ID: 1105539004

View in Genome Browser
Species Human (GRCh38)
Location 13:21298308-21298330
Sequence CTGCGGCGCAGGCGGCGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 329}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105538995_1105539004 15 Left 1105538995 13:21298270-21298292 CCAAAAAGCCGGGCGGCTTCGGA 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1105539004 13:21298308-21298330 CTGCGGCGCAGGCGGCGGGTCGG 0: 1
1: 0
2: 0
3: 38
4: 329
1105538996_1105539004 7 Left 1105538996 13:21298278-21298300 CCGGGCGGCTTCGGAGCCAGAGC 0: 1
1: 0
2: 1
3: 12
4: 133
Right 1105539004 13:21298308-21298330 CTGCGGCGCAGGCGGCGGGTCGG 0: 1
1: 0
2: 0
3: 38
4: 329
1105538999_1105539004 -9 Left 1105538999 13:21298294-21298316 CCAGAGCAGCGGCTCTGCGGCGC 0: 1
1: 0
2: 0
3: 13
4: 168
Right 1105539004 13:21298308-21298330 CTGCGGCGCAGGCGGCGGGTCGG 0: 1
1: 0
2: 0
3: 38
4: 329
1105538990_1105539004 27 Left 1105538990 13:21298258-21298280 CCACGCTGTGCGCCAAAAAGCCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1105539004 13:21298308-21298330 CTGCGGCGCAGGCGGCGGGTCGG 0: 1
1: 0
2: 0
3: 38
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105539004 Original CRISPR CTGCGGCGCAGGCGGCGGGT CGG Intergenic
900251942 1:1675424-1675446 GTGGGGCGCAGGCGGAGGGGCGG + Intronic
900256749 1:1701549-1701571 GTGCGGGGCAGGCAGCGGGGGGG + Intronic
900262353 1:1738281-1738303 GTGGGGCGCAGGCGGAGGGGTGG + Intronic
900562141 1:3312457-3312479 GTGAGGTGCAGCCGGCGGGTGGG - Intronic
900600240 1:3499768-3499790 CTACGGCACAGGCGGGGGCTAGG - Intronic
901199166 1:7457039-7457061 CGGCGGCGCAGGGGGCGGGGCGG - Intronic
902044278 1:13513563-13513585 CGGCGGCGCAGGCTGGGGCTCGG + Exonic
904720066 1:32500835-32500857 CGGCGGCGGCGGCGGCGGGAAGG + Intronic
904784192 1:32973197-32973219 CTACGGCGCAGGGGACGGGAAGG + Intergenic
905212775 1:36385857-36385879 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
905990664 1:42334909-42334931 TTGCGGGGTGGGCGGCGGGTGGG - Exonic
906325583 1:44843371-44843393 CGGCGCCGCAGGGGGCGGGGCGG + Intergenic
906678721 1:47710686-47710708 CGGAGGCGCAGGCGGCTGCTGGG + Intergenic
908131198 1:61077132-61077154 CTGCGGCGGAGGGGGCAGGGAGG - Intronic
908355385 1:63322311-63322333 CTGGGGCCCAGGGAGCGGGTGGG - Intergenic
912174686 1:107141235-107141257 CTGCGGCGGTGGCGGCGGCTCGG + Intronic
912927903 1:113929714-113929736 CGGCGGCGGCGGCGGCGGGAAGG + Exonic
915441973 1:155951058-155951080 CTACGGCGCTGCCGGCGGCTAGG - Exonic
916890258 1:169106615-169106637 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
917846673 1:179025966-179025988 CTGTGGCGGCGGCGGCGGCTGGG + Exonic
918046919 1:180947207-180947229 CTGCAGAGCAGGCAACGGGTTGG + Exonic
919940615 1:202283552-202283574 CTGCGGCCCAAGCTGCGGTTTGG + Intronic
921355563 1:214281437-214281459 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
921432798 1:215083015-215083037 CGGCGGCGGCGGCGGCGGGCAGG + Intronic
923106609 1:230858661-230858683 CTGCGGGGCAGGCAGAGGGCAGG + Intronic
924415171 1:243850304-243850326 CGGCGGCGGCGGCGGCGGGAGGG + Intronic
924776007 1:247114768-247114790 CTGGGTAGCAGGCGGGGGGTGGG + Intergenic
1064443048 10:15370870-15370892 CGGCGGCGGCGGCGGCGGGAGGG - Intronic
1064443106 10:15371058-15371080 CCGCGGGGCCGGCGGCGGCTCGG + Exonic
1065099923 10:22321949-22321971 GCGCGGCGCGGGCTGCGGGTCGG - Intronic
1066464801 10:35641984-35642006 CGGCGGCGGCGGCGGCGGCTTGG - Exonic
1067694327 10:48524141-48524163 CCGGGGCGCAGGCGGCAGGCGGG - Intronic
