ID: 1105538823

View in Genome Browser
Species Human (GRCh38)
Location 13:21297125-21297147
Sequence TCCTCCCTTAGCCCCTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105538823_1105538829 11 Left 1105538823 13:21297125-21297147 CCTCCAAAGGGGCTAAGGGAGGA 0: 1
1: 0
2: 6
3: 35
4: 269
Right 1105538829 13:21297159-21297181 TGCTTCCAGCTTCTGGCAGCTGG 0: 3
1: 0
2: 2
3: 40
4: 283
1105538823_1105538827 4 Left 1105538823 13:21297125-21297147 CCTCCAAAGGGGCTAAGGGAGGA 0: 1
1: 0
2: 6
3: 35
4: 269
Right 1105538827 13:21297152-21297174 GCCTTGCTGCTTCCAGCTTCTGG 0: 3
1: 4
2: 49
3: 269
4: 934
1105538823_1105538830 14 Left 1105538823 13:21297125-21297147 CCTCCAAAGGGGCTAAGGGAGGA 0: 1
1: 0
2: 6
3: 35
4: 269
Right 1105538830 13:21297162-21297184 TTCCAGCTTCTGGCAGCTGGTGG 0: 3
1: 1
2: 18
3: 123
4: 710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105538823 Original CRISPR TCCTCCCTTAGCCCCTTTGG AGG (reversed) Intergenic
900010924 1:107625-107647 TCCTTCCTTAGCACCTTTTCAGG + Intergenic
900027027 1:284189-284211 TCCTTCCTTAGCACCTTTTCAGG + Intergenic
901239454 1:7684479-7684501 TCCCTCCCTAGCGCCTTTGGTGG - Intronic
904024957 1:27496998-27497020 TCCTCCCTGAGCGCCTTTGATGG + Intergenic
904488560 1:30844073-30844095 TCCTCCATTTGCCCCTTTCCTGG - Intergenic
906507759 1:46392956-46392978 TCCTCCCTTTCCCCCTCTGAAGG + Intergenic
906717259 1:47979496-47979518 CCCTCGCTCAGCCCCCTTGGTGG - Intronic
907208769 1:52799682-52799704 TCCTGCCTTAGCCTCTTGAGTGG - Intronic
907774313 1:57498467-57498489 TCCTCTCTTCTCCACTTTGGTGG - Intronic
912657097 1:111496619-111496641 TCCTCTCTCACCTCCTTTGGTGG + Intronic
915469953 1:156119875-156119897 TCCTTCCTGAGACCCTCTGGTGG + Intronic
916118364 1:161506954-161506976 TCCTGCCTTAGAGCCTTTAGAGG - Intronic
917001991 1:170370321-170370343 GCTTCCCCTAGCCCCTGTGGTGG - Intergenic
917028791 1:170667659-170667681 TCATCCCTGAGTCCCTTTGGGGG - Intronic
917437295 1:175034199-175034221 TTCTCCCCTAGAGCCTTTGGAGG - Intergenic
918447463 1:184629628-184629650 ACATCCCTGAGCCCCTTTGTGGG - Intergenic
919572287 1:199263854-199263876 TCCTGCCCTAACACCTTTGGTGG - Intergenic
921263790 1:213405925-213405947 TCCTCCCTTAGCCGGGTCGGAGG - Intergenic
921275777 1:213518484-213518506 TCCTCCCCTAGAGCCTTTGCAGG + Intergenic
922259372 1:223923632-223923654 TCCTTCCTTAGCACCTTTTCAGG + Intergenic
922342999 1:224672504-224672526 TTCTCCCTTAGAGCATTTGGAGG - Intronic
922352214 1:224743618-224743640 TCCTCCCTTCCCCTCTTTGAAGG - Intergenic
922937913 1:229435021-229435043 CCCTCCCCCAGCCTCTTTGGTGG + Intergenic
923313019 1:232754552-232754574 AACTCCCTTAGACCCTCTGGAGG + Intergenic
924021143 1:239784830-239784852 TCCTCCCTTGACACATTTGGAGG + Intronic
924340553 1:243026379-243026401 TCCTTCCTTAGCACCTTTTCAGG + Intergenic
1066468406 10:35673042-35673064 TCCTACCTTAGCCCCCTGAGGGG - Intergenic
