ID: 1105534836

View in Genome Browser
Species Human (GRCh38)
Location 13:21256291-21256313
Sequence GTGTCCTGCCTCTGCAGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105534836_1105534842 26 Left 1105534836 13:21256291-21256313 CCCAACCTGCAGAGGCAGGACAC 0: 1
1: 1
2: 1
3: 12
4: 186
Right 1105534842 13:21256340-21256362 TCCCTCTTCAGCATTAACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105534836 Original CRISPR GTGTCCTGCCTCTGCAGGTT GGG (reversed) Intergenic
900460624 1:2800784-2800806 GTGGCCTGCCTCTGCCGGGAGGG - Intronic
900863501 1:5250489-5250511 GTGTCCCGCTCCTGCAGGATAGG - Intergenic
901448908 1:9324473-9324495 GTGCCCAGCCTCTGGAGGGTCGG + Intronic
902684921 1:18070143-18070165 GTGCCCTCCCTCTGCAGGGAGGG + Intergenic
905481387 1:38264416-38264438 GTGTCATGCCTCTGCAGGGCAGG + Intergenic
905550441 1:38833624-38833646 ATGTACTGCCTCTACAGCTTTGG - Intergenic
906345736 1:45013199-45013221 GTGAACTGACTCTGCAGGTGAGG + Exonic
906617521 1:47244033-47244055 GTGTCCTGCCTCTTCATGGGAGG - Intergenic
908461162 1:64349512-64349534 GTGTGCTGCCTCTGTATGTGTGG + Intergenic
908765778 1:67553611-67553633 GAGTCCTCCCTCTGCATCTTCGG + Intergenic
908826185 1:68134936-68134958 TCATCCTGCCTCTGCAGGGTTGG + Intronic
912215601 1:107607582-107607604 GTCTCCTGCCACTGCAGGAAAGG + Intronic
915274157 1:154776502-154776524 GTTTTCTGCATCTGCAGGGTGGG + Intronic
916040928 1:160960830-160960852 ATGGCCTGCATCTGCAGGTGTGG - Intergenic
916074958 1:161195338-161195360 GTGTGCTTCCTCTGCAGTGTGGG - Intronic
916551882 1:165857761-165857783 ATGTCCTTCCCCTGCAGCTTTGG + Intronic
916966228 1:169945293-169945315 GCCCCCTGCCCCTGCAGGTTCGG - Intronic
920571185 1:207019179-207019201 GTGCTCTGACTCTGCAGGGTAGG - Exonic
922769866 1:228175920-228175942 GTGTCCAGGGTCTGCAGGCTGGG + Exonic
923685316 1:236149358-236149380 TTGTCCTGCCTCTGCACGCCTGG - Intronic
1063483124 10:6394281-6394303 GTGTCCTGTCTCTGGAGATCAGG - Intergenic
1065864994 10:29906899-29906921 GTGTTCTGTCTCTGCTGGATTGG - Intergenic
1066044456 10:31583578-31583600 CTGTCCTGGCTCTGCAGGGTGGG + Intergenic
1066245366 10:33578178-33578200 ATGTCCTGATTCTGCAGGTTTGG + Intergenic
1071465313 10:85934395-85934417 GTGTCCAATCTCTGCAGCTTAGG - Intronic
1072945771 10:99808772-99808794 GTGACCTTCCTCTGCAGATCTGG - Intronic
1073491014 10:103853628-103853650 GTGTCCTGCATCTGCAACCTTGG + Intronic
1074122154 10:110500848-110500870 GGGTCCTGCCTCTTCAAGCTGGG - Intronic
1077532925 11:3105724-3105746 GTGCTCGGCCTCTGAAGGTTGGG + Intronic
1079190331 11:18271805-18271827 TTGTGCTGCATCTGCAGGTAGGG + Intergenic
1080744104 11:35092256-35092278 TTGGCCTGCCTTTGTAGGTTGGG - Intergenic
1081417340 11:42831737-42831759 GTATCCAGCCTCTGCAGTTTTGG - Intergenic
1081449510 11:43158300-43158322 GTGTCCACCCTCTGCAGTATAGG + Intergenic
1083858354 11:65404993-65405015 CTGCCCTGCCTCCGCAGCTTGGG - Exonic
1084303768 11:68268027-68268049 GTGTCCTGGCCCTGCAGGCTGGG - Intronic
