ID: 1105533483

View in Genome Browser
Species Human (GRCh38)
Location 13:21242349-21242371
Sequence CCTCTTGCCTTGAAAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 2, 1: 0, 2: 3, 3: 19, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105533477_1105533483 4 Left 1105533477 13:21242322-21242344 CCTCCCTTTGAGAGGCGCAGGCT 0: 2
1: 0
2: 3
3: 19
4: 282
Right 1105533483 13:21242349-21242371 CCTCTTGCCTTGAAAATGGGTGG 0: 2
1: 0
2: 3
3: 19
4: 197
1105533478_1105533483 1 Left 1105533478 13:21242325-21242347 CCCTTTGAGAGGCGCAGGCTATG 0: 2
1: 0
2: 0
3: 4
4: 72
Right 1105533483 13:21242349-21242371 CCTCTTGCCTTGAAAATGGGTGG 0: 2
1: 0
2: 3
3: 19
4: 197
1105533474_1105533483 23 Left 1105533474 13:21242303-21242325 CCAGTGCGGCTTTGACAATCCTC 0: 2
1: 0
2: 0
3: 5
4: 65
Right 1105533483 13:21242349-21242371 CCTCTTGCCTTGAAAATGGGTGG 0: 2
1: 0
2: 3
3: 19
4: 197
1105533479_1105533483 0 Left 1105533479 13:21242326-21242348 CCTTTGAGAGGCGCAGGCTATGT 0: 1
1: 1
2: 0
3: 4
4: 75
Right 1105533483 13:21242349-21242371 CCTCTTGCCTTGAAAATGGGTGG 0: 2
1: 0
2: 3
3: 19
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105533483 Original CRISPR CCTCTTGCCTTGAAAATGGG TGG Intergenic
901223248 1:7596068-7596090 CCTCTGTCCTTGAAGATGGGTGG + Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
901775293 1:11556366-11556388 CCTTTTTGCTTGAAATTGGGTGG + Intergenic
904041255 1:27586432-27586454 CCTCTTCCTTTTCAAATGGGTGG - Intronic
905430474 1:37919082-37919104 CCTCATGCATGCAAAATGGGAGG - Intronic
905445818 1:38027991-38028013 CCTCTTGCCTAGAAAAAGCTGGG - Intergenic
907623396 1:56005163-56005185 CCTACTACCTTGAGAATGGGAGG + Intergenic
909840360 1:80313327-80313349 CCTCTGGCTTTGAAGATGGATGG - Intergenic
912733088 1:112127149-112127171 CCTGTTGACTTAAAGATGGGAGG + Intergenic
914454193 1:147820356-147820378 CCTTTTGTAATGAAAATGGGTGG + Intergenic
914827121 1:151144548-151144570 GATGCTGCCTTGAAAATGGGAGG + Intronic
915775263 1:158477297-158477319 TCTCTTGCCTTGAATAGGAGTGG - Intergenic
916124657 1:161558578-161558600 CCTCTACCCTTGAATCTGGGTGG - Intergenic
916134548 1:161639927-161639949 CCTCTACCCTTGAATCTGGGTGG - Intronic
917979317 1:180259536-180259558 CCTCTTCCATGGGAAATGGGAGG + Intronic
918954203 1:191183834-191183856 GCTGTTGCCATGGAAATGGGTGG - Intergenic
1063585797 10:7351013-7351035 CCTCCTTCCTTGCAATTGGGTGG + Intronic
1065456170 10:25908882-25908904 CCTCCTCCCTTGATCATGGGAGG + Intergenic
1068806554 10:61201160-61201182 CCTCTTGCCTTGCAATCAGGGGG - Intergenic
1069659122 10:70112020-70112042 CCTCTTCCCTTGGAAAAAGGAGG - Exonic
1069829504 10:71273880-71273902 CCTCCTGCATTTTAAATGGGTGG + Intronic
1069881378 10:71595867-71595889 CCTCTGGGCTTGAAAGTGGCTGG - Intronic
1071957699 10:90777526-90777548 CTTCTTGCCTGGAACATGGATGG - Intronic