1067081387 10:43214489-43214511 TCCTCCCATAGCCCCTTTTGGGG - Intronic
1068350037 10:55831252-55831274 TCCTCCCCTAGAGGCTTTGGAGG - Intergenic
1070370804 10:75780112-75780134 TTCTCCCCTAGGGCCTTTGGAGG + Intronic
1070406952 10:76105655-76105677 TTCTCCCCTAGAGCCTTTGGAGG + Intronic
1070741199 10:78904354-78904376 TCCTCCTTGAGCCTCTTTGGAGG + Intergenic
1071138245 10:82477245-82477267 TCCTCCCTTAACTCCTTGTGTGG - Intronic
1074100596 10:110351882-110351904 TTCTCCCCTAGATCCTTTGGAGG + Intergenic
1074600359 10:114907749-114907771 TTCTCCCTTAGAGACTTTGGAGG + Intergenic
1075399381 10:122150268-122150290 TCCTCCCTGAGCCCCATTTCAGG - Intronic
1076479608 10:130776301-130776323 TCCTCCCCTAGAGCCTTCGGGGG - Intergenic
1077326898 11:1967838-1967860 TCCTCCCTGAGCCCCGAGGGAGG - Intronic
1077483598 11:2828038-2828060 TCCTGCCCTCGCCCCTTTGCAGG - Intronic
1077722597 11:4643452-4643474 TCCTCCCTTCTCTCATTTGGGGG - Exonic
1078928464 11:15894931-15894953 TTTTCCCTTAGAGCCTTTGGAGG - Intergenic
1079732008 11:23945061-23945083 TTCTCCCCTAGAGCCTTTGGAGG - Intergenic
1083375331 11:62215678-62215700 TACTCCCTTAACCAGTTTGGAGG + Intergenic
1084340520 11:68496419-68496441 TCCTGCCTTAGCCTCTCTAGTGG + Intronic
1084765417 11:71305252-71305274 TCCTCCTCTAGAGCCTTTGGAGG + Intergenic
1085311702 11:75520767-75520789 TCCTCCCTTTGCCCCCTTTGGGG - Intronic
1085909867 11:80810206-80810228 TCCTTCCCTAGAGCCTTTGGAGG + Intergenic
1085970738 11:81587666-81587688 TCCTCCCTTAGCCCTCTCTGAGG - Intergenic
1087640382 11:100749557-100749579 TCCTCCCTTTCCCCCTCTGAAGG + Intronic
1088358605 11:108968510-108968532 TCCTCCTTTAGAGCCTTCGGAGG + Intergenic
1089778048 11:120852825-120852847 TCCTCTCTTAGCCTTTTTGCAGG - Intronic
1090742913 11:129682318-129682340 TTCTCCCTCAGAGCCTTTGGAGG - Intergenic
1202809879 11_KI270721v1_random:23018-23040 TCCTCCCTGAGCCCCGAGGGAGG - Intergenic
1092083094 12:5734466-5734488 GCCTCCCTTAGCCCCTGTGCAGG - Intronic
1092084387 12:5743598-5743620 TCCTCCACTAATCCCTTTGGTGG + Intronic
1092318860 12:7449574-7449596 TCCTCCCTTAGAATCTTTGTAGG - Intronic
1094482441 12:30895553-30895575 TCCTCCCTTATTCCCTTAGGAGG - Intergenic
1095979561 12:47963726-47963748 TCCTGCCTGGGCCACTTTGGTGG + Intronic
1098523755 12:71462692-71462714 TCTTCCCATTGCCCCTCTGGTGG + Intronic
1099453632 12:82838126-82838148 CCCTCCCTTAGCCATTTTTGGGG + Intronic
1100315348 12:93440941-93440963 TCCTACCTTGGCCTCTGTGGGGG - Intronic
1100477420 12:94947326-94947348 TCCTTCCCTAGCCCCTTTAGAGG + Intronic
1100916017 12:99422864-99422886 TCCACCCTTACCTCCTTTGTAGG - Intronic
1101308751 12:103556972-103556994 TCCTCCCACAGAGCCTTTGGAGG + Intergenic
1101437027 12:104672606-104672628 TCCTCCCGAGGTCCCTTTGGAGG - Intronic
1102568081 12:113810160-113810182 TCCTCCCCTAGAGCCTTCGGAGG + Intergenic
1103166122 12:118772187-118772209 TCCTCCCCTAGAGCCTTTGGAGG + Intergenic
