ID: 1105531441

View in Genome Browser
Species Human (GRCh38)
Location 13:21224291-21224313
Sequence CCTCAGAACCACAGTCGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105531436_1105531441 -4 Left 1105531436 13:21224272-21224294 CCCATTTCTTCAGCATCTCCCTC 0: 2
1: 0
2: 5
3: 51
4: 468
Right 1105531441 13:21224291-21224313 CCTCAGAACCACAGTCGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 82
1105531437_1105531441 -5 Left 1105531437 13:21224273-21224295 CCATTTCTTCAGCATCTCCCTCA 0: 2
1: 0
2: 8
3: 73
4: 575
Right 1105531441 13:21224291-21224313 CCTCAGAACCACAGTCGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105531441 Original CRISPR CCTCAGAACCACAGTCGTTA GGG Intergenic
902208437 1:14887024-14887046 CCTCACAACCACACTCGTGGGGG - Intronic
904602549 1:31681580-31681602 CCTCAGCCCCACACTCGCTAGGG - Intronic
911414065 1:97548343-97548365 CCTCAAGACCACAGTCGTTGTGG + Intronic
916983954 1:170170229-170170251 CCTCAGAACCACAGAAAGTAAGG + Intergenic
920861475 1:209711370-209711392 CCTCAGAACCAGAGTGGAAAGGG + Intronic
923522601 1:234747163-234747185 CCTCAGGGCCACAGTCGGAAAGG - Intergenic
1063070428 10:2657451-2657473 CCTAAGAAACACAGTTGCTATGG - Intergenic
1069289651 10:66762337-66762359 CCACAGAACCACAGTGGGGAAGG - Intronic
1075612948 10:123868037-123868059 CCTCAGAGCCACAGGGGCTAGGG + Intronic
1076371891 10:129960400-129960422 GCTCAGAACCACAGAAGTGATGG + Intronic
1076882267 10:133245315-133245337 CCTCAGAACCACAGCTCTTCTGG + Intergenic
1078491172 11:11770246-11770268 GTTCAGAAACACAGTCGTTCAGG + Intergenic
1079815553 11:25052385-25052407 CCTCAGCACCTCAGTAGGTAAGG + Intronic
1083235944 11:61350738-61350760 CCACAGAACCACAGTGATTTGGG + Intronic
1084330879 11:68429506-68429528 CCTCAGAACCACAGCCTGGAGGG - Intronic
1085254071 11:75162555-75162577 CCTCAGAACCAAGGTCTTTCAGG - Intronic
1087591722 11:100197620-100197642 CCCCAGAGCCACAGTCTTAATGG + Intronic
1088147093 11:106694428-106694450 ACTCAGAACCATAGTAGCTAGGG - Intronic
1096047253 12:48573325-48573347 CCTGAGAGCCACAGTCATAATGG + Intergenic
1099279218 12:80622537-80622559 CCTCAGGACCACTGACATTACGG - Intronic
1104902827 12:132198407-132198429 CCGCAGAATCACAGTGGTCAGGG - Intronic
1105531441 13:21224291-21224313 CCTCAGAACCACAGTCGTTAGGG + Intergenic
1110361857 13:74634986-74635008 CTTCAGAATCACAGTCCTCACGG - Intergenic
1113457780 13:110461276-110461298 CCTCTAAAACACAGTCGTTTAGG - Intronic
1113793169 13:113041422-113041444 CCTCATGACCACAGTCAGTATGG + Intronic
1122687075 14:103514147-103514169 CCTCAGAAGCACAGCAGTTTTGG + Intergenic
1125816394 15:42588658-42588680 CCTCAGAGCCATAGTGATTAGGG - Intronic
1128239967 15:66095190-66095212 CCTCAGCACCAGAGTGGTTGAGG - Intronic
1129919767 15:79310684-79310706 CCTAACATCCACAGTAGTTAGGG - Intergenic
1135381069 16:21996554-21996576 CTTCAGAACCCCAGTAGGTATGG - Intronic
1137848244 16:51712837-51712859 CCTCAGACCCAGAGTCCTGATGG + Intergenic
1138911021 16:61399016-61399038 ACTCAGAACCACTGACATTATGG + Intergenic
1142001132 16:87665118-87665140 CATGAGCACCACAGTCTTTATGG + Intronic
1143838931 17:9715157-9715179 CCACAGAAACAAAGTCCTTAAGG + Intronic
1143942748 17:10559618-10559640 CTTCAGAATCAGAGTCCTTAGGG - Intergenic
1146692320 17:34884925-34884947 CCTCACATCCACAGTTTTTATGG + Intergenic
1151513060 17:74573552-74573574 ACTGAGAACCACAGCCCTTATGG - Intergenic
