intergenic
1047616294 8:126565191-126565213 GTGGCTTTCTGCAGGACAAATGG + Intergenic
1048108498 8:131439867-131439889 TAGTCTTTCTTCAGGCCCAAAGG - Intergenic
1048766423 8:137849001-137849023 CTGTGACTCTTCAGGACAAATGG + Intergenic
1050252110 9:3755886-3755908 TTGTCCTACTTTAGGACAAAAGG - Intergenic
1050879237 9:10678412-10678434 GTCTCATTCTTCAGGAAATAGGG + Intergenic
1051123325 9:13775627-13775649 TTGTCTTTCTTCAAGACCATTGG + Intergenic
1051972742 9:22910743-22910765 ATGTCATTTTACATGACAAAGGG + Intergenic
1052984847 9:34479343-34479365 TTCTCATTCTGCAAGACCAAGGG + Intronic
1056678202 9:88694823-88694845 TTGTCATTATTCAGGAGTGAAGG + Intergenic
1057595450 9:96412129-96412151 TTCTCATTGTTAAGGCCAAAAGG - Intronic
1057617973 9:96609422-96609444 TTCTCAGTCTTCAGGGAAAAGGG + Intronic
1059612679 9:115916318-115916340 TTACCTTTCTTCAGGACTAAGGG + Intergenic
1188119664 X:26288255-26288277 TTGGCATGCATGAGGACAAAAGG - Intergenic
1188435824 X:30157412-30157434 ATGTCAAACTTCAGGAGAAAAGG + Intergenic
1191128459 X:56983100-56983122 TTGTAATTTTGCATGACAAATGG - Intronic
1193449129 X:81645049-81645071 ATGTCAATCTTCAAGACAATGGG + Intergenic
1193469525 X:81882493-81882515 TTGTCATTCTTGAAGGAAAAGGG + Intergenic
1194004168 X:88470050-88470072 TTGTCTTTCTTCAGTTCACAGGG - Intergenic
1194750099 X:97674329-97674351 TTGTCATACTTGAGGGTAAAGGG + Intergenic
1194964607 X:100273026-100273048 TTGTTTTTTTTCAGTACAAAAGG - Intergenic
1195350265 X:103988921-103988943 TTGTCCTTCTCCAGCTCAAAAGG - Intergenic
1196991813 X:121337618-121337640 TTCTTATACTACAGGACAAATGG + Intergenic
1197056830 X:122131875-122131897 TTTTCCCTCTTCAGGAGAAAGGG - Intergenic
1197250644 X:124212994-124213016 ATTTTATTCTTCAGGGCAAAGGG - Intronic
1198632581 X:138657281-138657303 TTGTGTTTGTTCATGACAAATGG - Intronic
1200943862 Y:8811982-8812004 TTTTCATTGATCAGTACAAAAGG - Intergenic