1103801293 12:123539307-123539329 TCCTCCCCTGGCGCCTTCGGAGG - Intergenic
1104431443 12:128719685-128719707 TCCTCCTCTAGAGCCTTTGGAGG - Intergenic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1104931691 12:132342477-132342499 TCCACCCTCAGCCCCTTGAGAGG + Intergenic
1105399306 13:20074340-20074362 TCCTGCCTCAGCCCTTTAGGTGG + Intronic
1105538823 13:21297125-21297147 TCCTCCCTTAGCCCCTTTGGAGG - Intergenic
1105602571 13:21900410-21900432 CCCTCCCTTGGCTCCTCTGGGGG + Intergenic
1105799427 13:23890439-23890461 TCCTCCTGTATCCCCTTTGGAGG + Intergenic
1105849621 13:24322599-24322621 TCCTCCTGTATCCCCTTTGGAGG - Intergenic
1106907129 13:34420802-34420824 TCCTCCCCTAGAGGCTTTGGAGG - Intergenic
1107338968 13:39385970-39385992 TCCACCCTTGGCCCCTTGAGTGG + Intronic
1109613372 13:64795918-64795940 TCATCCCTTACCCACTTTGAAGG - Intergenic
1110899123 13:80798482-80798504 TTCTCCCTTAGCTCCTTAAGAGG - Intergenic
1113087474 13:106582941-106582963 TCCTTCCTTAGCCCCTGTGGGGG + Intergenic
1113113018 13:106844960-106844982 TCCTCCCCTAGCACCTTCAGAGG - Intergenic
1114236383 14:20827692-20827714 TCCTCCCTTTCCCCCTCTGAAGG + Intergenic
1116697865 14:48200266-48200288 TCCTTCATAAGCCCCTTTGGGGG + Intergenic
1117937661 14:60925379-60925401 TCATCCCTTAGCATCTGTGGGGG - Intronic
1117970379 14:61245577-61245599 TTCACCCTTGGCCCCTTTGGTGG - Intronic
1118096693 14:62545522-62545544 TCCTCCCCATCCCCCTTTGGGGG + Intergenic
1118497477 14:66322616-66322638 TCCTCCCTTAGAGCCTTCTGAGG + Intergenic
1121918775 14:97860887-97860909 TCCTCCCCTAGAGGCTTTGGAGG + Intergenic
1122133061 14:99617323-99617345 CCCTCCCTCAGCCTCTTTAGAGG - Intergenic
1122987558 14:105219529-105219551 CCCTCACTTGGCCCCTTTGTGGG - Intronic
1127485302 15:59412902-59412924 TCCTCCCTGAGCTCCTTTTCAGG + Intronic
1127715576 15:61645920-61645942 TTCACCCTTAGAGCCTTTGGAGG + Intergenic
1128582481 15:68819255-68819277 TCCCCTCTTGGCCCCTTGGGGGG - Intronic
1129325056 15:74795446-74795468 TCCTCCATGAGCCTCTTTGCTGG - Intronic
1130770126 15:86915926-86915948 ACCTCCCTCAGCCCCGTTTGCGG + Intronic
1130824980 15:87534477-87534499 TCCTACCTAATCCCCTCTGGAGG + Intergenic
1131854836 15:96582652-96582674 TCTTCCCTCAGCCCCTCAGGCGG - Intergenic
1133030108 16:3006644-3006666 TCCTCCCCTAGCACCTGTGAAGG - Intergenic
1136150232 16:28342831-28342853 TCCTCCCTTAGCTACTCAGGAGG - Exonic
1136166458 16:28456606-28456628 TCCTCCCTTAGCTACTCAGGAGG - Exonic
1136196515 16:28658426-28658448 TCCTCCCTTAGCTACTCAGGAGG + Exonic
1136212855 16:28772551-28772573 TCCTCCCTTAGCTACTCAGGAGG + Exonic
1136257581 16:29052470-29052492 TCCTCCCTTAGCTACTCAGGAGG + Exonic
1136712488 16:32251383-32251405 TTCTCCCTTATCCCATTTGGTGG - Intergenic
1136755426 16:32678046-32678068 TTCTCCCTTATCCCATTTGGTGG + Intergenic
1136812687 16:33192324-33192346 TTCTCCCTTATCCCATTTGGTGG - Intergenic
1136819163 16:33302404-33302426 TTCTCCCTTATCCCATTTGGTGG - Intronic
