ID: 1105539178

View in Genome Browser
Species Human (GRCh38)
Location 13:21299672-21299694
Sequence ACAATATGGGCAGGTTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105539173_1105539178 -1 Left 1105539173 13:21299650-21299672 CCGAGAGTTAGAATTCCTGAGAA 0: 1
1: 0
2: 0
3: 28
4: 276
Right 1105539178 13:21299672-21299694 ACAATATGGGCAGGTTGTACTGG 0: 1
1: 1
2: 0
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105539178 Original CRISPR ACAATATGGGCAGGTTGTAC TGG Intergenic
904493109 1:30872170-30872192 CCAATATGGGCTGATTGTTCTGG + Intronic
909279206 1:73727231-73727253 ACAATAAGAGAAGCTTGTACAGG + Intergenic
909714385 1:78690402-78690424 ACAACATGGTCATGTTGTCCAGG - Intergenic
910585135 1:88871187-88871209 ACAATATGGGCTGGGTGCAGTGG - Intronic
912314040 1:108650614-108650636 AAATTATGGGCAGGGTGTAGGGG + Intronic
913488074 1:119352149-119352171 ACATCATGGGCAGGATGGACTGG - Intergenic
915704503 1:157831243-157831265 ACCATGTTGGCAGGTTGTATAGG + Exonic
920273892 1:204789360-204789382 ACAATATTGGCCAGTTGTTCAGG - Intergenic
920688474 1:208127967-208127989 GCAAGATGGGCAGGCTGTGCTGG - Intronic
924441311 1:244087700-244087722 AAAAGATGGGTAGGATGTACAGG - Intergenic
1063403023 10:5766199-5766221 AGGATATGGGCAGGTTTCACTGG - Intronic
1066749594 10:38639557-38639579 AAAATATGGGCAGGCTGTTGTGG - Intergenic
1069614845 10:69800655-69800677 AGAAAATGGGAAGTTTGTACTGG + Intergenic
1070122324 10:73590211-73590233 ACTACCTGGCCAGGTTGTACTGG + Intronic
1071692779 10:87839906-87839928 ACAATATGGAAAGGTGGAACAGG - Intronic
1073366655 10:102948299-102948321 AGAATATTGGCAGGTGGGACGGG + Intronic
1074993250 10:118731188-118731210 AGAATATAGGCAGGTTCTTCTGG - Intronic
1081299866 11:41437748-41437770 ACAATATGGGCTGGGTGCCCTGG + Intronic
1085111557 11:73894350-73894372 ACAAAATAGGCTGGTTGTAGTGG + Intronic
1087254949 11:95943366-95943388 AAAATATGGGCAGCTTTTATAGG + Intergenic
1089044116 11:115484555-115484577 ATAATATGGACAGGCTGAACTGG + Intronic
1091945096 12:4532490-4532512 ACTATCTGGGCTGGTGGTACAGG - Intronic
1094642653 12:32291247-32291269 AGAATATGGGCCGGGTGTAGTGG + Intronic
1094754895 12:33456540-33456562 AAACTGTGGGCAGGTTGTTCCGG - Intergenic
1097207755 12:57337862-57337884 ACACTATGTCCAGGTTATACAGG + Intronic
1102440727 12:112962282-112962304 ATAACATGGGGTGGTTGTACAGG - Intronic
1103992269 12:124807218-124807240 ACAAGATGGGGAGATTGTCCTGG + Intronic
1105539178 13:21299672-21299694 ACAATATGGGCAGGTTGTACTGG + Intergenic
1105799064 13:23887952-23887974 GCAATATGGGCAGGTTGTACTGG - Intronic
1109841692 13:67924930-67924952 ACAATAAAGTCAGTTTGTACTGG - Intergenic
1114266550 14:21075614-21075636 ACAAAATGGCCAGGCTGTCCTGG - Intronic
1115195685 14:30796611-30796633 ACCATATGGGAAGTTTGAACGGG - Intergenic
1119016611 14:71063355-71063377 AGAATATAGGCAGATTGTAAAGG + Intronic