1154172540 18:12061803-12061825 CATCAGAACCACAGCGGGTATGG - Intergenic
1155019204 18:21879408-21879430 GCTCAGAACCAATGTCATTATGG + Intergenic
1155289471 18:24326197-24326219 CCCCAGAAGCACAGTCATCATGG - Intronic
1157638267 18:49184408-49184430 CCTCAGTAACCCAGTCCTTAGGG - Intronic
1160154203 18:76421008-76421030 ACTCAGAATCACAGTCATCATGG - Intronic
1160510829 18:79452449-79452471 GCACAGAACCACAGGCGTGACGG - Intronic
925506636 2:4572904-4572926 CCTGAGGACCACAGTCTTCAGGG - Intergenic
948040900 2:234900767-234900789 CCTCAGAACCCCAGGGTTTAGGG - Intergenic
1173070431 20:39759274-39759296 TCTCAGAACCATGGTGGTTAGGG + Intergenic
1173255673 20:41393015-41393037 GATCAGAACCACAGTCGTTCTGG + Intergenic
1174574595 20:51527438-51527460 CCACAGTTCCTCAGTCGTTATGG - Intronic
1175031188 20:55955949-55955971 CATAAGAACCACTGTCTTTATGG + Intergenic
1179009438 21:37544909-37544931 CCTGACAACAACAGGCGTTAAGG + Intergenic
1180203691 21:46243840-46243862 CAGCAGAACCACAGTTGTTGAGG + Intronic
1184889045 22:47368425-47368447 CCTCAGAACACCTGTCTTTAGGG - Intergenic
1184896870 22:47413959-47413981 GCTCAGCACCACTGTCATTAGGG + Intergenic
951819454 3:26791708-26791730 CCTAAGAATCTCAGTCTTTATGG + Intergenic
952855337 3:37765749-37765771 CCTCTGAACCACACTCTGTACGG - Intronic
953496024 3:43387644-43387666 ACTGAGAACCACAGTGTTTATGG - Intronic
954706697 3:52484813-52484835 CCTGACAAACACAGTGGTTAAGG + Intronic
955617608 3:60825687-60825709 CCTCAGATCATCAGGCGTTAGGG - Intronic
955651067 3:61194321-61194343 CCTCAGAACCAAGGTCTTTGTGG - Intronic
957604729 3:82382453-82382475 CCCCAGAACCACAGACCTAAGGG - Intergenic
958522309 3:95205061-95205083 CCTGAGAGCCACAGTGGGTAGGG - Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967875152 3:194263805-194263827 CGTCAGAACCACAGAGGCTATGG + Intergenic
972233445 4:37101801-37101823 CCTCAAAACCACACTGGTTTTGG - Intergenic
981646646 4:147005884-147005906 TACCAGAAGCACAGTCGTTAAGG + Intergenic
994097816 5:95862916-95862938 CCCCAGAAGCACAGACATTAAGG - Intergenic
996650269 5:125867388-125867410 CCCCAGAACCACTGTGGTTCAGG - Intergenic
1006642258 6:35495582-35495604 CCACAGAACCACATCCTTTAGGG + Intronic
1010954179 6:82071449-82071471 CCTCAGAATCAAGGTTGTTAAGG + Intergenic
1012124492 6:95410992-95411014 CCTGAGAAACACAGTCAATATGG + Intergenic
1014339627 6:120187858-120187880 CATCAGAACCACTGTGGCTATGG - Intergenic
1019468483 7:1203934-1203956 CCTCAGAACCACGGGCGCTGAGG + Intergenic
1019961173 7:4461177-4461199 CCTAAGTACCACAGTCTTTTGGG + Intergenic
1032491127 7:132325380-132325402 TCTCAGAAAAACAGTTGTTATGG + Intronic
1033042096 7:137928098-137928120 GCTCAGAACCAAAGGCGCTAAGG + Intronic
1034011538 7:147534279-147534301 CCTCAGCACCACTGACGTTTTGG - Intronic
1035057373 7:156044695-156044717 CCACAGAACCACAAGTGTTAAGG + Intergenic
1037637871 8:20716588-20716610 CCTCAGACCCACAGTGAGTAGGG - Intergenic
1038955148 8:32459795-32459817 CCTCCGAACTACAGGCCTTAGGG + Intronic
1046071408 8:109259439-109259461 TCTCAGACCCACTGTCATTATGG + Intronic
1049691983 8:143965517-143965539 CCACAGACCCACAGTGGGTAGGG - Intronic
1052083279 9:24232951-24232973 CCTCAGAACCACTGTTTTCAGGG - Intergenic
1186867926 X:13739824-13739846 CCTGAAACCCACAGTAGTTATGG - Intronic
1193755994 X:85409003-85409025 CCTAAGAATTACAGTCTTTATGG + Intergenic
1201372167 Y:13277808-13277830 CCTGAGAACTACAGTCTTTGTGG - Intronic