1084474127 11:69379064-69379086 GTGACCAGCCTCGGCAGGTGTGG - Intergenic
1084648168 11:70472945-70472967 AGGTCCTCCTTCTGCAGGTTTGG + Intronic
1090644843 11:128758956-128758978 GCGTCCTGCCTCTGCCCCTTGGG + Intronic
1094441898 12:30486928-30486950 ATTTCCTGCCTCTTCAGCTTTGG + Intergenic
1098577808 12:72063607-72063629 GTCTCCTGGCTCTGCAGACTGGG - Intronic
1100504216 12:95204248-95204270 GTCTCCTTCATCTTCAGGTTTGG + Intronic
1104670918 12:130679559-130679581 GTGTCCTGTCTCTGATGGTGCGG + Intronic
1105026172 12:132850582-132850604 GTGTCCCGACGCTGCAGGCTAGG + Intronic
1105534836 13:21256291-21256313 GTGTCCTGCCTCTGCAGGTTGGG - Intergenic
1106325342 13:28684127-28684149 GTCTCCCGCCCCTGCAGGCTTGG + Intergenic
1110898049 13:80781962-80781984 GTGTCCTGGTTCTGTAGTTTTGG + Intergenic
1112589664 13:100751529-100751551 GTGCCCTGTGTCTGCAGGCTGGG + Intergenic
1118458217 14:65964101-65964123 ATGGCCTGACTCTGCAGGCTCGG + Intronic
1120587594 14:86333138-86333160 GTGTACTTCCTCAGCAGTTTTGG - Intergenic
1122276267 14:100592299-100592321 GCGACAAGCCTCTGCAGGTTTGG - Intergenic
1122474142 14:101994656-101994678 GTGTTCTTCATTTGCAGGTTTGG + Exonic
1123117509 14:105901341-105901363 GTCTCCAGCCTCTGCAGGTCGGG - Intergenic
1124318498 15:28693374-28693396 GTGGCCTCCCTCTCCGGGTTTGG + Intergenic
1124663449 15:31570029-31570051 TCGTCCTGCCTCTGCAGGCAGGG + Exonic
1124667790 15:31608921-31608943 CTTTCCTGCTTCTGCAGTTTGGG - Intronic
1127278814 15:57471356-57471378 GTGTCCTACCTCTCCATGTGAGG - Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1137356298 16:47768512-47768534 TTGGCCTGCCTTTGTAGGTTGGG - Intergenic
1139279561 16:65758697-65758719 CTGTCCTGGCTCTGCATTTTGGG - Intergenic
1140245671 16:73245879-73245901 TTGTCCTGCCTCTTTAGGTCTGG + Intergenic
1140412206 16:74748053-74748075 GTGGCCTGCCCCTGCGGGCTGGG - Intronic
1141786419 16:86203733-86203755 GGGTCCTGCCTCTCCAGGGGTGG + Intergenic
1141910399 16:87054636-87054658 GTGTCCTGGTTCTGGAGTTTAGG - Intergenic
1143059072 17:4184946-4184968 GCTTCCTCCGTCTGCAGGTTTGG + Exonic
1143663995 17:8345733-8345755 GTGTCCTGCAGCAGCAGTTTCGG + Exonic
1147427023 17:40350774-40350796 GTGTCCTGCCACAGGAGGCTGGG + Intronic
1147438742 17:40433836-40433858 CTGTGCTGCCTCTGGAGGTGGGG + Intergenic
1148821765 17:50364073-50364095 CTCTCCTGCCTCTGCAGGCCTGG - Intergenic
1149198332 17:54151361-54151383 GTTTCCTGCCTCTCCATTTTAGG - Intergenic
1149298528 17:55283439-55283461 CTGTCCTGCCAGAGCAGGTTTGG + Intronic
1152149270 17:78588878-78588900 GTGTCCTGCCCCTGAAGGGAAGG - Intergenic
1152875963 17:82786373-82786395 GTGTGGTGCCTCTGCAGGGGAGG + Intronic
1153202014 18:2656197-2656219 GGGACCGGCCTCTGCAGGTCGGG + Exonic
1153417957 18:4870500-4870522 GTGTCATTCCTCTGCTGGCTAGG - Intergenic
1153696284 18:7646195-7646217 GTGTCCTGCCTGTACAGATAAGG + Intronic
1160539391 18:79612174-79612196 GTCACGTGCCTCTGGAGGTTGGG - Intergenic
1161730790 19:5959363-5959385 CTGTCCTGCGTCTGCAGGAGTGG - Intronic
