ID: 1105539179

View in Genome Browser
Species Human (GRCh38)
Location 13:21299673-21299695
Sequence CAATATGGGCAGGTTGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105539173_1105539179 0 Left 1105539173 13:21299650-21299672 CCGAGAGTTAGAATTCCTGAGAA 0: 1
1: 0
2: 0
3: 28
4: 276
Right 1105539179 13:21299673-21299695 CAATATGGGCAGGTTGTACTGGG 0: 2
1: 0
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105539179 Original CRISPR CAATATGGGCAGGTTGTACT GGG Intergenic
901203383 1:7479440-7479462 CAAAATGGGCAGGACGTCCTGGG + Intronic
906870328 1:49472260-49472282 CAAAATGGTCAAGTTTTACTAGG + Intronic
913488073 1:119352148-119352170 CATCATGGGCAGGATGGACTGGG - Intergenic
920688473 1:208127966-208127988 CAAGATGGGCAGGCTGTGCTGGG - Intronic
1068903849 10:62300620-62300642 TAAAATTGGCAGGTTGCACTTGG + Intergenic
1070089337 10:73269440-73269462 AAGTCTGGGCAGGCTGTACTTGG - Intronic
1070122325 10:73590212-73590234 CTACCTGGCCAGGTTGTACTGGG + Intronic
1071481509 10:86068445-86068467 CAATATGTGAAGGTTCTATTTGG - Intronic
1072159852 10:92755838-92755860 CAATAAGAGCAGATTGTGCTGGG - Intergenic
1073179171 10:101573734-101573756 CAAGGTGGGCTGGATGTACTTGG + Intronic
1078902241 11:15652121-15652143 CAGTATTTGCAGGTAGTACTAGG + Intergenic
1080728826 11:34925705-34925727 CAAGCTGGGCAGGTAGTAATTGG + Intronic
1090444750 11:126754494-126754516 CAAAATGGGCAGAGTCTACTTGG + Intronic
1092343664 12:7697699-7697721 CAATAAGAGTAGGTTGTATTTGG + Intergenic
1103992270 12:124807219-124807241 CAAGATGGGGAGATTGTCCTGGG + Intronic
1104084612 12:125462647-125462669 GACTATGGGCTGGTTGAACTCGG + Intronic
1105539179 13:21299673-21299695 CAATATGGGCAGGTTGTACTGGG + Intergenic
1105799063 13:23887951-23887973 CAATATGGGCAGGTTGTACTGGG - Intronic
1108599448 13:51979201-51979223 CAATATGGGCAGGAATTACACGG + Intronic
1118007213 14:61574236-61574258 CAACATTGGCAGGTTGTGCCTGG + Intronic
1121899802 14:97683674-97683696 CAAAGTAGGCAGGTTGTTCTAGG - Intergenic
1124126618 15:26943129-26943151 CACTTTGGGCATGTTGTACTGGG + Intronic
1127393440 15:58525210-58525232 CAAATTGGCCAGGTTGTTCTGGG - Intronic
1127393621 15:58526497-58526519 CCATTTGGCCAGGTTGTTCTGGG - Intronic
1135399995 16:22160177-22160199 CAATATCAGCAGCTGGTACTGGG + Intergenic
1141918552 16:87119074-87119096 CAATTTGGGGAGGTAGTTCTTGG + Intronic
1150342069 17:64376352-64376374 AAATATGGTCAAGATGTACTTGG + Intronic
1158476221 18:57782039-57782061 CAATATGCTCAGGTTGCAGTGGG + Intronic
1161274981 19:3410878-3410900 CCACATGGCCAGGTTGTGCTGGG + Intronic
1162361807 19:10224887-10224909 CACCATGGGCAGCTTGTACTCGG - Exonic
1163224577 19:15949069-15949091 CAAGATGGGCAGGAGGTGCTGGG - Exonic
1168357267 19:55709476-55709498 GAAAATGGGCAGGTTGTAAATGG - Intronic
933370347 2:81407623-81407645 CAATATGGGCATGTTGCATAAGG - Intergenic
935639516 2:105277745-105277767 GAATATGGGGAGCTTGGACTGGG - Intronic
938697152 2:133844563-133844585 AAATAGGGGCAGGTTGGAATTGG - Intergenic
939938013 2:148315624-148315646 TAAGATGGGAAGGTTGGACTGGG - Intronic
940140041 2:150484310-150484332 AAATGTGGGCAGTTTGTAGTTGG - Intronic
940713406 2:157190057-157190079 AAATATGGTCATGTAGTACTAGG - Intergenic
943409603 2:187530474-187530496 CAATATGGGTAGGATTTACCAGG - Intronic
947459718 2:230293216-230293238 CAATTGGGGCAGGTTGTGCAGGG + Intronic
1169522547 20:6389050-6389072 CATTATGGGAATGTTGGACTTGG + Intergenic
1170223874 20:13969596-13969618 CAATAAGAGCAGGGTGTAGTGGG - Intronic
1172659343 20:36556902-36556924 CAATATGGGCATGTTATATTGGG + Intergenic