1072862752 10:99023255-99023277 CCTCTGTCTTTGGAAATGGGAGG + Intronic
1078011634 11:7576896-7576918 TCACTCGCCTGGAAAATGGGTGG + Intronic
1080891035 11:36409418-36409440 CCTCTTTCCTTGAAAATCTCTGG - Intronic
1081547438 11:44081334-44081356 CCTGGTGACCTGAAAATGGGAGG + Intronic
1081872612 11:46390453-46390475 CCTCTCGCCGCGAGAATGGGCGG - Intergenic
1082251939 11:49992235-49992257 CCTCTACCTTTGGAAATGGGAGG + Intergenic
1084027574 11:66461627-66461649 CCCCTTCCCTTGAATGTGGGTGG - Intronic
1084270825 11:68028200-68028222 CCTCTTCTCCTGAATATGGGTGG - Exonic
1084541111 11:69787779-69787801 CCTCCTGCCTGGTGAATGGGAGG - Intergenic
1085430064 11:76440213-76440235 CCCCTTTCCTTGAACCTGGGTGG + Intergenic
1086180112 11:83940676-83940698 TCTATTGCCTTTAAAATAGGAGG - Intronic
1086278834 11:85162100-85162122 CCTGTTGACTTAAAAGTGGGAGG - Intronic
1086426833 11:86693222-86693244 CCTCTCCGCTTGAGAATGGGGGG - Intergenic
1088378424 11:109167261-109167283 TCTCTTGCCTGAAAAGTGGGAGG - Intergenic
1089177768 11:116560704-116560726 GCTCTGGCCTTGAAAATGCAGGG + Intergenic
1089884237 11:121803858-121803880 CCTATTGCCCAGAAAGTGGGGGG + Intergenic
1090145202 11:124313941-124313963 CCTCTTGCTTTTAAGATTGGGGG - Intergenic
1092794702 12:12098709-12098731 GATCTTTCCTTGAAGATGGGAGG - Intronic
1093533402 12:20194446-20194468 CCACTGGCCTTGACAATGGAGGG - Intergenic
1093569813 12:20654081-20654103 ACTAATGCCTGGAAAATGGGTGG + Exonic
1095838995 12:46671049-46671071 ACTCTTCCCTTTTAAATGGGAGG - Intergenic
1096286523 12:50305421-50305443 CCCCTCCCCTTGAACATGGGTGG + Intergenic
1096339530 12:50785989-50786011 CCTCTCCCCTTGAGAGTGGGAGG - Intronic
1096839067 12:54370010-54370032 CCTCTCCCCTAGAAAAGGGGGGG - Exonic
1102525184 12:113507552-113507574 TCTCTGGCCTTGAACCTGGGAGG - Intergenic
1102583998 12:113910507-113910529 CCTCCTTCCTGGAAGATGGGGGG + Intronic
1104081132 12:125431286-125431308 CTTGTTGCCTTGGTAATGGGGGG + Intronic
1104410864 12:128556594-128556616 CTTCTCCCCTTGAAACTGGGTGG + Intronic
1105533483 13:21242349-21242371 CCTCTTGCCTTGAAAATGGGTGG + Intergenic
1107570450 13:41652026-41652048 GGTCTTCTCTTGAAAATGGGAGG + Intronic
1109685893 13:65819183-65819205 CCTCTTTCTTTGGAAAGGGGAGG + Intergenic
1112169757 13:96958860-96958882 CCTCTGGCCTTCAAAATTGAGGG - Intergenic
1113523737 13:110957911-110957933 CTTCTTGTCTGGAAAATGGGGGG + Intergenic
1114627618 14:24139585-24139607 CCCCTGGCCTTGAAAATTGCTGG - Exonic
1115464339 14:33698351-33698373 GCTTTTGCCATGAAACTGGGTGG + Intronic
1117264868 14:54076539-54076561 CCTCTGCCTTTGAAAAGGGGAGG - Intergenic
1117967232 14:61218567-61218589 CTTTTTCCCTTGAAATTGGGGGG - Intronic
1119982928 14:79102520-79102542 CCCATTGCCTTGCACATGGGAGG - Intronic
1121590743 14:95106033-95106055 CCCCTTACCTTGAAGATGTGTGG + Exonic
