ID: 1105530588

View in Genome Browser
Species Human (GRCh38)
Location 13:21215569-21215591
Sequence CAAACCTGACACTTTGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 2, 1: 1, 2: 0, 3: 8, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105530585_1105530588 6 Left 1105530585 13:21215540-21215562 CCAAGGGGAGAGGAGGCTGCAGG 0: 1
1: 0
2: 14
3: 108
4: 864
Right 1105530588 13:21215569-21215591 CAAACCTGACACTTTGATCCTGG 0: 2
1: 1
2: 0
3: 8
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105530588 Original CRISPR CAAACCTGACACTTTGATCC TGG Intergenic
903150271 1:21403063-21403085 CAAATCTGACACCTTGAACTTGG - Intergenic
903854575 1:26329125-26329147 CTAACCTGGCACTCTGAGCCAGG + Intronic
906669543 1:47644606-47644628 CAAAACTATCACTTTGATACTGG + Intergenic
909112881 1:71502659-71502681 CAAACCTGAAACTGTTATTCAGG + Intronic
909329554 1:74395446-74395468 CAAACCTGAGACTGTTATTCAGG + Intronic
909714436 1:78690971-78690993 CAAACCTGAAACACTGATGCTGG + Intergenic
912604741 1:110978168-110978190 CTAATCTGACACATTGATCTAGG + Intergenic
913486687 1:119338133-119338155 CCATGCTGACACTTTGATCTTGG - Intergenic
914989438 1:152485709-152485731 CAAACCTGAGACTGTTATTCAGG - Intergenic
915565442 1:156710355-156710377 CAACCCTGCCACTGTGGTCCAGG + Intergenic
915704548 1:157831694-157831716 CAACCCTGACCCTTTGACACTGG - Exonic
917017339 1:170548116-170548138 CAAATCTGACACCTTGATTTTGG - Intronic
919021401 1:192110297-192110319 CACTGCTGACACTTTGATCTTGG - Intergenic
920156132 1:203953182-203953204 CAACCCTGGCACCTTGATCTTGG - Intergenic
921298260 1:213724602-213724624 AAAGCCTGACAGTTTGAGCCAGG + Intergenic
921857679 1:220004597-220004619 CAAAGATGACACCTAGATCCTGG + Intronic
922150184 1:222995143-222995165 AAACACGGACACTTTGATCCTGG - Intronic
924078969 1:240372300-240372322 CAAATCTGACAGATTGATACTGG + Intronic
924758523 1:246963792-246963814 CAATCCTGACACTATGTACCTGG + Intronic
1063021258 10:2130557-2130579 CAAATTTGACAGTTTGATCATGG - Intergenic
1065578134 10:27144452-27144474 CAAACCTGCTATTTTGTTCCTGG + Intronic
1067672359 10:48334569-48334591 CAAACCTGAGACTGTTATTCAGG - Intronic
1069041410 10:63699389-63699411 CACACCTGTCACTTTCATCCAGG + Intergenic
1069568972 10:69482942-69482964 CAACCCTGCCACCTTGATCTTGG - Intronic
1069943509 10:71970898-71970920 GAAACCTGACATTTTTGTCCAGG - Intronic
1071128163 10:82359911-82359933 TAAACCTGGCTCTTGGATCCAGG - Intronic
1071203661 10:83249887-83249909 TAAACATAACACTTTGATTCTGG - Intergenic
1078168751 11:8912257-8912279 CAAGCCTGTCTCTTAGATCCTGG + Intronic
1078986317 11:16603299-16603321 CAGACCTGACACTGGGATCTGGG + Intronic
1083888556 11:65584582-65584604 CAAATCTGACACTGAGAGCCTGG - Intronic
