ID: 1105528997

View in Genome Browser
Species Human (GRCh38)
Location 13:21201293-21201315
Sequence CAAAATGCTGATAGTGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 38, 1: 78, 2: 68, 3: 54, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105528997 Original CRISPR CAAAATGCTGATAGTGATAT AGG (reversed) Intergenic