1067972715 10:50991307-50991329 CGGCGGCGGCGGCGGCGGCTGGG - Intergenic
1067972811 10:50991711-50991733 CCGCGGCGGCGGGGGCGGGTCGG + Intronic
1070328646 10:75403315-75403337 CTGCGGGGATGGCGGCAGGTGGG - Intergenic
1071695298 10:87863523-87863545 CGGCGGCGGAGGGGGCGGGCAGG + Exonic
1072719499 10:97771929-97771951 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1072757569 10:98030865-98030887 CGGCGGCGAAGGCGGCGGCGAGG + Intergenic
1075699795 10:124461934-124461956 CAGCGGCGCGGGCGGCGGCACGG + Exonic
1076374186 10:129972696-129972718 CTGCGGCGGAGGCGCGGGGTGGG - Intergenic
1076374266 10:129972947-129972969 CGGCGGCGCCGGCTGCGGGCCGG + Intergenic
1076722094 10:132397179-132397201 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1076749890 10:132537420-132537442 CCGCGGCGCGGGGGGCGGGGCGG + Intergenic
1076890701 10:133281831-133281853 CTGCGGCGCCGGCTCCGGGGTGG - Intronic
1077043665 11:535285-535307 CGGCGGCGGCGGCGGCGGGTGGG - Intronic
1077225116 11:1436220-1436242 CTGCGGTGCTGGATGCGGGTGGG + Intronic
1078498274 11:11842070-11842092 CTGGAGCGCAGGCGGCGGAGAGG + Exonic
1078631732 11:13009712-13009734 CAGCGGCGGAGCCGGCGGCTGGG + Intergenic
1080503768 11:32893157-32893179 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1081574303 11:44309745-44309767 CTGCGGCTGCGGCGGCGGCTGGG + Exonic
1081831910 11:46121536-46121558 CGGCGGCGGCGGCGGCGGGCCGG - Intergenic
1081938135 11:46918590-46918612 CTGCGGCGCGGGGGGCGGGGCGG - Exonic
1083039029 11:59668773-59668795 CTGCGGGGCAGGGGGCGGGCTGG - Intronic
1083259742 11:61516503-61516525 CCGCGGGGCAGGCGGGTGGTGGG + Intronic
1083262167 11:61529080-61529102 CTGGGGCTCAGGCGGCTGGGGGG - Intronic
1083442724 11:62687803-62687825 CTGCGGCTCGGGCGGCGGCTCGG + Exonic
1083448392 11:62726569-62726591 CAGGGGCGCAGCCGGCAGGTTGG + Intronic
1083595554 11:63916980-63917002 CGGCGGCGACGGCGGCGGGACGG + Intergenic
1083595940 11:63918299-63918321 CTCGGCCGCAGGCAGCGGGTGGG - Intergenic
1084072393 11:66744828-66744850 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
1084295839 11:68213129-68213151 GGGCGGCGCAGGCGGTGAGTCGG - Exonic
1084295908 11:68213376-68213398 CGGCGGCGGCGGCGGCCGGTTGG - Exonic
1085011103 11:73142240-73142262 CGGCGGCGCAGGCGGCCGACCGG - Exonic
1085717992 11:78889907-78889929 CTGCGGGGCAGGGGTCGGGGCGG + Exonic
1087014622 11:93543236-93543258 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1088325112 11:108593282-108593304 CTGCTGCGGAGGCTGCGGGTCGG - Intronic
1088648445 11:111937119-111937141 CTGCGGCCCGGGCGGGGGGGGGG + Intronic
1089150149 11:116358024-116358046 CTGCGGCAAAGGCGGTGGGCGGG - Intergenic
1090357028 11:126147112-126147134 CTGCGGGTCAGGCTGTGGGTGGG - Intergenic
1091558577 12:1594153-1594175 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1091712736 12:2753238-2753260 ACGCGGCGCTGGCGGCGGGAGGG - Intergenic
1092743219 12:11649804-11649826 CGGGGGCGCCGGCTGCGGGTGGG + Intergenic
1095917609 12:47495975-47495997 GGGCGGCGGAGGGGGCGGGTGGG - Intergenic
1096489711 12:52006953-52006975 CGGCGGGGCTGGCGGCGGCTGGG - Exonic
1096863763 12:54549324-54549346 GTGCAGCGGAGGCGGCGGGCTGG - Intergenic
1097267798 12:57755761-57755783 CGGCGGCGCGGGCGGCGGCAGGG - Exonic
1098550374 12:71755141-71755163 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1101816000 12:108146661-108146683 CTGAGGCCCAGGCGTAGGGTGGG + Intronic
1102537373 12:113591514-113591536 CGGCGGCGGTGGCGGGGGGTGGG + Intergenic
1103954266 12:124567621-124567643 CGGCGGCGGCGGCGGCGGGAGGG + Intergenic