1136825726 16:33358939-33358961 TTCTCCCTTATCCCATTTGGTGG - Intergenic
1136830792 16:33457710-33457732 TTCTCCCTTATCCCATTTGGTGG - Intergenic
1139017249 16:62705409-62705431 TCCTACCTTAGCCTCTCTAGTGG + Intergenic
1139700170 16:68703323-68703345 TTCTCCCTGAGTCCCTTTGTGGG - Intronic
1139855488 16:69976486-69976508 TCCTCCCTTAGCTACTCAGGAGG - Intergenic
1139885206 16:70203604-70203626 TCCTCCCTTAGCTACTCAGGAGG - Intergenic
1140367272 16:74391774-74391796 TCCTCCCTTAGCTACTCAGGAGG + Exonic
1141240621 16:82262014-82262036 TCCCCCTTTAGCCCCTCTGGTGG - Intergenic
1141672659 16:85500824-85500846 TCCTCCCTTGGGGCCTTTAGAGG - Intergenic
1142383399 16:89746802-89746824 TGCTCCCTCAGCCCCTCTCGTGG - Intronic
1142453422 16:90199291-90199313 TCCTTCCTTAGCACCTTTTCAGG - Intergenic
1202991264 16_KI270728v1_random:15294-15316 TTCTCCCTTATCCCATTTGGTGG - Intergenic
1203057569 16_KI270728v1_random:938385-938407 TTCTCCCTTATCCCATTTGGTGG + Intergenic
1142471891 17:169335-169357 TCCTCCCCTGGCCCCTGGGGAGG - Intronic
1142695007 17:1628714-1628736 TTCTCCCTACGCCCCTTCGGCGG + Intronic
1143785987 17:9256168-9256190 TCCTACCTAAGGCCCTCTGGCGG + Intronic
1144025884 17:11275289-11275311 TCCTCTCCAAGCCCCTTTGGAGG - Intronic
1146357921 17:32150559-32150581 TCCTCTCTCAGCACCTTTGCTGG - Intronic
1149543246 17:57484315-57484337 TCCACCCTTGGCTCCTTCGGGGG + Intronic
1151150747 17:72083975-72083997 TTCTTCTTTAGCTCCTTTGGGGG + Intergenic
1151815679 17:76470355-76470377 CCCACCCTTAGCCCCTAGGGTGG + Intergenic
1152322246 17:79614193-79614215 TCCTCGGATAGCCCCTCTGGAGG + Intergenic
1152372913 17:79901618-79901640 TCCTCCCCTAGAGCCTCTGGAGG - Intergenic
1154088973 18:11339047-11339069 TCCTCACTTGGCTCCTTTTGAGG - Intergenic
1154116939 18:11619562-11619584 TCCTCCCTTAGCTACTCAGGAGG - Intergenic
1155746498 18:29361582-29361604 TCCTCCCTTTACCCCTTTGAAGG + Intergenic
1160974844 19:1787929-1787951 TCCTGCCTCAGCCCCTCTAGTGG - Intronic
1161349580 19:3784464-3784486 TCCTCCCTTTGCCCCTCTCCCGG - Intronic
1161410569 19:4114817-4114839 TCCTCCCTTAGCCTCCTGAGTGG - Intronic
1161654174 19:5503487-5503509 TCCTTCCCTAGAGCCTTTGGAGG - Intergenic
1162542755 19:11307765-11307787 TTCTCCCTGACCCCCTTTGCAGG - Intronic
1162856302 19:13470998-13471020 TCCTCCCCTAGAGCCTTTGAAGG - Intronic
1163413174 19:17169636-17169658 TCCTCCCTTGGAGCCTCTGGAGG - Intronic
1163755272 19:19102927-19102949 TCCTCCCCTAGAGCCTCTGGAGG - Intronic
1165070550 19:33252883-33252905 TCCTCCCCTAGACCCTGTGCTGG - Intergenic
1165591728 19:36974354-36974376 CCCTCCCTGAACCCCTTGGGAGG - Intronic
1166883213 19:45941453-45941475 CCCTCCCTTCGCCAGTTTGGTGG - Intronic
1167854393 19:52226160-52226182 TGCTCCCCTAGCCCGTTGGGAGG - Exonic
926195888 2:10763357-10763379 TCCTCCCTTAGCACTCTAGGCGG + Intronic
927511487 2:23646880-23646902 TCCTCCCTGAGGCCCTGTGAGGG - Intronic