1084025136 11:66443375-66443397 CAAACCTGAGACTGTTATTCAGG - Intronic
1084547796 11:69822985-69823007 CAAAGCTGGCACTTTGCTTCTGG + Intergenic
1085608742 11:77927063-77927085 CAAAACTGCCACTTTAACCCAGG - Intronic
1086599603 11:88616820-88616842 CAAAACTGAGCCTTAGATCCAGG - Intronic
1086908505 11:92445101-92445123 CTGACCTGACACTGTGATCTTGG + Intronic
1088271162 11:108035842-108035864 GAAACCTGACACTCTGCTACTGG - Intronic
1089267145 11:117272264-117272286 AAAACCTCAAACTTTGGTCCAGG - Intronic
1089757815 11:120699251-120699273 TAAAGCAGACAATTTGATCCAGG - Intronic
1091388659 12:111681-111703 CAAACCTGAAACTGTTATTCAGG - Intronic
1091556268 12:1575838-1575860 CAAACCTGACCCCAGGATCCAGG - Intronic
1092107931 12:5936550-5936572 GAATGCTGACACCTTGATCCTGG + Intronic
1098181939 12:67856522-67856544 GAAACCTCACACTTTGAAACTGG + Intergenic
1098756355 12:74368264-74368286 GAAACCTGACACTCAGATCTTGG + Intergenic
1099415426 12:82379584-82379606 CAAACTTGAAACTTTATTCCAGG + Intronic
1100555481 12:95689019-95689041 CAAACCTCACACATTCATACTGG - Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103277514 12:119725096-119725118 CAATTCTGAGACTTTGATTCTGG + Intronic
1104520303 12:129468011-129468033 CACACGTGACACTTGGATTCAGG + Intronic
1105530588 13:21215569-21215591 CAAACCTGACACTTTGATCCTGG + Intergenic
1105924004 13:24990195-24990217 CAAACCTGTCACTTTGATCCTGG - Intergenic
1107926742 13:45270416-45270438 CAGACGTGGCCCTTTGATCCTGG - Intronic
1109441865 13:62384821-62384843 CAAACCTGACAGATAAATCCTGG + Intergenic
1109979848 13:69893740-69893762 CATACCTCACATTTTCATCCTGG + Intronic
1110348721 13:74480701-74480723 CAAACATGACACTATGATGGAGG - Intergenic
1114531923 14:23401889-23401911 CCAGCTTGACACTTTGATCTGGG + Intronic
1114731484 14:24997280-24997302 CAAACCTGACACCATCATCCAGG + Intronic
1128440598 15:67704923-67704945 CAAACCTGGAACTGTAATCCAGG - Intronic
1132457744 16:33430-33452 CAAACCTTCCACTTTGGCCCAGG - Intergenic
1133180520 16:4050794-4050816 CACACCTAATACTTAGATCCTGG + Intronic
1135459534 16:22629318-22629340 CAACCCTGGCACCTTGATCATGG + Intergenic
1136661894 16:31770244-31770266 CCTAGCTGACACTTTGATACAGG - Intronic
1138862811 16:60778616-60778638 CAAACTTGACCCTTTTATCTTGG + Intergenic
1140647334 16:77047101-77047123 CAGACCTGACATTGTAATCCAGG + Intergenic
1143241707 17:5448755-5448777 CAAAGCTGTCACTTTGTTCAAGG - Intronic
1144397777 17:14861867-14861889 CAAAGCTGACACTTTGGTAAAGG - Intergenic
1147388258 17:40094301-40094323 CAAAGCTGACACTCAGATTCAGG - Intronic
1150042528 17:61879300-61879322 CAAACTTGAAACTTTCCTCCAGG + Intronic
1150847810 17:68677235-68677257 CAAACCTGGCACTATCTTCCTGG + Intergenic
1152961765 18:84239-84261 CAAACCTTCCACTTTGGCCCAGG - Intergenic