1120695509 14:87640022-87640044 ACAAGCAGGGCAGGTGGTACTGG - Intergenic
1124126617 15:26943128-26943150 TCACTTTGGGCATGTTGTACTGG + Intronic
1134503580 16:14788119-14788141 ACAATTTGGGCAGGATGTTGAGG + Intronic
1134576988 16:15340779-15340801 ACAATTTGGGCAGGATGTTGAGG - Intergenic
1134725451 16:16415713-16415735 ACAATTTGGGCAGGATGTTGAGG + Intergenic
1134941981 16:18296145-18296167 ACAATTTGGGCAGGATGTTGAGG - Intergenic
1135399994 16:22160176-22160198 ACAATATCAGCAGCTGGTACTGG + Intergenic
1140276696 16:73515299-73515321 TCAATAGGAGCAGGATGTACTGG + Intergenic
1141098388 16:81179181-81179203 ACAATCCTGGCAGGGTGTACAGG + Intergenic
1141292026 16:82727109-82727131 ACAAGATGCGCAGGTGGTATAGG + Intronic
1142743259 17:1942527-1942549 ACAATGTTGGCAGGTGGCACGGG - Intronic
1147790179 17:43009284-43009306 AAAATCTGGGCAGGTTGTTGTGG - Intronic
1158476220 18:57782038-57782060 ACAATATGCTCAGGTTGCAGTGG + Intronic
1159305143 18:66631307-66631329 AAAATAGGGGCAGTTTGTAGTGG - Intergenic
1160582921 18:79897936-79897958 GCGATATGAGCAGGTTGTAAAGG - Intronic
1163211625 19:15845151-15845173 ACAATATGGGCCGGGTGTGATGG + Intergenic
1163224578 19:15949070-15949092 ACAAGATGGGCAGGAGGTGCTGG - Exonic
1164421808 19:28100089-28100111 AGAATATGGGCAGCTTTTAAGGG + Intergenic
1165012060 19:32855946-32855968 ACTATCTGGGCTGGTGGTACAGG - Intronic
1166527534 19:43522001-43522023 ACAAAATGGGCAGGTTGTGGTGG - Intronic
1167445587 19:49535231-49535253 ACAATATGGGCAGAAGGTAGAGG - Intronic
1167830262 19:52014158-52014180 ATAATATGGGGTGGTTGTTCTGG + Exonic
1168687646 19:58358160-58358182 ACAGTATGGGCAGCATGTCCAGG + Intronic
926517396 2:13865239-13865261 CCAAGATAGGCATGTTGTACTGG + Intergenic
935639517 2:105277746-105277768 AGAATATGGGGAGCTTGGACTGG - Intronic
935682203 2:105647767-105647789 ACAAAATGGGGAGGTTGAATTGG + Intergenic
937319229 2:120951116-120951138 ATAATAAGTGCAGGTTGTTCTGG + Intronic
937803396 2:126107622-126107644 ACAATAAGGTCAGATTGTTCAGG + Intergenic
939938014 2:148315625-148315647 ATAAGATGGGAAGGTTGGACTGG - Intronic
941921024 2:170850730-170850752 AAAATCTGGGCAGGGTGTAGTGG + Intronic
942850718 2:180482165-180482187 ACATTTTGAGCAGGTAGTACTGG - Intergenic
944761119 2:202814981-202815003 ACAATATGTGCAGTTTGCACAGG - Intronic
947459717 2:230293215-230293237 ACAATTGGGGCAGGTTGTGCAGG + Intronic
1170771713 20:19338545-19338567 ATCATATGGGCAGGTTGGACAGG - Intronic
1172623015 20:36331920-36331942 ACAAACTGGGGAGGTTGTGCTGG + Intronic
1172659342 20:36556901-36556923 ACAATATGGGCATGTTATATTGG + Intergenic
1172817617 20:37700534-37700556 ACAATATGGGCAGGAGGTGGTGG + Intronic
1176365206 21:6028670-6028692 ACAATCTGGGCCGGTGGTACTGG - Intergenic
1176931343 21:14814563-14814585 AAAATAGGGGCAAGTTGAACTGG - Intergenic
1179140439 21:38720354-38720376 ACATTATGATGAGGTTGTACTGG - Intergenic