1125457065 15:39870653-39870675 CCTCTCCCCTTGAATGTGGGTGG + Intronic
1126525809 15:49652822-49652844 CCTCATTCCTTGCAACTGGGAGG - Exonic
1127831724 15:62756926-62756948 ACTCTTGCCTTCAAATAGGGAGG - Intronic
1127945211 15:63744583-63744605 CCTCTAGCTTTGGAAAGGGGAGG - Intronic
1128106041 15:65045594-65045616 CATCTTGCCTTGGGGATGGGTGG + Intronic
1130022862 15:80245621-80245643 CCCCTGTCCTTGAAACTGGGTGG - Intergenic
1130303210 15:82695939-82695961 CCTCTGGCCACAAAAATGGGTGG - Intronic
1130642432 15:85691223-85691245 CCTCTTACCTTGTGAATGGTAGG + Intronic
1132539494 16:501882-501904 CTCCTTGCCTATAAAATGGGGGG - Intronic
1132911355 16:2314280-2314302 CATCTAGCCTTGAAAAGGAGGGG + Intronic
1135560089 16:23469503-23469525 CCACTTCCCTTGAAAAGGGATGG + Intronic
1136587432 16:31196368-31196390 CCTCTTGCCGCTAACATGGGTGG - Intergenic
1138386496 16:56638941-56638963 CCTCTCGCCTCTGAAATGGGAGG - Intronic
1138387870 16:56648467-56648489 CCTCTCGCCTTAGAAATGGGAGG - Intronic
1138573167 16:57889017-57889039 CCCCTTCCCTTGAGGATGGGTGG + Intronic
1138944457 16:61831012-61831034 CTTTTTTCCTTGAAAGTGGGGGG + Intronic
1139408797 16:66741710-66741732 CCACTTGCCAGGGAAATGGGAGG - Intronic
1140540819 16:75754966-75754988 TCTCCTGCCTTGCACATGGGAGG - Intronic
1140990702 16:80208648-80208670 TCTCTTGCCTATCAAATGGGGGG + Intergenic
1143618762 17:8069280-8069302 CTCCCTGCCTTGAAAATGGGTGG - Intergenic
1143901621 17:10178752-10178774 CTTCTTGCTTTGAAAAGAGGAGG - Intronic
1148878666 17:50708042-50708064 CCTCCTCCCTTGAAACTGCGGGG - Intergenic
1148884778 17:50764354-50764376 CCTTTTCCCTTGAGAAGGGGAGG - Intergenic
1149548456 17:57521939-57521961 GCTCTGGCCTTGAAAAGGGTGGG - Intronic
1149974949 17:61256218-61256240 CCTCTTGGCTTGAAGATGGAAGG - Intronic
1150024016 17:61652663-61652685 CCTCTAGCCTTTCACATGGGGGG + Intergenic
1154255403 18:12777410-12777432 CCTGTTGCCCTGAAACTGAGAGG - Intergenic
1156099066 18:33572079-33572101 CCTCTTGGCCTAAAAAAGGGAGG + Intergenic
1161025694 19:2035711-2035733 CCCCTTCCCTTGAACCTGGGCGG + Intergenic
1163378618 19:16949592-16949614 CCTCTTGCCTAGACAATGGCAGG + Intronic
1164611602 19:29636335-29636357 CCTCGTGCCCTGCAAGTGGGAGG + Intergenic
1164805832 19:31115882-31115904 TCTCTTTCCTACAAAATGGGAGG + Intergenic
1165923155 19:39311097-39311119 CCTCTGTCCTTGAAAAGGGGTGG - Intronic
1168454529 19:56496095-56496117 CCTCCTGCCCTCAAAAGGGGAGG - Intergenic
929926502 2:46216806-46216828 CCTCTGGCTTTGGAAAGGGGAGG - Intergenic
931506307 2:62931082-62931104 TTTCTTGCCTACAAAATGGGAGG + Intronic
939469494 2:142601698-142601720 CCTCTTCCCTTGAAACTGGGTGG + Intergenic
939853923 2:147334187-147334209 CCTGTCTCCTTGAAAATGGGTGG + Intergenic
939865023 2:147462911-147462933 CCTCTTGCACTGAAAATCAGAGG + Intergenic
941489630 2:166127213-166127235 CCTCATGCCTTGAACAAGGAAGG - Intronic