1104112488 12:125716941-125716963 CTGGGGCGCAGGCAGAGGGAAGG + Intergenic
1104198782 12:126567309-126567331 CTGTGGGGCAGGGGGTGGGTGGG - Intergenic
1104761297 12:131298884-131298906 CTGCTGCGGGGGCAGCGGGTGGG + Intergenic
1104818478 12:131661908-131661930 CTGCTGCGGGGGCAGCGGGTGGG - Intergenic
1105539004 13:21298308-21298330 CTGCGGCGCAGGCGGCGGGTCGG + Intergenic
1106057710 13:26254264-26254286 CTGCGGCGGGAGCGGCGGGGCGG - Exonic
1106956331 13:34942669-34942691 CTGAGGCGCAGGCGGGGAGCGGG + Exonic
1107654124 13:42574398-42574420 GTGCGGCGCAGGCGGCGGCGGGG - Exonic
1112216256 13:97434108-97434130 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1113731185 13:112642604-112642626 GTGGCGGGCAGGCGGCGGGTGGG - Intergenic
1113785445 13:112999971-112999993 CTGAGGCACAGGTGGCGAGTGGG + Intronic
1113831240 13:113297381-113297403 CGGGGGCGCGGGCGGCGGTTGGG - Exonic
1116895515 14:50311972-50311994 CAGCAGCGCAGGCGGCGGGGAGG + Intronic
1116928618 14:50668076-50668098 CGGCGGCGGAGGCGGCGGCTCGG - Exonic
1118749225 14:68794450-68794472 CCAAGGCGCAGGGGGCGGGTGGG - Intronic
1122226833 14:100285385-100285407 CGGCGGCGCACCCTGCGGGTGGG - Intergenic
1122620962 14:103057473-103057495 CTGCGGCGGCGGCGGCGGGGAGG - Intergenic
1122787556 14:104171003-104171025 CTGGGGGGCAGGCTGAGGGTGGG - Intronic
1122940334 14:104978295-104978317 CTCCGGCGCACGGGGCGGGCGGG + Exonic
1123025259 14:105420946-105420968 CAGCAGCGCAGGCTGCAGGTGGG - Intronic
1123035519 14:105470276-105470298 CTGAGGGGCGGGCGGCGGGCTGG - Exonic
1202899773 14_GL000194v1_random:28353-28375 CGCCGGCGCAGGCGCCGGGGGGG - Intergenic
1124204513 15:27705420-27705442 CTGGGGCACAGGCGGTGGGTGGG - Intergenic
1124922311 15:34038911-34038933 CGGCGGCGGAGGCGGCGGCGGGG - Exonic
1124966549 15:34436816-34436838 CTGGGCTGCAGGCGCCGGGTTGG - Intronic
1126668501 15:51094960-51094982 CTCCGACGCAGGGCGCGGGTAGG - Intronic
1126852402 15:52805385-52805407 CGGCGGCGGCGGCGGGGGGTTGG + Intergenic
1128119431 15:65134696-65134718 CTGGGGCGAAGGCGGAGGGGGGG - Intergenic
1129262140 15:74374409-74374431 CTGCGGTGGAGGGGGCGGGGCGG + Intergenic
1131466086 15:92655748-92655770 CTGCGGCGGAGGCGGCTGCGCGG + Exonic
1132251897 15:100341038-100341060 CTGCGGCGCCGCCGGCGGCCTGG - Exonic
1132884745 16:2177736-2177758 CTGCGTCCCAGGGCGCGGGTGGG - Exonic
1133784358 16:8963370-8963392 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1133784576 16:8964072-8964094 CTGCGGCGCAGGCGGTGCCGGGG - Intronic
1134441528 16:14302118-14302140 CAGCGGCCCAGGCGGCGGGGCGG - Intergenic
1134621390 16:15692180-15692202 CTGCGGCGAAGGCTGCAGGCTGG - Intronic
1135296538 16:21283936-21283958 CAGCGGCGGAGGCGGCGGCGAGG + Intronic
1135712505 16:24729706-24729728 CGGCGGCGGCGGCAGCGGGTCGG + Exonic
1136261774 16:29082239-29082261 CTGCGGCGCAGGAGCCGGGGCGG - Intergenic
1136409016 16:30065757-30065779 GGGCGGCGCAGGAGGCGGGCAGG - Intronic
1137003649 16:35252278-35252300 CTGGGGGGCAGGCTGGGGGTGGG - Intergenic
1138450773 16:57092561-57092583 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1140223947 16:73064172-73064194 CTGGGGGGCAGGAGGCAGGTGGG + Intergenic
1141553180 16:84819807-84819829 CTGAGGCGCGGGCGCCGGGTGGG - Intergenic
1141869492 16:86775086-86775108 CGGCAGGCCAGGCGGCGGGTGGG + Intergenic
1142049935 16:87951611-87951633 CTGCGGCGCGGGCGGCCCGGCGG - Intronic
1203070916 16_KI270728v1_random:1073773-1073795 CAGCGGCGGTGGCGGCGGGGGGG + Intergenic
1142752679 17:1998128-1998150 CGGCGGCGGAGGGGGCGGGGAGG + Intronic