1179758312 21:43509875-43509897 ACAATCTGGGCCGGTGGTACTGG + Intergenic
1180539338 22:16427521-16427543 AAAATATAGGCAGGTTGTTGTGG - Intergenic
955538759 3:59952248-59952270 ACAAACTCGGCAGGTTGTTCAGG - Intronic
955661927 3:61308955-61308977 ATTATATGGGCTGTTTGTACAGG - Intergenic
956195509 3:66650133-66650155 ACAATACAGGGAGGTTCTACTGG + Intergenic
956676528 3:71738431-71738453 ACAATGTGGGTAGGTTGAAAGGG + Intronic
963686686 3:148444202-148444224 ACAATATGGGAAGGTGATAAAGG + Intergenic
970868930 4:20791943-20791965 CCAATATGGGCAGGGTAGACTGG - Intronic
978500174 4:109400932-109400954 GCAGTAGGGGCTGGTTGTACTGG - Intergenic
980296633 4:130926925-130926947 AAAATATGGGCAGACTGTAGTGG - Intergenic
990140647 5:52699369-52699391 ACAACATGGGCAGGGTGTGGTGG + Intergenic
991991431 5:72343837-72343859 TCAATATGGGCAGGCTGAATGGG - Intronic
994302893 5:98167021-98167043 AGTATATGTGCAGGATGTACAGG + Intergenic
997646333 5:135484482-135484504 TGAATGTGGGCAGGGTGTACTGG + Intergenic
1004113881 6:12748687-12748709 ACAATGTTGCCAGGTTGTAGAGG + Intronic
1004545331 6:16592833-16592855 AGAATCTGAGCAGGTTGCACTGG + Intronic
1008026519 6:46642791-46642813 AGAGGTTGGGCAGGTTGTACAGG - Intronic
1008466284 6:51834405-51834427 ACAATATGTGCACTTAGTACGGG + Intronic
1010155975 6:72793370-72793392 ATAATATGGGCATGTTTTATTGG - Intronic
1010695080 6:78962731-78962753 ATTATATGGGTAGCTTGTACTGG - Intronic
1011768116 6:90646494-90646516 ACAATATTGGCCGGGTGTAGTGG - Intergenic
1016738481 6:147506275-147506297 AAAAAATGGGCAGGTTGTATGGG - Intergenic
1018559343 6:165085402-165085424 ACCATGTGGGCAGGTAGTACCGG - Intergenic
1018990488 6:168670032-168670054 ACAATATGGGCTGGGTGTGGTGG + Intronic
1022893056 7:34720456-34720478 GAAATATGGGCAGGATGTAGGGG + Intronic
1027976469 7:85162658-85162680 ACAATATGGGAAACGTGTACTGG + Intronic
1030818902 7:114072786-114072808 ATAATCTGGGCAGGGTGTAGTGG - Intronic
1035761711 8:2073433-2073455 ACACGATGCGCAGGGTGTACAGG - Exonic
1036636595 8:10554898-10554920 ACAATAGGGGCAGGTTGGTGGGG - Intergenic
1036665679 8:10735685-10735707 ACAGTAGTGGCAGGTTGGACTGG - Intronic
1036713752 8:11100918-11100940 ACTTTATGGGCAGGTGGTGCCGG + Intronic
1042444471 8:68868168-68868190 ACAATTTAGGCAGATAGTACAGG + Intergenic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1056090015 9:83196116-83196138 ACAAGAGGGGCAGGTTGAAGTGG + Intergenic
1056452199 9:86727193-86727215 ACAAGATTGGCAGGTGGTGCTGG + Intergenic
1058620817 9:106880940-106880962 ACAATATTGGCAGGTTTTCAAGG + Intronic
1060949942 9:127595073-127595095 AAAATATAGGCAGGTCGTAGAGG + Intergenic
1191707334 X:64106939-64106961 ATAAAATGTGCAGGATGTACAGG - Intergenic
1197338790 X:125241164-125241186 ACAAAATGGGCTGGGTGTACTGG + Intergenic
1198832756 X:140768226-140768248 AAAATATGATCAGGTTGTAAAGG + Intergenic
1199066337 X:143422901-143422923 AAAATATGTGCAGATTATACAGG - Intergenic