ID: 1105537435

View in Genome Browser
Species Human (GRCh38)
Location 13:21281000-21281022
Sequence GCTCAACAGAAGCTGAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105537435_1105537437 15 Left 1105537435 13:21281000-21281022 CCAATCCTCAGCTTCTGTTGAGC 0: 1
1: 0
2: 0
3: 25
4: 152
Right 1105537437 13:21281038-21281060 GCCATGTCTTTTATAGCACAAGG 0: 1
1: 0
2: 2
3: 15
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105537435 Original CRISPR GCTCAACAGAAGCTGAGGAT TGG (reversed) Intergenic
900704490 1:4071846-4071868 GCTCAGCAGCAGCTGGGGACAGG - Intergenic
901804042 1:11726570-11726592 GCTCAACAGAAGCCAGGGCTGGG + Intergenic
903126324 1:21250710-21250732 GCTTAACAGATGCTGAGGCCGGG + Intronic
904324401 1:29718643-29718665 GCTCAAGAGAGGTTGAGGAGAGG - Intergenic
907332745 1:53681851-53681873 GCTCTACAGAAGAAGAGGATGGG - Intronic
912502394 1:110130815-110130837 GCTGAACAAAAGCTGAGGGGAGG - Intergenic
912996273 1:114535419-114535441 GCTAATCAGAAGCTCAGGTTGGG + Intergenic
913528510 1:119715697-119715719 GCTGAACAGCAGCTAAGGACAGG + Intronic
918824520 1:189306141-189306163 GGTTACCAGAGGCTGAGGATGGG - Intergenic
919428585 1:197465309-197465331 GCACAACAGAAGCAAAGGCTAGG - Intronic
920142638 1:203830008-203830030 GATCAACAGAAACTAAGTATAGG - Intronic
921113813 1:212066864-212066886 TCTCAGCAGGAGCTGTGGATGGG + Exonic
922089167 1:222379192-222379214 GATCCACAGAAGCTAAGTATGGG + Intergenic
1064044172 10:11996467-11996489 CCTCATGAGAAGCTGAGTATGGG + Intronic
1066986676 10:42474831-42474853 GTTCCACAGAAGCTGGGGAAAGG + Intergenic
1067395799 10:45915807-45915829 TGTAAACAGAAGCTGAGGAATGG + Intergenic
1067864120 10:49884930-49884952 TGTAAACAGAAGCTGAGGAATGG + Intronic
1071399700 10:85257204-85257226 GCTCAACAGGAGGTCAGGAGAGG + Intergenic
1076289914 10:129337477-129337499 GCTGCAAAGAAGCAGAGGATGGG + Intergenic
1077464215 11:2725901-2725923 GTTCAGCAGAATCTGAGGAGCGG - Intronic
1078095010 11:8291505-8291527 GGGCAACAGAAGCTGGTGATAGG - Intergenic
1078369103 11:10730410-10730432 GCTCTGCAGAGGCTGAGGTTGGG - Intergenic
1078611381 11:12822500-12822522 CCTGCGCAGAAGCTGAGGATGGG - Intronic
1080837717 11:35955835-35955857 GCTCATCAGGTGCTGAGGACTGG + Intronic
1083401165 11:62424428-62424450 CCTAAATAGAAGCGGAGGATTGG + Intergenic
1085393216 11:76193166-76193188 GCTCAGCATAAGCTGGGGAAAGG + Intronic
1090682110 11:129072033-129072055 GATTAACATGAGCTGAGGATAGG + Intronic
1093047172 12:14460714-14460736 GCTCTGTAGAAGCTGAGGCTGGG - Exonic
1094355747 12:29575481-29575503 GCTCAACAAAAGTTGAGGTAGGG - Intronic
1094437549 12:30437640-30437662 GCTCAACATAACTTGAAGATAGG + Intergenic