1162888445 19:13714012-13714034 TTGGCCTCTCTCTGCAGGTTGGG - Intergenic
1163012750 19:14435331-14435353 GTGTCCTCCCTCTGCCTGCTGGG + Intronic
1164722040 19:30439464-30439486 TTGTCCTGCCTCGGCTGTTTTGG + Intronic
1168046575 19:53798408-53798430 GCATCCTGTCTTTGCAGGTTGGG - Exonic
926682721 2:15675988-15676010 GGGGCCTGCCTCTGCAGAGTGGG + Intergenic
927447141 2:23173133-23173155 TTGGCCTGCCTCAGTAGGTTGGG - Intergenic
927759826 2:25742968-25742990 GTGCCCTGCCATTGCAGGTTTGG + Exonic
927888409 2:26732555-26732577 GTGTCCTGCCTCTGGGGGCAGGG - Exonic
927917616 2:26947056-26947078 CTCTCCTGCCCCTGCAGCTTCGG - Exonic
928638918 2:33277211-33277233 GTGTCTTGCCTCTGCCCCTTGGG + Intronic
928646936 2:33364630-33364652 CTCAGCTGCCTCTGCAGGTTAGG - Intronic
929250674 2:39751205-39751227 CTGTCATGCCTCTGCTGGCTTGG - Intronic
929795063 2:45053030-45053052 GTGTGCTGCCTCTGCTAGATGGG + Intergenic
931472552 2:62553501-62553523 GGCTCCTGCCACTGCAGGTGGGG - Intergenic
931800536 2:65753800-65753822 GTGACCTGACTCTGCAGTTTGGG + Intergenic
932345641 2:70993765-70993787 GAGTCCAGCCGCTGCAGGGTGGG + Exonic
932426837 2:71643131-71643153 GTGTCCTGTCTCGGCAGGTGGGG - Intronic
933242209 2:79934663-79934685 GTGTCCTTGCTCTGCAGCTCAGG + Intronic
933697826 2:85233256-85233278 GTGTGCTGACTCTTCAGGTCAGG - Intronic
933985537 2:87589066-87589088 GAGGCCTGCCACTGCAGGTGGGG + Intergenic
936308306 2:111361734-111361756 GAGGCCTGCCACTGCAGGTGGGG - Intergenic
937706629 2:124928183-124928205 GTGGCCTGCCACTGCTGGCTGGG - Intergenic
941396876 2:164984131-164984153 CTGTCTTCCCTCTGGAGGTTCGG + Intergenic
942647788 2:178132952-178132974 GTATACTGGTTCTGCAGGTTTGG + Intronic
945201382 2:207285188-207285210 GGATCCAGCCTCTGCAGCTTTGG + Intergenic
947072505 2:226306270-226306292 GAGACCTGGCTCTTCAGGTTTGG + Intergenic
947858408 2:233340375-233340397 GTGTCCTGCCTCTGAATCATGGG + Intronic
948301302 2:236909335-236909357 TTGTCCTCCCTGTGCAGTTTAGG + Intergenic
948988562 2:241540571-241540593 GGGTCCCACCTCTGCAGCTTCGG + Intergenic
1174775276 20:53338049-53338071 GTGTCCCTGCTCTGCAGGTGAGG - Intronic
1176042765 20:63073876-63073898 GTGTCCAGCCTGTGCAGGGAGGG - Intergenic
1176049584 20:63110817-63110839 GCCACCTGCCTCTGCAGGGTGGG + Intergenic
1176055227 20:63141718-63141740 GAGTCCAGCATCTGCAGGCTGGG - Intergenic
1177857680 21:26418144-26418166 TTGGCCTGCCTCTGCTGCTTAGG + Intergenic
1179176906 21:39014637-39014659 GTGTCGTGTCTCAGCAGGCTGGG + Intergenic
1179448835 21:41453764-41453786 GTGTCCTGCCTCTTTAGGGAGGG - Intronic
1180228603 21:46413079-46413101 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1180228621 21:46413139-46413161 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1180228639 21:46413199-46413221 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1180228676 21:46413318-46413340 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1181486091 22:23232574-23232596 GGGTCCTGCCTTTCCAGGTGGGG - Intronic