1157339522 18:46766951-46766973 GTAACCTGACTCTTTGTTCCGGG - Intergenic
1160808849 19:1004346-1004368 CAAGCCTAACCCCTTGATCCCGG - Intronic
1161497930 19:4597742-4597764 GAAACGTGACCCTTTGGTCCAGG - Intergenic
1164781273 19:30895596-30895618 CACATCTGACACTTGGATCTTGG - Intergenic
1165071103 19:33255287-33255309 CTCTCCTCACACTTTGATCCTGG - Intergenic
1168451148 19:56467512-56467534 CAATTCTGACACTATGTTCCTGG + Intronic
926026568 2:9550344-9550366 CTAACCTGAAACTTGCATCCTGG - Intronic
928042005 2:27888079-27888101 TAACCCTGACACTTTTATTCAGG + Intronic
929927898 2:46230493-46230515 CTAACCTGACAGCTTGACCCAGG - Intergenic
932109956 2:68989306-68989328 CAAACCAAATACATTGATCCAGG + Intergenic
932596073 2:73094327-73094349 CTGACCTGTCACTTTCATCCAGG + Intronic
932776069 2:74529197-74529219 GGACCCTGACACTGTGATCCCGG + Exonic
932861583 2:75298419-75298441 CAAAACTGACACCTTGAGCTTGG - Intergenic
933585763 2:84178025-84178047 CATACCTGGCACTTTAAGCCAGG - Intergenic
933685202 2:85135836-85135858 CAAAACTGACACTTACATTCAGG - Intronic
936279750 2:111127686-111127708 CAAACCTTACAGCTAGATCCAGG - Intronic
938753693 2:134360569-134360591 CAAACCTGACACTATACTTCAGG - Intronic
940520233 2:154736427-154736449 CAAACCTGACACTGTGACACTGG + Intronic
941142118 2:161796952-161796974 CAGACCTGTCACTTTGCTTCAGG - Intronic
945764870 2:213962609-213962631 TAAACCTGATATTTTGATCTGGG + Intronic
946048893 2:216844481-216844503 CAAAGTTGACACTGTCATCCTGG - Intergenic
948347576 2:237311868-237311890 TAAACGTGACACTGTGAGCCAGG + Intergenic
1169896347 20:10508936-10508958 CCAGCCTGACATTTTGATACTGG + Intronic
1171046948 20:21817760-21817782 CAAAACTCACAATGTGATCCAGG - Intergenic
1173271597 20:41541358-41541380 CAAAGCAGGTACTTTGATCCTGG + Intronic
1179248413 21:39652701-39652723 CAAACTTCACAGTTTGATCAAGG + Intronic
952583346 3:34861969-34861991 CAAACCTGACTGTGTGATCTTGG - Intergenic
955864549 3:63369254-63369276 CTCTGCTGACACTTTGATCCTGG + Intronic
965729042 3:171750833-171750855 AGAACCTGACAATATGATCCTGG + Intronic
966553460 3:181230840-181230862 CAAACCTGGCACTGTTAGCCGGG - Intergenic
967604741 3:191432241-191432263 CAATGCTGGCACCTTGATCCTGG - Intergenic
967905239 3:194494071-194494093 AAACCCAGACACTTTGCTCCAGG + Exonic
968446626 4:655426-655448 CAAGCCTGGCACCTGGATCCTGG - Intronic
970025464 4:11619354-11619376 CAAACCTGTCACTTGTATACTGG + Intergenic
970512039 4:16790686-16790708 AACATCTGACACTTTCATCCCGG - Intronic
973603715 4:52566258-52566280 CCAACCTGCCACTCTGCTCCTGG - Intergenic
977214528 4:94264430-94264452 CAAACTTGTTACTTTGACCCTGG - Intronic
979755530 4:124335652-124335674 CAAATTTGACACTGTGGTCCAGG - Intergenic
981889413 4:149717288-149717310 CAAATCTGACACTATGTACCTGG - Intergenic