1094495074 12:30984133-30984155 GCTCAGCAGGAGCTGAGTGTGGG + Intronic
1096645822 12:53034856-53034878 GCTCCAAAGAATCTGAGGAATGG + Intronic
1097261532 12:57723238-57723260 GCTGATCAGAAGCTCAGAATGGG + Intergenic
1097710403 12:62911542-62911564 GCTCAAGAGGAGCTGGGGACTGG - Intronic
1098370630 12:69756783-69756805 GCCTAACAGGAGCTGAGGCTGGG - Intronic
1099122348 12:78706913-78706935 GCTGAAAAGAAACTGAAGATAGG + Intergenic
1101601686 12:106215350-106215372 GCTCTGCAAAAGCTGAGGTTAGG + Intergenic
1105537435 13:21281000-21281022 GCTCAACAGAAGCTGAGGATTGG - Intergenic
1107416151 13:40202567-40202589 GCCCAAAAGGAGCTGAGAATTGG + Intergenic
1112151566 13:96770328-96770350 GCTCAAGAGAAACTGAGAATAGG - Intronic
1113761396 13:112849821-112849843 GCTCAGCAGGAGGTGAGGCTGGG + Intronic
1115317012 14:32035511-32035533 GCTCAAAAGAAAGGGAGGATTGG + Intergenic
1116289344 14:43012469-43012491 GCTCAACTGAAGCTCATAATAGG - Intergenic
1120203062 14:81559536-81559558 GCCCCCCAGAAGCTGAGGAGAGG - Intergenic
1121927367 14:97940457-97940479 GGTTAACAGAAGCTGAGCAGGGG - Intronic
1122997106 14:105271239-105271261 ATTCAACAGAAGCTCAGGACAGG + Intronic
1123427919 15:20187835-20187857 GGTCAACAGAAGCCTAGGCTGGG - Intergenic
1123660330 15:22559104-22559126 CCTCAATGGAAGCTGAGGCTTGG - Intergenic
1124022754 15:25939138-25939160 GCTGAGCAGAAGCTGCGGTTGGG + Intergenic
1128347450 15:66863487-66863509 TCCCAGCATAAGCTGAGGATAGG - Intergenic
1131454260 15:92570946-92570968 GCTCAGTTGAAGCTGAGGACTGG - Intergenic
1131734193 15:95314506-95314528 GAAAAACAGAAGCTGAGGAAGGG - Intergenic
1133372305 16:5254533-5254555 GCATAACTGAAGCTGAAGATCGG - Intergenic
1134563150 16:15228065-15228087 GCAAAACAAAAGCTGAGGATGGG - Intergenic
1134923682 16:18139694-18139716 GCAAAACAAAAGCTGAGGATGGG - Intergenic
1136856379 16:33661926-33661948 GGTCAACAGAAGCCTAGGCTGGG + Intergenic
1140833365 16:78771313-78771335 CCTCAACAGAAGCTGGGGGTTGG - Intronic
1142191611 16:88720735-88720757 TCCCTACAGAAGCTGAGGACAGG - Exonic
1144076163 17:11721555-11721577 GCTCAGCACATGCTGAGGAAAGG - Intronic
1147660796 17:42115854-42115876 ACTCACCAGGAGCTGAGGATGGG + Intronic
1147740668 17:42669584-42669606 GCTCCACAGAAGCTGTGCCTGGG - Exonic
1148077918 17:44949943-44949965 GCTCAAAGGAAGCAGAGGAAAGG + Intergenic
1152370555 17:79885849-79885871 GCTCAACAGAAGGTGAGAGCAGG + Intergenic
1152409429 17:80115337-80115359 GCTCAACAGCAGATGAGAACTGG - Intergenic
1152500859 17:80708074-80708096 GCTTAACAGAAGCTACGGATGGG - Intronic
1152595418 17:81235556-81235578 GCACAGCAGGACCTGAGGATGGG - Intronic
1152831991 17:82503130-82503152 GCTTCACAGAAGCTCAGAATAGG + Intergenic