1142762396 17:2050177-2050199 CGGCGGCGCAGGCAGCGGGCCGG + Intergenic
1142799711 17:2337553-2337575 CGGCGGCGGCGGCGGCGGGCCGG + Exonic
1142836764 17:2593518-2593540 CTGCGGCGCATGCGCCGGGCTGG - Intronic
1143750501 17:9023407-9023429 CGGCGGAGCCGGCGGCGGGTGGG + Intronic
1145925649 17:28644943-28644965 CGGCGGCGGCGGCGGCGGGAGGG - Intronic
1146132635 17:30291964-30291986 CGGCGGCGGCGGCGGCGGGGAGG + Exonic
1146219836 17:31008724-31008746 CAGCGGCGGAGGCGGCGGGCAGG - Intergenic
1148025488 17:44584767-44584789 CTGGGGCGAAGGCGCAGGGTGGG - Intergenic
1148053391 17:44779969-44779991 CTGAGCCGCAGGAGGTGGGTGGG - Exonic
1148271759 17:46267003-46267025 CGGCGGCGCGGGCGGCGAGCCGG - Intergenic
1148733382 17:49851245-49851267 CCGCGGCCCCGGCGGCGGGTGGG + Intergenic
1148786924 17:50150103-50150125 CGGCGGCGCAGGCTGCGCGGAGG + Exonic
1148857386 17:50586231-50586253 CTGAGGCCCTGGGGGCGGGTGGG - Intronic
1149626354 17:58083349-58083371 CGGCGGCGCGCGCGGCGGGGGGG + Intergenic
1149626606 17:58084177-58084199 CGGCGGCGCGGGCGGGAGGTCGG + Intronic
1149685824 17:58534062-58534084 CTGCTGCCCAGGCAGCAGGTTGG + Intronic
1150060583 17:62065369-62065391 CGGCGGCGGCGGCGGCGGGGGGG - Intergenic
1152095737 17:78270579-78270601 CTGGGGCTCAGGCGGTGGGGTGG - Intergenic
1152408912 17:80112238-80112260 CTGGGGTGCAGGCAGCGGGTGGG - Intergenic
1152433119 17:80260542-80260564 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433132 17:80260572-80260594 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433145 17:80260602-80260624 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433158 17:80260632-80260654 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433171 17:80260662-80260684 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433184 17:80260692-80260714 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433197 17:80260722-80260744 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433210 17:80260752-80260774 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433223 17:80260782-80260804 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433236 17:80260812-80260834 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152711222 17:81871248-81871270 GCGGGGCGGAGGCGGCGGGTCGG - Intronic
1154048186 18:10927394-10927416 TTGCAGCGCAGGCCGTGGGTGGG + Intronic
1155392722 18:25352309-25352331 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1156099661 18:33578454-33578476 CGGCGGCGGCGGCGGCGGGTGGG - Intergenic
1157849137 18:51030715-51030737 CGGCGGCGGCGGCGGCGGCTGGG + Intronic
1158259107 18:55588152-55588174 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1158601938 18:58863501-58863523 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1159586613 18:70288873-70288895 CCGCGGCGCAGGCGGGGCGTCGG - Intergenic
1159798106 18:72867785-72867807 CGGCGGCGCCGGCGGCGGCGGGG + Exonic
1160454847 18:78992959-78992981 CTGCGGCGCTGGCGCCGGGGCGG - Exonic
1160860842 19:1236779-1236801 CTGCGGAGCAGGCCGCGGCTGGG + Intronic
1160914552 19:1490418-1490440 CTATGGCGCCGGGGGCGGGTCGG - Intronic
1160935493 19:1592682-1592704 CTGAGGCGGCGGCGGCGAGTGGG - Exonic
1161800587 19:6415153-6415175 CTGCTGCGTGGGCGGCGGCTGGG + Exonic
1161802628 19:6424539-6424561 CGGCGGCCCGGGCGGGGGGTCGG - Exonic
1162372929 19:10289865-10289887 CGGCGGCAGAGGCGGCGGGGGGG - Intergenic
1162954499 19:14090776-14090798 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1163138809 19:15332498-15332520 CGGCGGCGGCGGCGGCGGCTGGG - Intronic
