ID: 1105535168

View in Genome Browser
Species Human (GRCh38)
Location 13:21259315-21259337
Sequence GCCACTGTGTGAGCTGCTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 147}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105535161_1105535168 9 Left 1105535161 13:21259283-21259305 CCCAGAGTTCACTCCCTGCCCAG 0: 1
1: 1
2: 1
3: 28
4: 317
Right 1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG 0: 1
1: 0
2: 2
3: 10
4: 147
1105535165_1105535168 -5 Left 1105535165 13:21259297-21259319 CCTGCCCAGTGAGAAGGAGCCAC 0: 1
1: 1
2: 0
3: 23
4: 272
Right 1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG 0: 1
1: 0
2: 2
3: 10
4: 147
1105535166_1105535168 -9 Left 1105535166 13:21259301-21259323 CCCAGTGAGAAGGAGCCACTGTG 0: 1
1: 0
2: 2
3: 19
4: 222
Right 1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG 0: 1
1: 0
2: 2
3: 10
4: 147
1105535162_1105535168 8 Left 1105535162 13:21259284-21259306 CCAGAGTTCACTCCCTGCCCAGT 0: 1
1: 1
2: 1
3: 31
4: 262
Right 1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG 0: 1
1: 0
2: 2
3: 10
4: 147
1105535160_1105535168 25 Left 1105535160 13:21259267-21259289 CCTCAGCTCAGCGCAGCCCAGAG 0: 1
1: 0
2: 6
3: 49
4: 493
Right 1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG 0: 1
1: 0
2: 2
3: 10
4: 147
1105535167_1105535168 -10 Left 1105535167 13:21259302-21259324 CCAGTGAGAAGGAGCCACTGTGT 0: 1
1: 0
2: 4
3: 25
4: 204
Right 1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG 0: 1
1: 0
2: 2
3: 10
4: 147
1105535164_1105535168 -4 Left 1105535164 13:21259296-21259318 CCCTGCCCAGTGAGAAGGAGCCA 0: 1
1: 1
2: 1
3: 53
4: 500
Right 1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG 0: 1
1: 0
2: 2
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105535168 Original CRISPR GCCACTGTGTGAGCTGCTAC CGG Intergenic
903031992 1:20470374-20470396 GCTGCTGTGTGAGCTGATATGGG - Intergenic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
903948967 1:26982992-26983014 GCCACTGTGCAAGGTGCTAGAGG - Intergenic
907278718 1:53331065-53331087 GTCACTCTGTGAGCTGCTGGAGG + Intergenic
908823846 1:68115036-68115058 GCCACTGTGTGGCCTGTGACAGG + Intronic
908929371 1:69298786-69298808 GCCACTGTGTGTGCTCTTATTGG + Intergenic
909042194 1:70668098-70668120 GCCTCTGTGTCAGCTGCTCAGGG - Intergenic
912392462 1:109313636-109313658 TACACTGTGAGAGCTGATACTGG + Exonic
918590988 1:186240921-186240943 CCCACAGTGTGAGCAGCTACAGG + Intergenic
919201176 1:194357273-194357295 GTCACTGTTTAAGCTGTTACAGG + Intergenic
919772816 1:201173524-201173546 CCCTCTGTGTGAGCTGAGACCGG - Intergenic
920979869 1:210823072-210823094 CTCTCTGTGTGAGCTGCTCCTGG + Intronic
921151284 1:212405048-212405070 GCCACAGTGTGAGCCCCTTCAGG + Intronic
922305610 1:224341268-224341290 GCCACTGCGCGAGCTGCAGCAGG - Intergenic
922713600 1:227852836-227852858 GCCCATGTGTAAGCTGCTGCTGG + Intergenic
1062849175 10:729736-729758 CCCACAGTGTGATCTGCTAGAGG - Intergenic
1064267035 10:13833490-13833512 GCCACTCTGTGAGCTCCTGAAGG - Intronic
1066126702 10:32348743-32348765 CCCACTGTGTAAGCTCCTCCAGG - Intronic
1067539875 10:47143709-47143731 GGCAGAGTGTGAGCTGCTAAGGG + Intergenic
1069493261 10:68879784-68879806 GCAACTGTGGGAAATGCTACTGG + Intronic
1069799237 10:71072022-71072044 GAAACTGTGTGAGCTGATCCAGG + Intergenic