927779197 2:25925898-25925920 TCCTCCTTTAACCCCTTTGGTGG + Intergenic
928381856 2:30824827-30824849 TCCTTCCCTGGCACCTTTGGAGG + Intergenic
928727198 2:34188334-34188356 TTATCCCTTACCCACTTTGGAGG - Intergenic
929814531 2:45220518-45220540 TCCTCCCTCTGCCCCATTGCTGG + Intergenic
930040836 2:47121723-47121745 TTCTCCCTTAGATCCTCTGGAGG - Intronic
931264980 2:60652693-60652715 TCCTCCCATAGTGCCTTTGGAGG + Intergenic
931290073 2:60864858-60864880 TCCTCCTCTAGAGCCTTTGGAGG + Intergenic
931756355 2:65378024-65378046 TCCTTCCTTAGCCCTTCTGGTGG - Intronic
932404480 2:71504226-71504248 TCATCCCCTAGACCCTCTGGTGG + Intronic
932667119 2:73707083-73707105 TCCTTCCTCTGCCCCTTTGAGGG + Intergenic
934591234 2:95551685-95551707 TGCCCTCTTAGCCACTTTGGGGG - Intergenic
934705250 2:96472865-96472887 TCCTCTCTGAGGCCCCTTGGTGG - Intergenic
934750916 2:96793566-96793588 TCCTCTCTGAGACCCCTTGGCGG - Intronic
936153517 2:110034128-110034150 TCCTCCCTGAGCCCCTCTCTAGG + Intergenic
936191164 2:110337287-110337309 TCCTCCCTGAGCCCCTCTCTAGG - Intergenic
939425556 2:142032005-142032027 TCCTTCCCTAGCCCCTTCTGAGG + Intronic
939687848 2:145221947-145221969 TCCAACCTTATCCCCTTGGGAGG - Intergenic
940967721 2:159858652-159858674 TCCTTTGTTAGCCCCTTTGAGGG - Intronic
941305436 2:163859340-163859362 CCTTCCCTTATTCCCTTTGGTGG + Intergenic
941633790 2:167913806-167913828 TCCCACCTTCTCCCCTTTGGGGG - Intergenic
942814987 2:180042442-180042464 TCATTCCTTAGCCTCTTGGGAGG + Intergenic
943479489 2:188400113-188400135 TCCTCCCCTAGAGCCTTTGGAGG - Intronic
943887204 2:193234435-193234457 TCCTCCCTTAGCCTCCTGAGTGG - Intergenic
944635653 2:201673902-201673924 CCCTCCCTTACCCCCTTTCCAGG + Intronic
946280575 2:218663045-218663067 TCCTCCCCTAGTGCCTTGGGAGG + Intronic
947638102 2:231690515-231690537 TCCTCCATAAGCCCCCTTCGGGG - Intergenic
948761759 2:240196788-240196810 TCCTCCTTTAGAGCCTCTGGAGG + Intergenic
948822017 2:240554817-240554839 TCCTCCCCTAGGGCCTCTGGTGG - Intronic
949084863 2:242143941-242143963 TCCTTCCTTAGCACCTTTTCAGG - Intergenic
1169334834 20:4747612-4747634 TCCTCCCCTAGACCCTTCAGGGG + Intergenic
1169832083 20:9836531-9836553 TCCTCCCTTAGAGGTTTTGGAGG + Intronic
1170825648 20:19792602-19792624 CCCCCCTTTAGCCCCTCTGGTGG - Intergenic
1173258344 20:41411135-41411157 TGCTACCACAGCCCCTTTGGGGG - Intronic
1173405705 20:42762618-42762640 TCCTTACTGAGCCCCCTTGGAGG + Intronic
1174019785 20:47520746-47520768 TCCTCCCTTTCCCCCTCTGAAGG + Intronic
1174703609 20:52634282-52634304 TCCTCCCCTAGAGCCTTCGGAGG + Intergenic
1175230554 20:57470963-57470985 TCCTAACTCAGCCCCTTTGCAGG - Intergenic
1175419956 20:58825270-58825292 ACCTCATTTATCCCCTTTGGTGG + Intergenic
1175993379 20:62801077-62801099 TCCTGGCTTTGCCCCTTTAGTGG - Exonic
1176205768 20:63887370-63887392 TCCTCCCTTGGCCTCATGGGGGG - Intronic
1178498204 21:33104527-33104549 TCCTCCCCTAGAGCCTTCGGAGG - Intergenic