1163424880 19:17235862-17235884 CTTCGGCGCAGGGGGCGGCGCGG - Exonic
1163791417 19:19308571-19308593 CTGCGGCTGAGGTGCCGGGTGGG - Intronic
1165623734 19:37268992-37269014 CTGTGGCCCAAGCGGCGGCTCGG + Intergenic
1165624824 19:37274059-37274081 CTGTGGCCCAAGCGGCGGCTCGG + Intergenic
1165805442 19:38578021-38578043 CAGCAGCCCTGGCGGCGGGTTGG - Exonic
1166045281 19:40226347-40226369 CACCAGGGCAGGCGGCGGGTAGG + Intronic
1166211662 19:41310368-41310390 GTCACGCGCAGGCGGCGGGTGGG + Intronic
1166361247 19:42253856-42253878 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1166714062 19:44955400-44955422 CGGCGGCGCAGGAGGCGGACGGG + Exonic
1166721878 19:45001650-45001672 CTCCGGCGCAGCCGGCGGTCTGG - Exonic
1167293165 19:48635557-48635579 GTGCGGCGAAGGGGGCGGGGCGG - Intronic
1168076352 19:53982606-53982628 CGGCGGCGGAGGCGGCGGCGGGG + Exonic
1168092648 19:54095833-54095855 CTGGGGCGGAGGAGGCGGGCCGG + Exonic
927652426 2:24920410-24920432 ATCCGGCGCGGGCGGCGGGCTGG + Intergenic
929151158 2:38750540-38750562 CAGCGGCGTCGGCGGCGGGAGGG + Intronic
929983182 2:46699472-46699494 CCGGGGAGCAGGCGGCGGGCCGG - Intronic
932773192 2:74513206-74513228 CTGCGGTGGCGGTGGCGGGTGGG - Intergenic
933666855 2:84971274-84971296 CGGCGGCGGCGGCGGCGGGGAGG - Exonic
933791784 2:85888952-85888974 GAGCGGCGCTGGGGGCGGGTGGG - Exonic
934079068 2:88452325-88452347 CTGCGGCGGCGGCGGAGGGCGGG + Exonic
934079118 2:88452460-88452482 CGGCGGCGGTGGCGGCGGGCGGG + Exonic
934567134 2:95347141-95347163 CTGCGGCGGAGGCGGCGAAGGGG - Intronic
934580736 2:95435510-95435532 CCGGGGCGCAGGCGCTGGGTAGG - Intergenic
934598715 2:95641207-95641229 CCGGGGCGCAGGCGCTGGGTAGG + Intergenic
936126706 2:109794593-109794615 CGGCGGCGGCGGCGGCGGGGGGG + Intronic
937093917 2:119223824-119223846 CCGCGGCGAAGGCGGTGGCTCGG - Exonic
937960859 2:127457181-127457203 CTGCGGGGCACGCGGAGGGCTGG + Intronic
938038138 2:128053515-128053537 CGGCGGCGGCGGGGGCGGGTAGG - Intergenic
938451542 2:131425324-131425346 CGGCGGCGGCGGCGGCGGCTCGG - Intergenic
940918879 2:159286531-159286553 CAGCGGCGGTGGCGGCAGGTGGG - Exonic
941666422 2:168247540-168247562 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
941906045 2:170716686-170716708 CGGCGGCGGAGGCAGCAGGTTGG - Exonic
943624152 2:190180547-190180569 CTGCGGCGCCGGCAGCTGCTTGG + Intronic
944273006 2:197804638-197804660 CTGCGCCGCAGTCCGCGGGCAGG + Intergenic
946921437 2:224585182-224585204 CGGCGGCGGCGGCGGCGGCTCGG + Exonic
947523444 2:230865156-230865178 CTGGGGCTCAGGCGGTGGGGCGG + Intronic
948893185 2:240916760-240916782 CTGCTGAGCAGGCGGAGGGAGGG + Intergenic
948912628 2:241011992-241012014 GAGCGGGGCAGGCGGCGGGTGGG + Intronic
949019784 2:241734653-241734675 CTGCGGCGGGCGCTGCGGGTTGG + Exonic
1168756771 20:324177-324199 CCGCGGCGCGGGGGGCGGGGTGG - Intergenic
1168883252 20:1225636-1225658 CGGCGGCGGCGGCGGCGGCTGGG - Intergenic
1169065570 20:2692815-2692837 CGGCGGCGGCGGCGGCGGGATGG + Intergenic
1170150380 20:13221376-13221398 CTGCGGGGTCGGCGGCGGGGCGG - Intergenic
1172596592 20:36154710-36154732 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1172830387 20:37829106-37829128 CTGGGGGGCAGGGGGCAGGTGGG + Intronic
1174246713 20:49187779-49187801 CTGGGGCGCAGGCGGGGGGGGGG - Intronic
1174607011 20:51768402-51768424 CGGCGGCCCAGGCGGCGCGGGGG - Exonic
1175074025 20:56358885-56358907 CGGCGGCGAAGCCGGCGGGCGGG + Intergenic
1175358613 20:58389542-58389564 CTGGGGCGGAGGCCGCGGGCAGG - Intronic