1070475815 10:76828049-76828071 GCCACTCTGAGTGCTGATACTGG + Intergenic
1071516847 10:86303722-86303744 GCAACTGGGTGAGCTGCTGGTGG - Intronic
1074595636 10:114863662-114863684 CTCACTGTGAGAGCTTCTACTGG - Exonic
1075117044 10:119635711-119635733 GCAACTGTGGCAGCTGCTATGGG + Intergenic
1076581922 10:131517575-131517597 GGCACTGTGTCAGCTGCTGGGGG - Intergenic
1076652383 10:131998829-131998851 GCCACTGTGTGAGGTGGCAGTGG + Intergenic
1076985537 11:233357-233379 GCCACTGGGTGTGCTGATGCCGG + Exonic
1077359232 11:2133361-2133383 GCCAGCGTCTGAGCTGCTCCCGG + Intronic
1078697255 11:13646977-13646999 GCAACTGTGTGAGCAGCTGCTGG - Intergenic
1079464186 11:20713340-20713362 GCCACTGTGAGGGCTGGTAGAGG + Intronic
1081721778 11:45294644-45294666 GGCACTGTGTAAACTGCTCCAGG + Intergenic
1082700430 11:56423091-56423113 GCAAATGTGTGATCTACTACTGG + Intergenic
1084320644 11:68371695-68371717 GCCCCTGGGTGAGCAGCTCCAGG - Intronic
1089043829 11:115481321-115481343 GCCACAGTGTCAAATGCTACAGG - Intronic
1089363885 11:117909392-117909414 GGCACTGTATCAGCTGCTAACGG - Intronic
1089582622 11:119490873-119490895 GCCACTCTCTGGGCTGCTGCAGG + Intergenic
1090417983 11:126554036-126554058 GGAACTGTGTGAGGTGCTGCTGG - Intronic
1096266774 12:50129841-50129863 GCCACTGGGTGAGCTGTTCACGG - Exonic
1097224016 12:57466286-57466308 GCCACTGGGGGGGCTGCTCCAGG + Exonic
1100616985 12:96238464-96238486 GCCCTTGTGTGAGCTGCTGCTGG + Intronic
1100882683 12:99035929-99035951 TCCACTGGGTGAGCTGCTCAGGG + Intronic
1101728203 12:107405277-107405299 GCCACTGTGAGTGCTGTTAATGG + Intronic
1104903637 12:132202235-132202257 GCAACTGAGTGAGGTGCTCCAGG - Intronic
1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG + Intergenic
1107645875 13:42493830-42493852 TCCACCATGTGAGCTGCTTCTGG - Intergenic
1107851094 13:44574348-44574370 GCCACTATGAGTGCTGCAACTGG - Exonic
1113784508 13:112995465-112995487 GCCGCTGTGTGAGCTGCTGCTGG + Intronic
1114473929 14:22981463-22981485 GACACTCTGTGACCGGCTACGGG - Exonic
1121622913 14:95362622-95362644 GCCCCAGTGGGAGATGCTACAGG - Intergenic
1123032487 14:105458514-105458536 GCCTCTCTGGGAACTGCTACCGG - Intronic
1125260993 15:37824404-37824426 GCCATTGGGTAATCTGCTACAGG - Intergenic
1125333879 15:38608376-38608398 GCCTCTGTGTGAGGTGTTTCTGG - Intergenic
1130085534 15:80775880-80775902 GCCACTATAGGAGCTACTACAGG + Intergenic
1132094450 15:98971284-98971306 GCCACTTTGTGAGCTCCTTGAGG - Intronic
1136677318 16:31922465-31922487 GCCATTGTGTGAGGAGCTTCTGG + Intergenic
1137693406 16:50445681-50445703 CCCTCTGTGTGGGCTGCCACTGG + Intergenic
1138593530 16:58016679-58016701 TCCACTGTGTGAGATACTGCTGG + Intronic
1139514689 16:67446199-67446221 GCCACTGGGGGAGCTCCCACAGG + Intronic
1139547437 16:67656310-67656332 GCCACTGTGTGTGTTGGTAGTGG + Intronic
1141634937 16:85309622-85309644 GGCACTGTGGAAGCTGCTCCCGG - Intergenic
1147176351 17:38658492-38658514 GTCTCAGTGTGGGCTGCTACAGG - Intergenic
1147763825 17:42819348-42819370 CCCACTCTGTGAACAGCTACAGG + Intronic
1151586571 17:75012480-75012502 GCCAGAGAGCGAGCTGCTACCGG - Intergenic
1152041330 17:77905843-77905865 GCACCTGTGTGAGCAGCTAGTGG - Intergenic
1152404794 17:80091039-80091061 GCGACTGTGTCAGCCGCTGCAGG + Intronic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1154305680 18:13229142-13229164 GCCTGTGTGTCAGCTGCCACGGG + Intronic