942334804 2:174871853-174871875 CCTGTTTCCTTGCAAATGGGAGG + Intronic
945645802 2:212491385-212491407 TCTATTGCCTTCAAAATGGTGGG - Intronic
946709961 2:222495513-222495535 TCTCTTGGCTTAAAAATGAGAGG + Intronic
946815207 2:223569994-223570016 CTCCTTCCCTTGAGAATGGGTGG + Intergenic
1169565856 20:6852908-6852930 CCTCTTTCCTTGAAACTGGATGG + Intergenic
1170767165 20:19300180-19300202 CCCCTTTCCTTGAATATGGCTGG + Intronic
1172070834 20:32255721-32255743 CCCCTTTCCTTGAATCTGGGTGG - Intergenic
1172200858 20:33125123-33125145 CCTTTTGCCTGGAAAGTGGCTGG - Intergenic
1175263904 20:57691291-57691313 CCTCATGCCATGTTAATGGGAGG - Intronic
1175383240 20:58577828-58577850 GCTTTTGCCTAAAAAATGGGAGG - Intergenic
1176519894 21:7816416-7816438 CCTCCTGCCTTGTAAAGGGGAGG - Intergenic
1177179280 21:17727313-17727335 CCTTTTGCCTTGAAAATGTGTGG + Intergenic
1177456373 21:21344535-21344557 CCTCTGCCTTTGGAAATGGGAGG + Intronic
1178545637 21:33491318-33491340 CCGATTGCCTAGAAAATAGGGGG - Exonic
1178653922 21:34446429-34446451 CCTCCTGCCTTGTAAAGGGGAGG - Intergenic
1180842731 22:18966788-18966810 TCTCTGGTCTGGAAAATGGGTGG + Intergenic
1183200277 22:36381075-36381097 CCTCTTACCTTGTAAAAGGTAGG + Intronic
1184772696 22:46607189-46607211 CCTCGTGTCTTTAAAAAGGGGGG + Intronic
949697400 3:6715008-6715030 GCTCTTGTCTTGAAAATGTGTGG - Intergenic
950126086 3:10510622-10510644 CCTCTGGCCTTGCAGAAGGGAGG - Intronic
951435407 3:22657122-22657144 CCTCTTCCTTTGGAAAGGGGAGG - Intergenic
954574214 3:51666385-51666407 CCTCAGGCCTGGATAATGGGTGG - Exonic
958669080 3:97180128-97180150 CCTCTGCCTTTGAAAAGGGGAGG - Intronic
962811697 3:138963880-138963902 CCACTTCCCTTGAATCTGGGTGG + Intergenic
963481681 3:145882874-145882896 CCTCTTGCCTTGCATCTAGGTGG - Intergenic
964431609 3:156612452-156612474 CCTCTTGCCTTCCAAATGCTGGG + Intergenic
965349915 3:167599321-167599343 CCTCTGCCTGTGAAAATGGGAGG - Intronic
965537911 3:169843214-169843236 ACTCCTGTCTTGAAAATGAGGGG + Intronic
966759970 3:183408939-183408961 CACCTTGCCATGATAATGGGAGG + Intronic
967080830 3:186048088-186048110 CCCCTTGTCTAGAAAAAGGGGGG - Exonic
967576516 3:191101129-191101151 CCCCTTGCTTTGGAAATTGGTGG - Intergenic
968537460 4:1143366-1143388 CCTCTTTCCTGGATGATGGGAGG + Intergenic
974435743 4:61855800-61855822 CCTATAGCCTAGAAAATGGTAGG - Intronic
974630289 4:64479881-64479903 CCTCTGCCCTTGGAAAGGGGAGG - Intergenic
974642127 4:64644735-64644757 CCTCTTGCCTAGAAGATCAGAGG - Intergenic
974780197 4:66544122-66544144 CCTCTGCCTTTGAAAAGGGGAGG + Intergenic
975503957 4:75117654-75117676 CCTCTGCCTTTGAAAAGGGGAGG + Intergenic
977413026 4:96691897-96691919 TCTCTTGCTTTGAATCTGGGAGG - Intergenic
979655906 4:123193894-123193916 CCTCTTGTCTTAAAAATGTAAGG - Intronic
980960501 4:139470287-139470309 CCTCTGTCTTTGGAAATGGGAGG - Intronic