1175429372 20:58891237-58891259 CCGCGGCGGCGGCGGCGGCTGGG - Intronic
1176005629 20:62861062-62861084 GCGCGGCGCGGGCGGCGGCTCGG + Exonic
1176062640 20:63178995-63179017 CCGCGGTGCTGGCGGCGGGGCGG + Intergenic
1176388025 21:6149034-6149056 CTGCAGGGCAGGCGGCAGGCAGG - Intergenic
1176418971 21:6499175-6499197 CGGCAGCGGCGGCGGCGGGTGGG - Intergenic
1176425677 21:6547036-6547058 CTGCAGGGCAGGCGGCAGGCTGG - Intergenic
1179694464 21:43107497-43107519 CGGCAGCGGCGGCGGCGGGTGGG - Exonic
1179701168 21:43155353-43155375 CTGCAGGGCAGGCGGCAGGCTGG - Intergenic
1179735447 21:43389214-43389236 CTGCAGGGCAGGCGGCAGGCAGG + Intergenic
1179800161 21:43807992-43808014 CTGCAGGGCAGGCGGCCGGCTGG + Intergenic
1180169943 21:46052897-46052919 CTGAGACGCAGGCTGTGGGTCGG - Intergenic
1180910694 22:19447874-19447896 CTGCGGCGCGCGCGGAGGGCCGG + Exonic
1181478007 22:23180502-23180524 CTGCGGCGCAGAGTGCGGGCCGG + Exonic
1181631918 22:24156059-24156081 CCACGGCGGAGCCGGCGGGTAGG + Intronic
1182321666 22:29481738-29481760 CTGTGGCGGAGGTGGCTGGTGGG + Intronic
1182697117 22:32205272-32205294 CTGTGGCGTGGGGGGCGGGTTGG + Intergenic
1183451004 22:37895070-37895092 CTGCAGGGCAGGCTGGGGGTGGG - Intergenic
1183524929 22:38317279-38317301 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1184620330 22:45671916-45671938 CTGCAGCGGCGGCGGCGGTTAGG + Exonic
1184818770 22:46893069-46893091 CTGCGGGTCAGACGGCTGGTCGG - Intronic
1185081972 22:48714472-48714494 CTGAGGCCCAGGTGGTGGGTGGG - Intronic
1185222951 22:49638111-49638133 CTGCCCAGCAGGCAGCGGGTGGG - Intronic
1185330754 22:50251137-50251159 CTGGGGCGCAGGCGGGCGGCGGG + Exonic
950316346 3:12004742-12004764 CTGCGGCGCGGGCGCCGAGGCGG - Exonic
950829444 3:15859701-15859723 CGGCGGCGGCAGCGGCGGGTAGG - Exonic
951080464 3:18445285-18445307 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
951558834 3:23945941-23945963 CTGAGGCGGCGGCGGCGGGCGGG + Intronic
954004217 3:47578863-47578885 CGGCGGCGCGGGAGGCGGGGAGG - Exonic
954743153 3:52770773-52770795 ATGCGGCGGCAGCGGCGGGTAGG + Exonic
954798767 3:53175061-53175083 CTGCTGGGCAGGCCGGGGGTAGG + Intronic
956978918 3:74614428-74614450 CGGCGGCGGCGGCGGCGAGTGGG - Intergenic
962277954 3:134030034-134030056 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
963511148 3:146250951-146250973 CTGCGGGGCAGGCGGTGAGTGGG - Exonic
964482779 3:157159572-157159594 CAGCGGCGGCGGCGGCGGGAGGG - Intronic
964819598 3:160755633-160755655 CTGAGCCGCAGGCGGCCGGCTGG - Intronic
967849436 3:194071057-194071079 CCGCGGAGCAGGCGGCGGGAGGG - Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968674719 4:1871352-1871374 CTGCGGCGGCGGCGGCGGGCGGG + Intergenic
968775346 4:2536728-2536750 CTGCGGGGCAGGCCGCTGGGCGG - Intronic
969115004 4:4865962-4865984 CTGCGGCGCAGGGAGGGGGCGGG - Intergenic
969436590 4:7192609-7192631 CAGCGGAGCCGGCGGCGGGGCGG - Exonic
970456221 4:16226550-16226572 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
978741872 4:112145811-112145833 CTGCGGCGCGGCCCGCGGGCCGG - Intronic
978795747 4:112705997-112706019 CTGCGGCGCAGGAGCCGGGGCGG + Intergenic
981528787 4:145733152-145733174 GGGAGGGGCAGGCGGCGGGTGGG - Intronic
985580472 5:693181-693203 CTGCGGCGCAGGTGGCTGCTGGG + Intronic
985595131 5:784571-784593 CTGCGGCGCAGGTGGCTGCTGGG + Intergenic
986190903 5:5495159-5495181 CTGCTGGGCAGGCTGCGGGAAGG + Intergenic
986330579 5:6713838-6713860 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
989102272 5:37834571-37834593 GTGCGGGGCTGGCTGCGGGTGGG + Intronic