1156556899 18:38078099-38078121 GCCAATGTGTCAGCTGCTAGGGG - Intergenic
1158666349 18:59436263-59436285 GCCAATGTGAGGACTGCTACAGG + Intronic
1158775247 18:60571007-60571029 TCCACTATGTGAGTTGCTATAGG + Intergenic
1163762603 19:19145781-19145803 GCCACCGGGTGATCTCCTACCGG + Exonic
1164146473 19:22515571-22515593 ACCACTGTGTGAGCTATTCCAGG + Intronic
1164633661 19:29777634-29777656 GCCTCTGTGTGAGCTCACACAGG - Intergenic
1164797490 19:31045815-31045837 GCCACCCTGTGGGCTGCTCCTGG - Intergenic
1166888472 19:45975339-45975361 GCCACTGCGTGATCTGCGGCAGG + Intergenic
930886115 2:56328853-56328875 ACCACTGAGGGAGCTGCTATGGG - Intronic
931681576 2:64753564-64753586 GCCCCTGTGTCAGTTGTTACTGG + Intergenic
933701628 2:85259125-85259147 GCCACTGTGTGTGGTGCTGTGGG - Intronic
933740984 2:85533714-85533736 GTCACTGTCTGTGCAGCTACCGG + Intergenic
938297640 2:130188352-130188374 CCCAGTGTGGGAGCTGCTGCAGG + Intronic
938459131 2:131486314-131486336 CCCAGTGTGGGAGCTGCTGCAGG - Intronic
939303323 2:140376858-140376880 GCCTCTGTGGGAGATACTACAGG - Intronic
941603872 2:167571541-167571563 CCCTCTGTGTGAGGTGCTATGGG - Intergenic
941815306 2:169790054-169790076 ACCGCTGTGTGAGCTGGGACTGG + Intergenic
945871837 2:215235579-215235601 ACCACTATTTGAGTTGCTACAGG - Intergenic
946733794 2:222734227-222734249 GCCACTGTGCCAGCTGCTCAGGG + Intergenic
1168804543 20:664559-664581 ACCACTGTCGGAGCTGCCACAGG - Intronic
1171206582 20:23286478-23286500 GCCACAGTGGGATCTGTTACCGG + Intergenic
1172163133 20:32882391-32882413 GGAACTGTGTGAGGTGCTGCTGG - Intronic
1174465470 20:50713847-50713869 GGCACTGTCTGAGCTGCAAGTGG - Intergenic
1175543907 20:59765811-59765833 GTCACTGTGTTAGCTCCTATGGG - Intronic
1176424217 21:6538095-6538117 GCCTCTGGGTGAGCTGCAGCAGG - Intergenic
1177107553 21:16978785-16978807 GCCACTCTCTGAGCTGCTGGGGG - Intergenic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
1179699710 21:43146410-43146432 GCCTCTGGGTGAGCTGCAGCAGG - Intergenic
1180988524 22:19919709-19919731 GCCACTGTGTGGGCAGCCGCAGG - Intronic
1181181872 22:21074140-21074162 CCCATTGTGGGAGCTGCTGCAGG - Intergenic
1183274649 22:36885984-36886006 CCCAAAGTGTGAGCTGCTACGGG + Intergenic
1183985455 22:41567636-41567658 CCTACTGTGTGAGCTGGTACAGG - Intronic
1184495733 22:44840207-44840229 GCCACTGTGACAGCAGCCACAGG - Intronic
950263878 3:11560947-11560969 GCCAGTGTGAGATCTGCTCCAGG - Intronic
950547205 3:13645628-13645650 GCCGCTTTGTGAGCTGCCATAGG - Intergenic
953845170 3:46421034-46421056 GGCACTCTGTGTGCTGCCACAGG + Intergenic
954714803 3:52521678-52521700 GCCACGCTGTGAGGTGCAACTGG + Exonic
957971775 3:87391111-87391133 GCCACTCTCTGAGCTGGTACTGG - Intergenic
962234169 3:133693599-133693621 GCCTCAGTGTCAGGTGCTACTGG + Intergenic
962961007 3:140310902-140310924 GCCTCTGTGTTAGGTGCTGCAGG + Intronic
964624728 3:158748205-158748227 GCAGCTGTGTGACCTGCTTCTGG + Intronic
964638758 3:158885947-158885969 CCCACAGTGTTAGCTGCCACTGG - Intergenic
966875923 3:184321632-184321654 TCCACTGTGTGAGATGCCAAAGG - Exonic
968456160 4:701083-701105 TCCACTGTTTCAGCTGCTTCGGG + Intergenic
971388302 4:26161633-26161655 GCCTCTGTGTGACCTACTTCTGG - Intergenic
973910792 4:55578191-55578213 GCCATTGTGTGAACTCCCACTGG - Intronic