982060621 4:151600943-151600965 CCTCTTCCCTTGAAATTGAGTGG - Intronic
983251015 4:165346575-165346597 CACCTTGCCTTGAACATGGTAGG + Intergenic
983274819 4:165604287-165604309 CCTATTATCTTGACAATGGGTGG - Intergenic
984299275 4:177894202-177894224 CCTCTCCCCTTGAATTTGGGTGG - Intronic
985445680 4:190020131-190020153 CCTGTTTCCTGCAAAATGGGGGG + Intergenic
985730151 5:1543198-1543220 CCTCTGGCCTTATGAATGGGAGG + Intergenic
986124797 5:4875027-4875049 CCTCTCCCCTTGAATCTGGGTGG - Intergenic
987164020 5:15174603-15174625 CCTCTTCCTGTGGAAATGGGAGG + Intergenic
989629023 5:43461695-43461717 CCTCTGTCTTTGAAAAGGGGAGG + Intronic
990901019 5:60749007-60749029 CCTCTCCTCTTGAAAATGGGTGG + Intergenic
993192184 5:84696569-84696591 CCTCTGCCCTTGAAAAGGGGAGG + Intergenic
995013573 5:107285482-107285504 CCCCTTGCTTTGAAACTGGCAGG - Intergenic
999340461 5:150765608-150765630 CATCCTGCCTTGTGAATGGGAGG - Intergenic
999345699 5:150817183-150817205 CCTCTTCCTTTGGAAAGGGGAGG + Intergenic
1001121505 5:168984601-168984623 CCTCTTGCTGTGAAAATGTCAGG + Intronic
1001517893 5:172369405-172369427 CCCCTGGCCTAGAACATGGGTGG + Intronic
1003388774 6:5693983-5694005 CCTCTTGCCTTGAAAATGGGTGG - Intronic
1004118930 6:12800181-12800203 CATCTAGCCTAGAAAATGGTTGG - Intronic
1004406982 6:15342187-15342209 CATCTTTCCTTGTAATTGGGTGG + Intronic
1006283306 6:33073661-33073683 CCTCTAGCACTGGAAATGGGTGG + Exonic
1007640368 6:43334250-43334272 CCCCTGGCCTTGCAAATGGGGGG - Intronic
1007831051 6:44638725-44638747 CACCTTGCCTATAAAATGGGTGG - Intergenic
1010769094 6:79808072-79808094 CCCCTTGCCATGAATGTGGGTGG - Intergenic
1013471301 6:110468802-110468824 CATCTTGGCTTGAAGATGAGTGG + Intronic
1015031408 6:128600411-128600433 CCTATTTCCTTGAAAATGTCAGG + Intergenic
1015687807 6:135885258-135885280 CATGATGCCTTGAAAATGTGGGG + Intronic
1015810502 6:137157710-137157732 ACTCTTGACTTGAAAATGTCAGG - Intronic
1016151261 6:140745531-140745553 CCTCTGCCTTTGAAAACGGGAGG + Intergenic
1016185672 6:141195625-141195647 CCTCTGACTTTGAAAAGGGGAGG - Intergenic
1016456129 6:144232743-144232765 CCTCTTTCCTTGAAAAAAGGGGG + Intergenic
1017379705 6:153813988-153814010 CCTCTGCCTTTGAAAAGGGGAGG + Intergenic
1019452888 7:1108638-1108660 CCACTTGTCCTTAAAATGGGAGG - Intronic
1022523613 7:31023292-31023314 CCTCTGGCCCTGAAAGTGGGAGG - Intergenic
1022687815 7:32613005-32613027 GCTCATGCCATGGAAATGGGTGG + Intergenic
1023305985 7:38827446-38827468 CCTCTTGCCTTGAAAAGTTCAGG + Intronic
1024170339 7:46778405-46778427 CCTCTGCCTTTGGAAATGGGAGG + Intergenic
1027796683 7:82703148-82703170 TCTCTGGCCTAGAAAATGTGTGG + Intergenic
1028388069 7:90282107-90282129 CCTCCTGCCTTGAAAGTGTTGGG - Intronic
1028564452 7:92212874-92212896 ACTCTTGCTATTAAAATGGGAGG - Intronic
1029507252 7:100969782-100969804 CCCCTTGCCATGCAAAGGGGAGG - Intronic