982405079 4:155010385-155010407 CAAACCTGAAATTTTTATCTTGG + Intergenic
982813529 4:159856626-159856648 AAAACCTGTCACCATGATCCTGG - Intergenic
987688953 5:21242825-21242847 CCATCCTGACACTTTGATTTTGG + Intergenic
988118799 5:26933287-26933309 CATTGCTGACACTTTGATCTTGG + Intronic
989391967 5:40910091-40910113 CAATGCTGACTCTTTCATCCAGG - Intronic
990518829 5:56557663-56557685 AAACCCTGACACTCTGTTCCTGG + Intronic
991310924 5:65240700-65240722 CCATGCTGACACTTTGATCTTGG + Intronic
993581842 5:89672447-89672469 CATACCGGACACCTTCATCCAGG + Intergenic
996405859 5:123101399-123101421 CAAACCAGATGCTTTGAGCCGGG - Intronic
996581756 5:125039048-125039070 CCATCCTGACACTTTGATCTTGG - Intergenic
998185251 5:139974406-139974428 CACACCAGTCACTTTGAGCCAGG + Intronic
1000284092 5:159811596-159811618 ATTAGCTGACACTTTGATCCTGG + Intergenic
1000690082 5:164306716-164306738 GAGACCTGACACCTTGATCTTGG + Intergenic
1003400856 6:5789661-5789683 CAAACCTGACACTTTGATCCTGG - Intergenic
1003688707 6:8330310-8330332 TAAATATGACACTTTGATCCTGG - Intergenic
1005462105 6:26078963-26078985 AAAACCTGCCACCTTGCTCCTGG + Intergenic
1010168407 6:72944550-72944572 CAAACTTGAGCCTTTAATCCTGG + Intronic
1010278318 6:73994566-73994588 CCATTCTGGCACTTTGATCCTGG - Intergenic
1014426153 6:121309036-121309058 CAAATCAGACACTCTGAACCAGG + Intronic
1014573403 6:123039995-123040017 CAAAGCTGAGAGTTTTATCCTGG + Intronic
1016435683 6:144034827-144034849 CAAAGCTGATGCTTTGTTCCTGG - Intronic
1016887891 6:148975492-148975514 CACACTGGACACTTTGATCATGG - Intronic
1017187478 6:151616741-151616763 CTCACCAGACACTTTGATCTTGG - Intronic
1018310824 6:162506643-162506665 CAAAGCTGACCCTTTCACCCGGG - Intronic
1018766646 6:166938818-166938840 CAAGCCTGACAGCTGGATCCAGG - Intronic
1018953933 6:168395484-168395506 CACACCTGGCACTGTGATTCAGG + Intergenic
1019343153 7:517906-517928 CAGCCCTAACACTTTAATCCAGG + Intronic
1019676608 7:2317165-2317187 CAAACCCCACACTTTTAGCCTGG - Intronic
1021518029 7:21508083-21508105 CAAACCTGAGACTGTTATTCAGG - Intronic
1025844160 7:65180744-65180766 CAAAACTGCCACTTTAACCCAGG + Intergenic
1025894487 7:65687055-65687077 CAAAACTGCCACTTTAACCCAGG + Intergenic
1027550653 7:79589964-79589986 CAAACCTGCTACTGAGATCCAGG + Intergenic
1027790860 7:82637965-82637987 CTAACCTGACCCTTTCCTCCTGG + Intergenic
1028020571 7:85766009-85766031 CAAGCCTGACTATCTGATCCGGG + Intergenic
1029325860 7:99808228-99808250 CAAACCTGAGACTGTTATTCAGG - Intergenic
1031214249 7:118870264-118870286 CAAACCTGAAACTTTTATTCAGG + Intergenic
1031680350 7:124665366-124665388 CCAACCTGAAACTTTGTTACAGG + Intergenic
1032713839 7:134487241-134487263 CTATCCTGACACTTGCATCCTGG - Intergenic