1181781892 22:25199779-25199801 GGGTGCTGCCTCAGCAGGCTGGG + Intergenic
1182279776 22:29211251-29211273 GAGTCCTGTATCTGCAGGTATGG + Intronic
953539645 3:43805416-43805438 TTGGCCTGCCTCTCTAGGTTGGG + Intergenic
954536964 3:51368031-51368053 TTGGCCTGCCTCGGTAGGTTGGG + Intronic
959308233 3:104696570-104696592 GTGCCCTGCCCCTGGAGGTGGGG + Intergenic
959872418 3:111343324-111343346 TTGTTCTACCTCTCCAGGTTGGG - Intronic
960680844 3:120246138-120246160 GATTCTTGCCTCTGCAGATTTGG - Intronic
961599083 3:128045129-128045151 CTGTGCTGCATCTGCAGATTCGG + Intergenic
968683351 4:1937548-1937570 GTGTCTTGTCTCTTCAGATTTGG + Intronic
968881470 4:3302431-3302453 GTGTGGTGCTTCTGCAGGATTGG + Intronic
969450795 4:7271877-7271899 GGGACCTGCCTCTGCAGCCTGGG - Intronic
975414992 4:74095648-74095670 TTGTCCTTCCTTTTCAGGTTTGG + Intergenic
978061370 4:104344593-104344615 GCCTCCTGCCCCTGCAGGCTCGG + Intergenic
979082037 4:116357894-116357916 GTGGCATGACTCAGCAGGTTTGG + Intergenic
979090672 4:116478448-116478470 GAGCCCTGCCCCTGCAGGCTTGG - Intergenic
979550291 4:121983396-121983418 GTTTCCTGACTCTATAGGTTGGG + Intergenic
986148754 5:5107226-5107248 GTGGTCTGACTCTCCAGGTTTGG - Intergenic
989643542 5:43605112-43605134 GTATCCTCCCTCTTTAGGTTGGG + Intronic
991539695 5:67713407-67713429 GTCTGCTGCCTCTTCAGTTTTGG - Intergenic
993031015 5:82705831-82705853 GTGTCTTTCCTCTGTAGGTGAGG - Intergenic
994851159 5:105057026-105057048 GTGTCCTGCCCTTGTAGGCTTGG + Intergenic
995749277 5:115437328-115437350 CAGTCCTGAGTCTGCAGGTTAGG + Intergenic
996310137 5:122095247-122095269 CTGTCCTACCTCTGGAGTTTAGG - Intergenic
997077481 5:130697419-130697441 GGGTCCTTCCTTTGTAGGTTTGG + Intergenic
998742470 5:145220201-145220223 TTGTCCTGCCTCAGCACCTTTGG - Intergenic
999776489 5:154816327-154816349 GTGTTTTTCCTCTGCTGGTTTGG + Exonic
1002721282 5:181262559-181262581 GTCTTCTGTCTCTGCAGGTAGGG + Intergenic
1003376390 6:5581649-5581671 GTGTCCTGCCTCTGCACGTTGGG + Intronic
1005413491 6:25575994-25576016 GTGGCCTTCCTCAGGAGGTTTGG + Intronic
1006211951 6:32403211-32403233 GTGGCTTCCCTCTGCAGGTCTGG - Exonic
1007586626 6:42994475-42994497 CTGACCTGCCTCTGCAGGTAAGG + Intronic
1008007287 6:46424401-46424423 GTGTCCTGCCTCTGAAGCAAAGG + Intronic
1009819664 6:68783780-68783802 GTGACCTAATTCTGCAGGTTGGG - Intronic
1013195981 6:107845943-107845965 GTCTCCTGTCACTGCAGGTGGGG - Intergenic
1014405582 6:121046663-121046685 GGTTCCTTCTTCTGCAGGTTGGG - Intergenic
1016549446 6:145260803-145260825 ATTCCCTGCCTCTGCAGGATTGG + Intergenic
1017719052 6:157232392-157232414 GTGCCCTGCTTCTGCAGGACTGG - Intergenic
1018114110 6:160566132-160566154 TTGGCCTGCCTTTGTAGGTTGGG - Intronic
1018197722 6:161369276-161369298 GTGTCCAGACTCTGGAGATTGGG + Intronic
1018370297 6:163162165-163162187 CTGTCCTGGCTCTCCAGGCTGGG - Intronic
1019709027 7:2509983-2510005 CTGGCCTGCCTCAGCAGGGTGGG - Intergenic