1181896112 22:26109235-26109257 TCCTCCCTTAGCACTTTCAGAGG - Intergenic
1183195035 22:36347622-36347644 TCCCACCTTAGCCTCTCTGGTGG - Intronic
1184472807 22:44705193-44705215 TCCTCCCCTAGAGCCTCTGGTGG - Intronic
1185333035 22:50260182-50260204 TACTCCCTCAGCCCCTTGGATGG - Intronic
949634981 3:5973035-5973057 TCCTGCCTTAGGCTCTGTGGTGG + Intergenic
950016855 3:9760590-9760612 TCCTCCCTCACCTGCTTTGGGGG - Intronic
950870531 3:16224745-16224767 TCCTGCCTCAGCCTCTTTAGTGG + Intronic
951257236 3:20464226-20464248 TCCTCCCATGCCCCCTTTGACGG + Intergenic
951534860 3:23731264-23731286 TTCTCCCTTAGAGCCTTTGGAGG - Intergenic
951889647 3:27556358-27556380 TCCTCCCATAGCCTGTTTTGCGG + Intergenic
952883277 3:37998431-37998453 TCCTCCCTTAGACCCTGGGGCGG - Intronic
953453486 3:43023292-43023314 TTCTCCCCTAGAGCCTTTGGAGG + Intronic
954629692 3:52041117-52041139 TCCTCCCTCAGCCCCTGTGCAGG + Intergenic
954636731 3:52074949-52074971 TCCTCCCTCTGCCCCTGTGCTGG - Intergenic
955117754 3:56022940-56022962 TCCTCTCTTACCCCCTTTCCAGG - Intronic
955356539 3:58237296-58237318 TCCTGCCTGAGTCACTTTGGCGG + Intergenic
955776802 3:62442320-62442342 TCCTGCCTCAGCCTCTCTGGAGG + Intronic
960974912 3:123164240-123164262 TCCTCCCTCTGCCCCACTGGAGG + Intronic
961059788 3:123818577-123818599 TCCTGCCTCAGCCCCTTGAGTGG - Intronic
961582112 3:127891640-127891662 TCCTCCCTTTCCCCCTCTGAAGG - Intergenic
965133568 3:164732710-164732732 TCCTCCCTTAGCACACATGGGGG - Intergenic
967855442 3:194113941-194113963 TCCTGCCTTAGCCCCCTAAGTGG - Intergenic
968280536 3:197473695-197473717 TGCTCCCTGAGGCCCTCTGGGGG + Intergenic
968418161 4:458733-458755 TCCTGCCTTAGCCTCCTGGGTGG - Intronic
968961677 4:3748545-3748567 GCCTCACTTAGACACTTTGGTGG - Intergenic
969592703 4:8130932-8130954 GCCTCCCCTAGAGCCTTTGGGGG - Intronic
969788685 4:9477150-9477172 TCCTTCCCTTGCCTCTTTGGGGG - Intergenic
973631351 4:52823864-52823886 TCCTCCCCTAGAGGCTTTGGAGG - Intergenic
973956607 4:56069116-56069138 TCCTCCCTTAGAGCCTTTGGAGG + Intergenic
974016246 4:56651948-56651970 TCCTTCCTCAGCCCCGTGGGAGG - Intronic
975665759 4:76733313-76733335 ACCTGCCTAAGCCCCTCTGGAGG - Intronic
977294989 4:95200305-95200327 TCCTTCTTTAGCTCCTTTGCTGG + Intronic
979262298 4:118662182-118662204 TCCTTCCTTAGCACCTTTTCAGG - Intergenic
980501178 4:133656149-133656171 TTCTTCCTTAGATCCTTTGGGGG - Intergenic
984539913 4:181024546-181024568 TCCTCCCCTAGAGGCTTTGGAGG - Intergenic
985025892 4:185738701-185738723 TCCTCCCTTAGACCCACTTGGGG - Intronic
985891106 5:2715731-2715753 TCCTGCCTCAGCCTCTTGGGTGG - Intergenic
986052699 5:4104901-4104923 TCCTTCCCTAGAGCCTTTGGAGG - Intergenic
986348318 5:6854597-6854619 TCCTCCCCTAGAGCCTTTGGAGG + Intergenic
991378090 5:65987449-65987471 TCCTGCCTTAGCCTCTTGAGTGG - Intronic
992810852 5:80387024-80387046 GACTCCCTTTGCCCCCTTGGTGG + Intergenic