992067463 5:73120720-73120742 CTGCGCCGGCGGCGGCGGGTCGG + Intronic
998386517 5:141760225-141760247 CTGTGGGGCAGGGGGCCGGTGGG + Intergenic
1001249746 5:170137933-170137955 CTGAGGCCAAGGCGGTGGGTAGG + Intergenic
1002490710 5:179575030-179575052 CTGCGGCTGGGGCGGGGGGTGGG - Intronic
1002591067 5:180291966-180291988 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
1002897857 6:1389746-1389768 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1003099038 6:3163120-3163142 CCGCGGCGCAGGGGGAGGGCGGG + Intergenic
1004044869 6:12013092-12013114 CGGCGGAGCAGGCGGCGAGGAGG + Intronic
1004690346 6:17987691-17987713 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1005987563 6:30884216-30884238 CAGCGGCGCGGGCGGCTGGGCGG + Intronic
1006185251 6:32177967-32177989 CTGCGCAGCACGCGGCGGGACGG - Intronic
1006523284 6:34584373-34584395 CTGCAGCTCAGGGGGCGGGGTGG - Intergenic
1007665295 6:43509940-43509962 CTGCGGCGGAGGCTGCGGCGGGG + Exonic
1007781400 6:44256970-44256992 CTGCAGCGGAGGGGGCGGGGAGG - Intronic
1008013328 6:46491204-46491226 CGGAGGCGGAGGCGGCGGCTGGG + Exonic
1010141923 6:72622254-72622276 CAGCGGCGGCGGCGGCGGGCGGG + Exonic
1011983851 6:93418685-93418707 CTGCGTCGGAGGCGGCGGCGCGG - Intronic
1012450692 6:99349951-99349973 CTGGAGCGCAGGCGGAGGGCCGG - Intronic
1013170790 6:107634941-107634963 CTGGGTCGCCGGCGGCGGGCGGG - Exonic
1013230510 6:108157782-108157804 CTGCGGCGGGGGCGGCCGGGCGG - Intronic
1013233325 6:108175781-108175803 CTGCGGCGCAGGAAGCCGGAGGG + Intronic
1015843049 6:137493493-137493515 CTGCAGCGCGGGCGGCGTGGAGG + Exonic
1016329847 6:142945053-142945075 GCGCGGCGCAGGCGGCCGGGCGG - Intronic
1016992799 6:149941662-149941684 TCGCGGCGCAGGCGGAGGGAGGG + Intergenic
1017002451 6:150005611-150005633 CCGCGACGCAGGCGGAGGGAGGG - Intergenic
1017044787 6:150337346-150337368 CTGCGGCGCAGGCTGTGAGCTGG + Intergenic
1017103090 6:150865717-150865739 CGGCGGCGGCGGCGGCGGGAAGG - Exonic
1017470459 6:154733482-154733504 CTGCGGCCCGAGCGGCGGGGAGG + Exonic
1017871906 6:158493783-158493805 GAGCAGTGCAGGCGGCGGGTAGG - Intronic
1019189556 6:170243822-170243844 CAGCGGGGCAGGCGTCGGGGAGG + Intergenic
1019324623 7:432079-432101 GTGGGGCGGAGGCGGGGGGTGGG + Intergenic
1019343659 7:519744-519766 CTGCGGCGGAGGCGCCGACTCGG - Intronic
1019472758 7:1229983-1230005 CGGCTGCGGGGGCGGCGGGTGGG + Intergenic
1019989550 7:4682244-4682266 CGGCGGCGCGGGGGGCGGGGAGG - Intergenic
1021451051 7:20784421-20784443 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1022097110 7:27147975-27147997 CTGCCGGGCGGGCGGCGGGCGGG - Intronic
1022318170 7:29264012-29264034 CTGGGGGGCAGGCCCCGGGTGGG + Intronic
1027390276 7:77696898-77696920 CAGCGGCGGCGGCGGCGGGCAGG - Exonic
1029465155 7:100720724-100720746 CTGCGGCTCTGGCCGGGGGTCGG - Intergenic
1034147155 7:148883889-148883911 CTGCGGGGCGGGGGGCGTGTGGG - Intronic
1034469718 7:151248750-151248772 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
1034578930 7:152025936-152025958 CTGCGGCGGCGGCGGCGCGCGGG + Intronic
1035656851 8:1314703-1314725 CTCCGGAGCAGGAGGCGGATAGG - Intergenic
1037529218 8:19757329-19757351 CAGCGGCGGCGGCGGCGGCTCGG + Intronic
1042040128 8:64581063-64581085 CGGCGGCGGCGGCGGCGGGGTGG + Exonic
1045488721 8:102654468-102654490 CTGAGGCGGAGGCCGGGGGTGGG - Intronic
1047024555 8:120811811-120811833 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1048214123 8:132480457-132480479 GGGCGGCGGAGGCGGCGGGGCGG - Exonic