1157173365 18:45428505-45428527 GCACCACAGAAGCTCAGGAAGGG + Intronic
1157188061 18:45557589-45557611 ACTCCAGAGAAGCTGAGAATAGG - Intronic
1157727540 18:49976456-49976478 ACTTAACAGAAGGAGAGGATAGG + Intronic
1159313900 18:66745747-66745769 GCTCAACAGCTGCTGACGTTAGG + Intergenic
1163303297 19:16461720-16461742 GCTCATCAGAGGGTGAGGAAAGG - Intronic
1163340510 19:16703477-16703499 CCTCAACAGAAACTGACCATGGG + Intergenic
1167117280 19:47495642-47495664 TTTCAGCAGAAGCTGAGGAGAGG + Intronic
1167986777 19:53325056-53325078 GCACAACAGGAGGTGAGCATCGG + Intergenic
1168220924 19:54959848-54959870 GAACAACAGAAGCTCAGGAGCGG - Intronic
1168627611 19:57931562-57931584 GCTCAAAAGAAGCTGATGGTTGG - Intronic
925615566 2:5741459-5741481 GTTGCTCAGAAGCTGAGGATAGG + Intergenic
926019365 2:9481827-9481849 GGTCCACAGAAGCTGGGGGTAGG + Intronic
927968609 2:27288974-27288996 GATAAACAGAAGCAGAAGATAGG + Intronic
928006344 2:27565597-27565619 GCACAAAAGGAGCTGAGGAAAGG - Intronic
928420409 2:31134168-31134190 GCTCCACAGAATCTAAGGGTCGG + Intronic
928721753 2:34129264-34129286 GCTCAACAGAAGATGATGTTTGG - Intergenic
929549116 2:42878240-42878262 GCTCAGCAGACTCTGAGGAAGGG + Intergenic
929553674 2:42910355-42910377 GCAGAACACAAGCTGAGGATGGG - Intergenic
929599392 2:43195530-43195552 GCTGAAAAGAAGCTGAGCTTGGG - Intergenic
929965324 2:46530260-46530282 GCTGAACAGAAGCTGAGAAGAGG + Intronic
931115333 2:59160496-59160518 GGTCAACAGAAGCTGAAGAATGG + Intergenic
932786496 2:74609218-74609240 GGTTATCAGAGGCTGAGGATAGG - Intronic
939177092 2:138761155-138761177 GCTCAAGTGAAGATGAGGGTGGG - Intronic
939228176 2:139389815-139389837 GCTCAACAGAAACTAAGTTTTGG + Intergenic
939858249 2:147386955-147386977 GCTCAAAATATGCTGAGGCTTGG - Intergenic
940912084 2:159217738-159217760 GCACAGCAGAAGCCGAGGATGGG - Intronic
948601733 2:239111424-239111446 GCTCTGCAGAGGCTGAGGAGGGG - Intronic
1170370286 20:15640639-15640661 TTCAAACAGAAGCTGAGGATGGG - Intronic
1174114771 20:48219399-48219421 GATAAACAGCAGCTGAGGACAGG + Intergenic
1174931215 20:54817345-54817367 GCTGAACAGAAGCTGCAGCTGGG + Intergenic
1175023625 20:55877828-55877850 GGTCACTAGAAGCTGAGGAGAGG + Intergenic
1175839972 20:62020419-62020441 GCTGGACAGCAGCTGAGGGTTGG - Intronic
1176031390 20:63014706-63014728 CCTCAACAGAATCTGGGGGTGGG - Intergenic
1179861491 21:44191803-44191825 GCACAGCAGGAGGTGAGGATGGG + Intergenic
1181169557 22:21000527-21000549 GCTACACAGAACCTGTGGATCGG - Intronic
1184045341 22:41969533-41969555 GCTGAGCAGGAGCTGAGGAGGGG + Intergenic
1184592424 22:45493997-45494019 GCTCAGCAGAGGTTGGGGATAGG - Intergenic