1019734601 7:2644567-2644589 GGGTCCTGCCCCTGGAGGGTGGG + Intronic
1020240162 7:6388215-6388237 GAGTCCTCCCTGTGCAGGCTGGG + Intronic
1020440705 7:8213745-8213767 GTGTCCTGATTGTGAAGGTTTGG - Intronic
1021306489 7:19038764-19038786 TTGGCCTGCCTCTCTAGGTTGGG + Intronic
1024557879 7:50619145-50619167 GAGTCTTACCTCTTCAGGTTTGG - Intronic
1032386665 7:131530106-131530128 GTGTGATGCCATTGCAGGTTCGG + Intronic
1034263380 7:149770658-149770680 CTGTCCTTCCTGAGCAGGTTGGG - Intronic
1035717402 8:1764261-1764283 GGGTCCTGCCTGCGCGGGTTGGG + Intronic
1038780439 8:30565015-30565037 GTGGCCTGGCTCTGCAGCTCTGG + Intronic
1038906713 8:31912492-31912514 GTGACCTGCCTCTGAGAGTTTGG + Intronic
1041417038 8:57622225-57622247 GTGCCATGCCTCAACAGGTTTGG - Intergenic
1041957057 8:63567689-63567711 GTATCCAGCCTTTCCAGGTTAGG + Intergenic
1042294109 8:67201563-67201585 GTCTCCTGCTTCAGAAGGTTGGG + Exonic
1042888987 8:73586195-73586217 GGCTTCTTCCTCTGCAGGTTAGG - Intronic
1042940569 8:74103193-74103215 GTGTATTGCCTCTGCAGGGTCGG - Intergenic
1046524969 8:115371924-115371946 TTGGCCTGCCTCGGTAGGTTGGG - Intergenic
1046759245 8:118004091-118004113 TTTTCCTGCCTCTGCTGTTTGGG - Intronic
1048228801 8:132616892-132616914 ATGTCCTTCCACTGCAGGCTGGG + Intronic
1048291054 8:133182029-133182051 GTGCCCAGGCTCTGGAGGTTAGG - Intergenic
1049533979 8:143169562-143169584 GTGTCCTGGCTCTGGAGGGGAGG - Intergenic
1051331234 9:16026657-16026679 ATCTCCTGCCTCTGGAAGTTGGG - Intronic
1053013239 9:34647270-34647292 GAGCCCTGCATCTGCAGGCTGGG + Intronic
1055057299 9:72035678-72035700 GTGTCTGTCCTCTGTAGGTTAGG + Intergenic
1055274469 9:74598800-74598822 ATTTCATGCCTCTGCAGGCTAGG + Intronic
1058961897 9:109999452-109999474 GGTTCCTGCCTCTCCAGTTTAGG + Intronic
1059258663 9:112954798-112954820 ATTTCCTGCTTGTGCAGGTTTGG - Intergenic
1059449154 9:114359462-114359484 CTGTCCTGCCTCTTCAAGTGTGG - Intronic
1059948796 9:119440490-119440512 GTGTCTTGCCTCTGCAGCTTGGG - Intergenic
1060773155 9:126347251-126347273 CTGTCCTGCCCCTGCACGCTGGG + Intronic
1061480589 9:130896077-130896099 GGGTCCTGCCTTTGCTGGGTTGG + Intergenic
1062497878 9:136840137-136840159 CTGTCCTGTCTGTGCAGGTAAGG + Exonic
1185700099 X:2224234-2224256 GTGTTCTGCAGCTGCAGCTTAGG + Intronic
1185748319 X:2589794-2589816 GTCTCCTGGATCTGCACGTTGGG + Intergenic
1187829017 X:23362190-23362212 TTGTCCTGCCTTTCTAGGTTAGG + Intronic
1187938227 X:24356527-24356549 CTTTCCTACCTCTGCAGGTAGGG + Intergenic
1188017505 X:25121676-25121698 TTGTCCTGCCTTTCTAGGTTGGG + Intergenic
1189600491 X:42619671-42619693 GTGTTCTGACTCTGTAGGTCTGG + Intergenic
1191846466 X:65551070-65551092 CTGCCCTGCCTCCGCAGCTTGGG + Intergenic
1195449974 X:105000229-105000251 ATGTCCTTCCTCTGGAGCTTAGG - Intronic
1195687711 X:107601313-107601335 GTGCCCTGCTTCTGCAGGGTGGG - Exonic
1199555391 X:149102364-149102386 GTGTCCTGCCTGTCCAGATAAGG - Intergenic
1201915208 Y:19174083-19174105 TTGTCCTGCCTCGCTAGGTTGGG - Intergenic