1049232595 8:141492277-141492299 CTGTGTCCCAGGAGGCGGGTAGG + Intergenic
1049232607 8:141492318-141492340 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232617 8:141492359-141492381 CTGTGTCCCAGGCAGCGGGTAGG + Intergenic
1049232629 8:141492400-141492422 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232641 8:141492441-141492463 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232653 8:141492482-141492504 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232665 8:141492523-141492545 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232678 8:141492564-141492586 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232690 8:141492605-141492627 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232702 8:141492646-141492668 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232714 8:141492687-141492709 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232726 8:141492728-141492750 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232738 8:141492769-141492791 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232750 8:141492810-141492832 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232762 8:141492851-141492873 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232774 8:141492892-141492914 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232786 8:141492933-141492955 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232798 8:141492974-141492996 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232810 8:141493015-141493037 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232821 8:141493056-141493078 CTGTGTCCCAGGAGGCGGGTAGG + Intergenic
1049232833 8:141493097-141493119 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049232855 8:141493179-141493201 CTGTGTCCCAGGGGGCGGGTAGG + Intergenic
1049235016 8:141508084-141508106 TCGCGGAGCAGGCGGCGGGGAGG - Intergenic
1049361881 8:142215879-142215901 CTGGGGTGCAGGCGGAGGGTTGG - Intronic
1049689785 8:143953444-143953466 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1049762273 8:144336902-144336924 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1051170017 9:14312983-14313005 CTGCGCTGCAGGCGGTGGGCGGG - Intronic
1055611779 9:78031585-78031607 CGGCGGCGGCGGCGGCGGCTCGG - Intergenic
1057658457 9:96977751-96977773 GTGAGGCTCAGGCGGCAGGTGGG + Intronic
1058687532 9:107491142-107491164 CTTCGGCTCAGGCTCCGGGTAGG + Intergenic
1058885836 9:109320694-109320716 CGGCGGCGGCGGCGGCGGGACGG - Exonic
1059021313 9:110579568-110579590 CCGGAGCGCAGGCGGCGGCTCGG + Exonic
1060406995 9:123377767-123377789 CTCCGGCTGAGGGGGCGGGTGGG - Exonic
1061050309 9:128191355-128191377 CTGCGGAGGAGGCGGCTGGCGGG - Intronic
1061541084 9:131278045-131278067 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1062022556 9:134326350-134326372 CTGCGGCGCCGGCGGGGGGGTGG - Intronic
1062028584 9:134351860-134351882 CTGCGGCTCTGGCGGGGCGTGGG + Intronic
1062659103 9:137619092-137619114 CAGCGGCGGAGGCGGCGCGGGGG + Intronic
1185890172 X:3815876-3815898 CTGCGCCGCAGGCCTCGGGGCGG + Intergenic
1187933103 X:24311732-24311754 CTGTGGCGGCGGCGGCCGGTGGG - Intergenic
1189324663 X:40105330-40105352 CTGCGGCGGCGGCGGCGGGGCGG - Intronic
1190058112 X:47193919-47193941 AGGCGGCCCAGGCGGCGGGGAGG + Exonic
1198767078 X:140091284-140091306 CCGCGGCGCAAGCGGGGGCTGGG + Intergenic
1198767096 X:140091345-140091367 CGGCGGCGGCGGCGGCGGCTGGG + Intergenic
1199445121 X:147912093-147912115 CGGCGGCGGCGGCGGCGGCTGGG + Exonic