1173095325 20:40022346-40022368 CAAAATGAGAAGGTTGTAGTGGG + Intergenic
1174802590 20:53576620-53576642 CAAAATGGACAGGTGATACTTGG + Exonic
1174994123 20:55546244-55546266 CAAGATCAGCAGGTTGTTCTGGG - Intergenic
1176123766 20:63466033-63466055 CACTGTGGGCAGGTTTTACCAGG - Intronic
1176365205 21:6028669-6028691 CAATCTGGGCCGGTGGTACTGGG - Intergenic
1176931342 21:14814562-14814584 AAATAGGGGCAAGTTGAACTGGG - Intergenic
1178114469 21:29403493-29403515 GAATATGGGCAAGATGTCCTAGG - Intronic
1179140438 21:38720353-38720375 CATTATGATGAGGTTGTACTGGG - Intergenic
1179758313 21:43509876-43509898 CAATCTGGGCCGGTGGTACTGGG + Intergenic
949864491 3:8536256-8536278 CACCATGGGCAGGCTGTGCTGGG - Intronic
950243317 3:11391674-11391696 CAACATGGGCAGGGAGGACTTGG + Intronic
951532844 3:23713876-23713898 TAATATGGGCTGGTTGGGCTTGG + Intergenic
958832283 3:99104146-99104168 CAAAATGGGCAGTTTGTTATTGG - Intergenic
961960037 3:130845313-130845335 AAAGATGAGCAGGTTGTACTTGG + Intergenic
962093315 3:132268306-132268328 AAAACAGGGCAGGTTGTACTGGG - Intronic
969898089 4:10323509-10323531 CAATTGGGGCAGGTTCAACTAGG + Intergenic
971008119 4:22398373-22398395 AAATAAAGGCAGGTTGTGCTGGG - Intronic
974865978 4:67581098-67581120 CACTCTGTGCAGGTTGTAGTTGG + Intronic
975382926 4:73723304-73723326 GAATATCAGCAGGTTGTAATTGG - Intergenic
977767651 4:100819156-100819178 CAATATGGGTTGATTGTATTTGG + Intronic
978500173 4:109400931-109400953 CAGTAGGGGCTGGTTGTACTGGG - Intergenic
984363252 4:178765318-178765340 CAGTATGGTCAGGTTCTAGTGGG + Intergenic
990221617 5:53597034-53597056 CAATTTGGGCAGGTTTTGCCAGG + Intronic
991991430 5:72343836-72343858 CAATATGGGCAGGCTGAATGGGG - Intronic
992980007 5:82159451-82159473 CAAGATGAGCATGTTGGACTAGG + Intronic
993955061 5:94222153-94222175 CAGTATGGGCAAGTTGGACTAGG - Intronic
996468688 5:123833918-123833940 CAATGGAAGCAGGTTGTACTGGG + Intergenic
997646334 5:135484483-135484505 GAATGTGGGCAGGGTGTACTGGG + Intergenic
999347640 5:150838597-150838619 CAATGTGGGCAGCTTGGACCTGG + Intergenic
999397995 5:151242785-151242807 CAAGACTGGTAGGTTGTACTGGG + Intronic
1000007455 5:157200355-157200377 GAATGAGAGCAGGTTGTACTTGG + Intronic
1000913938 5:167057409-167057431 AAAGATGGGCATGGTGTACTGGG + Intergenic
1005001411 6:21245579-21245601 CCATATGGGAAAGTTGAACTGGG - Intergenic
1016723942 6:147337911-147337933 CAATGCTGGCAGGTTTTACTCGG + Intronic
1016738480 6:147506274-147506296 AAAAATGGGCAGGTTGTATGGGG - Intergenic
1027976470 7:85162659-85162681 CAATATGGGAAACGTGTACTGGG + Intronic
1034083014 7:148298178-148298200 TAAAATAGGCAGGTTGGACTTGG - Intronic
1041262127 8:56030528-56030550 CAATATGTCCAGGTTATTCTAGG + Intergenic
1046757466 8:117986819-117986841 CAACATGAGCAGGTTCTATTTGG - Intronic
1047692553 8:127371261-127371283 CACAAAGGGCAGGTTGTTCTTGG - Intergenic
1048540125 8:135334748-135334770 CAATATGAGCAATTGGTACTGGG - Intergenic
1049976652 9:866405-866427 CAATATGGGGAAGCTGAACTAGG + Intronic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1054972985 9:71110274-71110296 CAAGAGAGGCAGGTGGTACTTGG - Intronic
1055279746 9:74660804-74660826 CACTATTGGCATGTTGCACTGGG + Intronic
1056444203 9:86648897-86648919 TAATTTGGGCAGGTTCCACTGGG + Intergenic
1061258140 9:129464802-129464824 CAATAAGGGCAGCTGGTTCTGGG - Intergenic
1189571453 X:42302186-42302208 CAATTTGGGCAGGATTTTCTGGG - Intergenic
1196864499 X:120058628-120058650 CATTCTGGGCAGGATGGACTTGG + Intergenic
1196878602 X:120177703-120177725 CATTCTGGGCAGGATGGACTTGG - Intergenic
1198769279 X:140111670-140111692 AAATATGTGCAGGTTGTAGATGG + Intergenic