1184856616 22:47149913-47149935 GTTCATCTGAGGCTGAGGATGGG - Intronic
1185414522 22:50702591-50702613 GCTGAGCAGAGGCTGAGGATGGG - Intergenic
949588093 3:5463335-5463357 TCTCAACAGAAGCTAGGGAAGGG - Intergenic
959320769 3:104871850-104871872 GCTTGCCAGAGGCTGAGGATAGG + Intergenic
960593024 3:119383290-119383312 ACTCAACAGAAAGTGAGGGTGGG + Intronic
962801872 3:138897577-138897599 GCTCTACAGGAGCAAAGGATGGG - Intergenic
962955903 3:140266501-140266523 GCTCTCCAGTAGCTGAGAATTGG - Intronic
963217951 3:142772425-142772447 GCTCAACAGTAGCTGTGAAATGG - Intronic
964480976 3:157138140-157138162 CCTCATCAGAAGCAGATGATGGG - Intergenic
965189608 3:165511500-165511522 GGTCCAAAGAAGCTGAGGAGAGG - Intergenic
965832261 3:172805787-172805809 GCTTAAGAGAAGCTGGGGGTCGG - Exonic
965910104 3:173764161-173764183 GTTCAACAGGAGCTCAGGATGGG + Intronic
969307851 4:6335941-6335963 GCTCACCAGAGGCTGTGGAGAGG - Intronic
972183335 4:36496903-36496925 CCACATCAGAAGCTGAGGTTAGG - Intergenic
972439489 4:39072783-39072805 GCTTACCAGAGGCTGAGGATGGG + Intronic
973100426 4:46261711-46261733 GCTCAACAGATGCTACGGAGTGG + Intronic
976330999 4:83830984-83831006 GCTCAGCAGAGGCTGAGTCTAGG - Intergenic
979291278 4:118981620-118981642 GCCCTAGAGGAGCTGAGGATTGG + Intronic
981456987 4:144964061-144964083 GGTTACCAGAAGCTGAGGGTGGG + Intergenic
983917172 4:173304699-173304721 GGTTACCAGAAGGTGAGGATTGG - Intronic
985310193 4:188589214-188589236 GTACAACAGAAGCTGAGGCCTGG - Intergenic
989679248 5:44009737-44009759 GGTTAACAGAGGCTGGGGATGGG - Intergenic
990003932 5:50923479-50923501 GGTCGACAGACGCTGTGGATGGG + Intergenic
990735963 5:58862509-58862531 GGTGAAAAGAAGATGAGGATTGG + Intergenic
990817827 5:59805423-59805445 GCTCACCAGAAGCTAAAGAAAGG - Intronic
991045454 5:62218153-62218175 GGTCAACAGAAGCCTAGGCTGGG - Intergenic
991188418 5:63838882-63838904 CCTCAACAGAAGCTGAGCAGAGG - Intergenic
996004906 5:118407880-118407902 GCTTAGCAGAAGCAGAGGGTAGG - Intergenic
998410000 5:141902604-141902626 TCTCATCAGAAGCAGAGGCTGGG + Intergenic
1001450061 5:171817748-171817770 GCTCAGAAGAAGCTGTGGATTGG + Intergenic
1002943753 6:1741346-1741368 GCTTACCAGAAGCTGAGGAAGGG - Intronic
1003406440 6:5830468-5830490 TCTCATCTGAAGTTGAGGATAGG - Intergenic
1004366492 6:15017540-15017562 GCTAATCAGTAGCTGAGGGTTGG + Intergenic
1004465349 6:15880169-15880191 GCTCAGCAGAGGCTGGCGATCGG - Intergenic
1005617093 6:27583917-27583939 GGTAAACAGAAGCAGAGGAAGGG - Intergenic
1010347481 6:74829095-74829117 GATAAACTGAAGCAGAGGATAGG + Intergenic
1015411016 6:132894100-132894122 ACTGAAAAGAAGTTGAGGATGGG - Intergenic