992842694 5:80711763-80711785 TCCTGCCTTAGCCCCCTGAGTGG + Intronic
996099982 5:119436096-119436118 TCCTCCCTTTCCCCCTCTGAAGG - Intergenic
996100153 5:119437341-119437363 TCCTCCCTTTCCCCCTCTGAAGG - Intergenic
996363544 5:122676603-122676625 TCCTCTCTGAGCACCTTTGCTGG + Intergenic
997230148 5:132236479-132236501 TCCTACCTCAGCCTCTCTGGTGG + Intronic
997405826 5:133645845-133645867 TCCTCCTCTAGAGCCTTTGGAGG + Intergenic
1000908465 5:166992708-166992730 TCCACCCTTAGACCCCCTGGAGG - Intergenic
1001371409 5:171207417-171207439 TCCTTATTTAGCTCCTTTGGGGG + Intronic
1001601337 5:172930797-172930819 TCCACCCTTGACCCATTTGGCGG + Intronic
1001970965 5:175954595-175954617 GCCTCCCTTTGCCCCATTGCTGG - Intronic
1002246477 5:177889182-177889204 GCCTCCCTTTGCCCCATTGCTGG + Intergenic
1003671974 6:8167862-8167884 TCCTCCCCTAGAGCCTGTGGAGG - Intergenic
1004333361 6:14741502-14741524 TCCTCCCTCAGAACCTTTGGAGG + Intergenic
1005379845 6:25222703-25222725 TCCTTCCTTAGCCCTTATAGCGG - Intergenic
1005949306 6:30619605-30619627 CCCTCCCTTTCCCCCTTTAGAGG - Intronic
1009813905 6:68706200-68706222 TCTTCTCTTTGCTCCTTTGGGGG - Intronic
1011523019 6:88230705-88230727 TCCTGCCTCAGCCCCCTAGGTGG - Intergenic
1012940034 6:105405546-105405568 TCCCCACTTCGCCCCTTGGGTGG - Intergenic
1013480046 6:110545192-110545214 TTCTCCCCTAGAGCCTTTGGAGG - Intergenic
1018191655 6:161314566-161314588 TCCTCCCTTTCCCCCTCTGAAGG + Intergenic
1019795391 7:3044366-3044388 TCCTCCCTCAGCCCCTGTTCTGG + Intergenic
1020323610 7:6957908-6957930 TGCCCCCTTAGCCACTGTGGGGG + Intergenic
1021828716 7:24581101-24581123 TTCTCCCTTAGATTCTTTGGAGG - Intronic
1022154282 7:27643759-27643781 TCCTCCCTTTGAGCCTTTGTGGG - Intronic
1023517708 7:41018272-41018294 TTCTCTGGTAGCCCCTTTGGTGG - Intergenic
1023623638 7:42096003-42096025 TCCTCCCTCTGGCCCCTTGGAGG - Intronic
1026508079 7:71003620-71003642 TCCTCCCTTTCCCCTTCTGGTGG + Intergenic
1026557705 7:71422503-71422525 TGTTCCCTTATCCCCTTTGCGGG + Intronic
1029159732 7:98543103-98543125 TCCTCCCCTAGGGCCTTTGGGGG - Intergenic
1032890035 7:136184155-136184177 TTCTCCCTTAGAACCTCTGGAGG + Intergenic
1033157152 7:138966834-138966856 TCCTTCTCTAGCACCTTTGGAGG + Intronic
1033465550 7:141586157-141586179 TCCCCGCTTAGCCTCTTTAGAGG + Intronic
1033681431 7:143599910-143599932 TCCTTCCCTATCCCCCTTGGGGG + Intergenic
1033703461 7:143861903-143861925 TCCTTCCCTATCCCCCTTGGGGG - Intronic
1034942198 7:155237746-155237768 TCCTCCCTTTGTCCTTTTGATGG - Intergenic
1035368431 7:158363171-158363193 TCCTCCCCTTGCCTCTCTGGTGG - Intronic
1038036669 8:23691817-23691839 TCCTCCCCCAGCCCCTTGAGAGG - Intergenic
1038293668 8:26271710-26271732 TCCTCCCTCAGTCACTTGGGAGG - Intergenic
1039888884 8:41671265-41671287 TCCCCACTTACCCCCTTTGAAGG - Intronic
1041603775 8:59755691-59755713 TCCTCCCCTAGCACATTTCGAGG + Intergenic