987507679 5:18794056-18794078 AGCACTCTGTGAGCTGCCACAGG - Intergenic
988575557 5:32420011-32420033 GTAACTGTGTGAGCAGCTACTGG + Exonic
989268464 5:39504486-39504508 GCCACTGTCTGAGGCTCTACAGG + Intergenic
991410092 5:66337084-66337106 CCTTCTGTGTGAGCTGCTTCAGG + Intergenic
992088041 5:73295751-73295773 GCCCCTTTGAGAGCTGCCACTGG - Intergenic
993190327 5:84672233-84672255 GAAACTGTGTGAGGTGCTGCTGG + Intergenic
999650854 5:153766044-153766066 ACCACTGTGGGAGATGCTGCAGG + Intronic
1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG + Intergenic
1002500474 5:179644443-179644465 GCCTCTGTGTGAGGTGCTCTGGG - Intronic
1003088636 6:3082177-3082199 GCCCCTGTGTCAGCAGCTCCTGG - Intronic
1003375991 6:5578286-5578308 GCCACAGTCTAAGCTGCTATGGG - Intronic
1004484899 6:16057270-16057292 GCCACTGTGGAAGGTGCTATAGG - Intergenic
1005811161 6:29517546-29517568 GCCACTGTGTGACCTCAGACAGG + Intergenic
1006065910 6:31462679-31462701 GCCACAGAGTGAGCTTCTCCTGG - Intergenic
1007909078 6:45495057-45495079 GCCACTGTGTTATCTTCTTCAGG + Intronic
1008370462 6:50724738-50724760 GCCACCGTCTGTGCTGCAACTGG - Intronic
1012376634 6:98569726-98569748 GCCAGTGTAGGAGCTGCTTCTGG - Intergenic
1016437335 6:144050239-144050261 CCCACTGTGTGACATGCTAGGGG + Intronic
1018707830 6:166475799-166475821 GCCCCCGTGTGAGTTGCTCCAGG - Intronic
1019730065 7:2624617-2624639 GCCACTCTGTGGGCTGCAATTGG - Intergenic
1021804750 7:24343686-24343708 GCAGCTGTGTGATGTGCTACAGG - Intergenic
1029706345 7:102278247-102278269 TCCACTCTGTGAGCTTCTCCCGG - Intronic
1032874659 7:136024700-136024722 GCCACTGCCTGAGCTGTTACAGG - Intergenic
1034202388 7:149290523-149290545 GGCACTGTGTAAGGTGCTAGAGG - Intronic
1034576727 7:152006171-152006193 GCCACTGTGTTGGATGCTGCTGG - Intronic
1037833928 8:22205182-22205204 GCCACTGTGTCAGCTCCCAGTGG - Intronic
1045711596 8:104990844-104990866 GCAGCTGTGTCAGCTGCTTCAGG + Intronic
1045937183 8:107694309-107694331 GGCAATATTTGAGCTGCTACTGG + Intergenic
1049040819 8:140110787-140110809 GCTACAGGGGGAGCTGCTACCGG - Intronic
1049763178 8:144340000-144340022 GCCATAGTGAGAGCTGCTGCTGG + Intergenic
1049797522 8:144503487-144503509 GCCACGGTGTGAGCTGTCCCAGG + Intronic
1052116248 9:24651613-24651635 GTCCCTGAGTGAGCTCCTACTGG + Intergenic
1053167877 9:35857265-35857287 ACCACCGTGTGAGCTCCTTCAGG - Intergenic
1056581898 9:87894701-87894723 GAGACTGAGTGAGGTGCTACCGG - Intergenic
1057482507 9:95456413-95456435 ACCACTGTGTGCCCTGCTCCAGG - Exonic
1059150278 9:111943287-111943309 ACCACTGTGTGATCAGCTATAGG - Intergenic
1059453171 9:114383476-114383498 GCCTTTGTGTGAGCTGCTCTGGG - Intronic
1060216252 9:121740199-121740221 TCCACTGGGTCAGCTGCTGCTGG - Intronic
1061841094 9:133359042-133359064 GCCAGTGTGTTAGCTGCTCAGGG + Intronic
1061956173 9:133962348-133962370 GCCACTTTGAGAGCTGCTTGTGG - Intronic
1192080225 X:68040661-68040683 CCCACTGTGTGCCCTGCCACTGG + Intergenic
1197445405 X:126547388-126547410 GTCACTATGTGAGCTGCTCAGGG - Intergenic
1197501150 X:127243900-127243922 GCCACTGGGTGGGCAGCTCCAGG + Intergenic
1198129709 X:133681563-133681585 GCCACTTTCTTTGCTGCTACTGG - Intronic
1198152441 X:133924145-133924167 TCCACTATGTGTGCTGGTACAGG + Intronic
1200037059 X:153338458-153338480 TCCCCTGCATGAGCTGCTACAGG + Intronic