1032892409 7:136212587-136212609 AAAATCTGTCACTTTGCTCCAGG + Intergenic
1033051896 7:138012328-138012350 CAAACCTGAAATTTTGATTTTGG + Intronic
1034345500 7:150382973-150382995 CAAACGTGCCACTGTGAACCAGG - Intronic
1036503526 8:9335008-9335030 CCATGCTGACACTTTGATCTTGG + Intergenic
1037052227 8:14389559-14389581 CAAACCTGAAACTCTAATCAGGG + Intronic
1038667886 8:29556931-29556953 CCTACATGACACTTTGCTCCTGG - Intergenic
1038668064 8:29558526-29558548 CCTACATGACACTTTGTTCCTGG - Intergenic
1039784915 8:40825757-40825779 CAGACCTGTTACTGTGATCCTGG - Intronic
1041921811 8:63190318-63190340 CAAACTTGAAAATTTAATCCTGG + Intronic
1044317641 8:90768298-90768320 CAAACCTGGCACTTTGTGCATGG - Intronic
1044685641 8:94823368-94823390 CCAACCTGACACTTGGATGCGGG - Exonic
1044910331 8:97051497-97051519 AAAACCTGTCACTTTGTTGCTGG - Intronic
1045911521 8:107416137-107416159 CAAACCTGACACTGTCCACCTGG + Intronic
1046886203 8:119369925-119369947 CAAAACTGGCACCTTGATCTTGG + Intergenic
1047560957 8:125987784-125987806 CAAACCTGAGACTGTTATTCAGG + Intergenic
1047630940 8:126707511-126707533 CAAAATTGACATTTTGAGCCAGG + Intergenic
1048250834 8:132865483-132865505 CAGTGCTGACACTTTGATCTTGG + Intergenic
1050995156 9:12208162-12208184 CAAAGCTGACACTTTGATTTTGG - Intergenic
1051352027 9:16206017-16206039 CAAACCTGGCACGTTGGTCTTGG - Intronic
1057886155 9:98831378-98831400 CAAAGCTGACCCTTTGGTCTGGG + Intronic
1059325161 9:113499867-113499889 CAAACCTGACAAGTTACTCCTGG - Intronic
1060211611 9:121713823-121713845 CACACCTGACACTTCCATTCTGG + Intronic
1062224215 9:135440177-135440199 GAACCCTGCCACTTTGCTCCCGG - Intergenic
1062736381 9:138139865-138139887 CAAACCTTCCACTTTGGCCCAGG + Intergenic
1185929996 X:4192006-4192028 CACACCTGACAATTTGGACCTGG + Intergenic
1186288165 X:8068169-8068191 CCAATCTGACAATTAGATCCAGG - Intergenic
1190974888 X:55389461-55389483 CAAGCCTCACCCCTTGATCCTGG - Intergenic
1196724616 X:118885131-118885153 CAAACCTGAGACTGTTATTCAGG + Intergenic
1197144374 X:123155116-123155138 GAAACCTGACCCTTTTATTCCGG + Intergenic
1197468951 X:126842716-126842738 AAAAACTGACACTTTGATTTCGG + Intergenic
1197530595 X:127619705-127619727 CAAACCAGACACCTAGATCTCGG + Intergenic
1198730790 X:139725641-139725663 CAAAGCTGATACTTTAATTCAGG + Intergenic
1199859285 X:151785672-151785694 CACACCTAACACTTAGATCTTGG - Intergenic
1200398619 X:156005970-156005992 CAAACCTTCCACTTTGGCCCAGG + Intronic
1201771652 Y:17622101-17622123 CACAGCTGACCCTTGGATCCAGG - Intergenic
1201829903 Y:18283885-18283907 CACAGCTGACCCTTGGATCCAGG + Intergenic
1202339459 Y:23846830-23846852 CAAAACTGCCACTTTGTTTCAGG + Intergenic
1202531307 Y:25823238-25823260 CAAAACTGCCACTTTGTTTCAGG - Intergenic