1042193602 8:66212776-66212798 TCCTCCCATAGAGGCTTTGGTGG + Intergenic
1042295751 8:67215696-67215718 TTCTCCCTTAGAGCCTTTGGAGG + Intronic
1043570865 8:81600926-81600948 TCCTCCCTTGGTGTCTTTGGGGG - Intergenic
1046368009 8:113261507-113261529 ACCTCCCTTAGCCTCTGTGAGGG + Intronic
1046521325 8:115330513-115330535 TCCTCCCGTGGCCCCTGTGTGGG - Intergenic
1047443439 8:124899483-124899505 TCCTCCCTTTCCCCCTCTGAAGG - Intergenic
1048395995 8:134014465-134014487 TTCTCCCCTAGACCTTTTGGAGG + Intergenic
1051284431 9:15481571-15481593 TCCTGCCTTAGCCTCTTGAGTGG - Intronic
1053001465 9:34579150-34579172 TCCTCCCTTCGCCCCTGTGGGGG + Intronic
1055081533 9:72272115-72272137 TCTGCCCTTGGCCCTTTTGGAGG - Intergenic
1055756895 9:79567885-79567907 TCCTCCAGAAGCCCCTTAGGTGG - Intergenic
1057082291 9:92181854-92181876 TCTTCCCCTAGAGCCTTTGGAGG - Intergenic
1060880068 9:127111982-127112004 TCCTCCCTGAACCCCTTTGGGGG + Intronic
1061435270 9:130557328-130557350 ACCACACTTTGCCCCTTTGGAGG - Intergenic
1062003692 9:134229031-134229053 TCCTCCTTTCTCCCCTTTTGTGG + Intergenic
1062158621 9:135067649-135067671 TCCTCCCCTAGAGCCTCTGGAGG + Intergenic
1062334981 9:136061066-136061088 TCCTCCCCTAGCCACTGAGGGGG - Intronic
1185511235 X:666548-666570 CCCTCCCTTAGAGCCTCTGGAGG + Intergenic
1185511256 X:666637-666659 CCCTCCCTTAGAGCCTCTGGAGG + Intergenic
1185511297 X:666815-666837 CCCTCCCTTAGAGCCTCTGGAGG + Intergenic
1185650472 X:1644140-1644162 TCCTCCCCTAGAGCCTCTGGAGG + Intergenic
1185865410 X:3619662-3619684 TCCTCCCCTAGAGCCTCTGGAGG + Intronic
1185914579 X:4021892-4021914 TCCTCCTTTAGAGCCTCTGGAGG + Intergenic
1186552606 X:10522352-10522374 TCCTCCCCTAGAACCTTTGTAGG + Intronic
1186897390 X:14017617-14017639 TCCTTCCCTAGCACCTTTAGAGG - Intronic
1187205910 X:17181161-17181183 TCCTCCCTCACCCCCCTAGGGGG + Intergenic
1189343195 X:40220128-40220150 TCCTCCCTTAGAGGCTTTGGAGG - Intergenic
1190111291 X:47590636-47590658 TCCTCCCTGAGCCCCTTCCAAGG - Intronic
1192050826 X:67722443-67722465 CCCTCTCTTAGCCCCTACGGAGG + Intronic
1195690582 X:107621120-107621142 TCATGCCTTAGCCACTTGGGTGG - Intergenic
1197681184 X:129387003-129387025 TCCTTCCTTAGCATCTTTAGAGG + Intergenic
1198211331 X:134519114-134519136 TCCTCCCCTAAAGCCTTTGGAGG - Intronic
1199460185 X:148075521-148075543 TCCTCCCCTAGAACCTTTGGAGG + Intergenic
1200051047 X:153431947-153431969 TCCTAACTTCGCCCATTTGGGGG + Intergenic
1200089652 X:153628417-153628439 TCCTCACCCAGCCCCTTAGGAGG - Intergenic
1200798280 Y:7361825-7361847 TCCTCCCCTAGAGCCTCTGGAGG - Intergenic
1201639292 Y:16161589-16161611 TCCTCCCTTGGAGCCTGTGGAGG + Intergenic
1201663521 Y:16423738-16423760 TCCTCCCTTGGAGCCTGTGGAGG - Intergenic
1201900213 Y:19041067-19041089 TCCTCCCTTTCCCCCTCTGAAGG + Intergenic
1202384371 Y:24310674-24310696 TCCTTCCTTAGCACCTTTTCAGG - Intergenic
1202486412 Y:25359448-25359470 TCCTTCCTTAGCACCTTTTCAGG + Intergenic