1032020231 7:128403676-128403698 CCTCTTCCTTTGACAAGGGGAGG - Intronic
1032342010 7:131082694-131082716 CCCCTTCCCTTGAATGTGGGCGG + Intergenic
1033368619 7:140689849-140689871 CCTCATGCCTGGAAGATGTGGGG - Intronic
1034282271 7:149862593-149862615 CCACTGGCCTAGCAAATGGGTGG - Intronic
1036693660 8:10960725-10960747 CCTCCTGCCTTGGGAATGTGAGG - Intronic
1037804148 8:22049900-22049922 CCTCGTCCAGTGAAAATGGGAGG + Intronic
1043114483 8:76233283-76233305 TTTCTTCCCTTGAAATTGGGTGG + Intergenic
1043126632 8:76404435-76404457 CCTCCTGCATTGGAAATCGGGGG + Intergenic
1045134523 8:99200050-99200072 CCTATTGCTGGGAAAATGGGAGG - Intronic
1045815964 8:106276398-106276420 CCTCTTTCCTTGTAAATGGGTGG - Intronic
1046547537 8:115669589-115669611 CTTCTTGCCGTGAAAATCGTGGG - Intronic
1047072182 8:121357540-121357562 CCTTTTGCTTGTAAAATGGGAGG - Intergenic
1048296922 8:133221234-133221256 CCCCTTGCTATGAAGATGGGTGG + Intronic
1048758071 8:137760839-137760861 CATCTTGCCTTGCATATGGAAGG - Intergenic
1050848023 9:10247999-10248021 CCTGATGGCTTTAAAATGGGAGG + Intronic
1051050749 9:12929166-12929188 TATCTTCCCTTAAAAATGGGGGG + Intergenic
1051413737 9:16817301-16817323 CCTGTTGCCTCTAAAAAGGGTGG - Intronic
1057409598 9:94806099-94806121 CATCTTGCCTTGAAATCAGGGGG - Intronic
1058284974 9:103166413-103166435 CCTCTGCCTTTGGAAATGGGAGG - Intergenic
1062599075 9:137311988-137312010 CCCCTTTTCTTCAAAATGGGAGG - Intronic
1185759461 X:2679017-2679039 CCCTTTTCCTTGAAATTGGGTGG + Intergenic
1187984035 X:24791234-24791256 CCTCATTCCTTGAAACTTGGGGG + Intronic
1189151866 X:38717524-38717546 CCTCTTGCCCTGAAAATTAATGG + Intergenic
1189167685 X:38877520-38877542 CTTATTGCCTTGAAGAAGGGAGG + Intergenic
1189289354 X:39874294-39874316 CCTCTCCCCTTGAACCTGGGTGG + Intergenic
1189339259 X:40192196-40192218 TCTCTGCCCTTGAAACTGGGTGG + Intergenic
1189460676 X:41240187-41240209 CCCCTCCCCTTGAACATGGGTGG - Intergenic
1189690512 X:43612857-43612879 CCTCTGCCTTTGAAAAGGGGAGG - Intergenic
1189738970 X:44099319-44099341 CCACTTCCCTTGAACCTGGGCGG - Intergenic
1190480929 X:50876039-50876061 CCTTTTCCCTTGAATATGGATGG - Intergenic
1190594086 X:52035589-52035611 ACTCTTGCCTGGTAAATGAGGGG + Intergenic
1190715229 X:53097241-53097263 CCTCTTACCGGGAAACTGGGTGG + Intergenic
1190969997 X:55339491-55339513 CCTCTCGTCTTGAACTTGGGTGG + Intergenic
1192062219 X:67839143-67839165 CCTCTGTCTTTGAAAAGGGGAGG + Intergenic
1192855914 X:75011729-75011751 CCTCTGCCTTTGGAAATGGGAGG - Intergenic
1193172983 X:78358137-78358159 CCTCTGCCTTTGGAAATGGGAGG - Intergenic
1193999593 X:88411285-88411307 CCTTTTGTTTTGAAAATGGTGGG + Intergenic
1197234169 X:124040437-124040459 CCTGCTGCCTTAAAAATGTGGGG - Intronic
1197363162 X:125532465-125532487 CCTCTGCCTTTGAAAAGGGGAGG - Intergenic