1016709811 6:147156710-147156732 GCTGAGCTGCAGCTGAGGATGGG - Intergenic
1016989192 6:149917921-149917943 GCTCAACAGACCCTGAGCCTTGG + Intronic
1016993924 6:149947692-149947714 GCTCAACAGACCCTGAGCCTTGG - Intronic
1017004409 6:150019845-150019867 GCTCAACAGACCCTGAGCCTTGG + Intronic
1019005213 6:168790846-168790868 GCCTCACAGAAGCTGAGCATAGG + Intergenic
1022896048 7:34751275-34751297 GGTGAACAGAAGATGAGGCTGGG + Intronic
1024246343 7:47472974-47472996 GCTCAGCAGAAGGTGAGGAAGGG - Intronic
1024749480 7:52448593-52448615 GCTAAAGACAAGATGAGGATTGG - Intergenic
1029217885 7:98964798-98964820 GTTCAACAGAGTCTGAGGAAAGG - Intronic
1030324409 7:108204348-108204370 ACTCAGCAGAAGCTGCAGATGGG + Intronic
1031469255 7:122149580-122149602 GCTCAAAAGAAGATGGGGAAGGG - Intergenic
1033840682 7:145370057-145370079 GGTCAACAGACGGTGAGGAAGGG - Intergenic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1036391925 8:8331056-8331078 ACACAACAGAAGCTGAGGCTGGG + Intronic
1039269502 8:35865676-35865698 CCTCACCAGAAGCAGAGGATGGG - Intergenic
1040433411 8:47366192-47366214 GCTGAACAGAGGCTGAAGGTGGG + Intronic
1043107912 8:76138187-76138209 GGTGTACAGAAGCTGAGGATGGG - Intergenic
1043940749 8:86192946-86192968 TCCCAACAGCAGCTGAGGAGTGG - Intergenic
1044468399 8:92535396-92535418 GCTCAACAGAAGCTGGGAGCTGG + Intergenic
1044849813 8:96417451-96417473 GTTTAACAGAAGGTGAGAATGGG + Intergenic
1051177733 9:14378052-14378074 GCTCCACACCAGCTGAGGGTGGG + Intronic
1053319320 9:37080954-37080976 TTTCAAGAGAATCTGAGGATGGG + Intergenic
1056244189 9:84677820-84677842 GCTGAACAGGAGAAGAGGATAGG - Intronic
1056686320 9:88765137-88765159 GGTTAACAGCAGCTGAGGATGGG + Intergenic
1058332354 9:103778625-103778647 GGTTAACAGAGACTGAGGATGGG - Intergenic
1059680802 9:116583803-116583825 GTACAACAGAAGCTTGGGATGGG - Intronic
1061909326 9:133714456-133714478 GCTCCAGAGAAGGTGACGATGGG + Intronic
1062153223 9:135032181-135032203 GCACAGCAGAAGCTCAGGACTGG - Intergenic
1062153385 9:135032906-135032928 GCACAGCAGAAGCTCAGGACTGG + Intergenic
1186224411 X:7382390-7382412 GCTAAATTGTAGCTGAGGATAGG - Intergenic
1187573338 X:20528381-20528403 GCTCAACAGAATCTGGGGTTGGG - Intergenic
1188522253 X:31051761-31051783 GGTCAACCGCAGCTGATGATGGG - Intergenic
1192859204 X:75048072-75048094 ACTGAACTGAAGCTGAGGGTGGG + Intergenic
1196475860 X:116084875-116084897 CCTCAACAGTAGTTGTGGATGGG + Intergenic
1197143697 X:123146563-123146585 GGTTACCAGAAGCTGAGGAGAGG - Intergenic
1198006318 X:132498186-132498208 TCGCAAGAGAAGCTGAGGAATGG - Intergenic
1198755696 X:139979806-139979828 ACTCAACATAAGCAGAGGAAAGG + Intergenic