ID: 1105539641

View in Genome Browser
Species Human (GRCh38)
Location 13:21304424-21304446
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 2, 1: 0, 2: 0, 3: 17, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105539641_1105539645 10 Left 1105539641 13:21304424-21304446 CCAAAAGGAGGTTTCATACCCTG 0: 2
1: 0
2: 0
3: 17
4: 122
Right 1105539645 13:21304457-21304479 TGTGTCACAGAAATCAGAAAAGG 0: 2
1: 0
2: 3
3: 39
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105539641 Original CRISPR CAGGGTATGAAACCTCCTTT TGG (reversed) Intergenic
901408643 1:9067317-9067339 CAGGGAAGGAAGCCTCCTCTGGG - Intronic
901475923 1:9489229-9489251 CAGGCCTTGAAACCTCCTCTGGG - Intergenic
905633989 1:39536920-39536942 AAGGGTATGAAGTTTCCTTTTGG + Intergenic
908273261 1:62441759-62441781 CATGTTATTAAACTTCCTTTGGG + Intronic
912708175 1:111930287-111930309 CAGTATATGAGACCCCCTTTTGG - Intronic
916806488 1:168265959-168265981 CAGGGAAGGAATCCTCCTCTGGG - Intergenic
1066526454 10:36284346-36284368 TAAGGTATGAAGCCTCCCTTGGG - Intergenic
1067400998 10:45973196-45973218 CAGGCTAGGAAACCTTCTTTAGG + Intronic
1067869351 10:49942765-49942787 CAGGCTAGGAAACCTTCTTTAGG + Intronic
1068183456 10:53553292-53553314 CAAGGTATGAAAACTTTTTTTGG + Intergenic
1070049681 10:72875986-72876008 CAGTATATTAAACCTCCTGTGGG + Intronic
1070569862 10:77632663-77632685 CAGGATCTAAAGCCTCCTTTTGG + Intronic
1071063303 10:81599921-81599943 CAGGAGATGGAACCTCCCTTGGG + Intergenic
1074027033 10:109647092-109647114 AAGGAAATGAAACCTCTTTTAGG - Intergenic
1074469874 10:113717242-113717264 CATGGTAAGAACCCTACTTTAGG + Intronic
1075705985 10:124501273-124501295 CAGGGTACGAGGTCTCCTTTTGG + Intronic
1078402884 11:11043983-11044005 CAGACTCTGAATCCTCCTTTTGG - Intergenic
1080773403 11:35363456-35363478 GAGGGTTTCAAACCTCATTTGGG + Intronic
1082839904 11:57680424-57680446 CAAGATATGAAACCTCCTGCAGG - Intronic
1085765833 11:79280711-79280733 CTGGGTATGAAACATCATTAAGG + Intronic
1086375138 11:86192457-86192479 CAGGATGTGAAACCATCTTTGGG + Intergenic
1086920755 11:92583665-92583687 AAGGGTATAAGAGCTCCTTTTGG - Intronic
1087891552 11:103542849-103542871 CAGGGAAGGAATCCTCCTTTAGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1093797324 12:23327925-23327947 CAGGGTTTTAAAACTCTTTTTGG + Intergenic
1095627272 12:44330843-44330865 CATGGAAGGAAACCTCCTTCTGG + Intronic
1096709477 12:53444627-53444649 CTGAGTATAAAACCTCCTTAGGG - Intronic
1099123970 12:78729392-78729414 CATTGTATTCAACCTCCTTTAGG + Intergenic
1099925225 12:89008899-89008921 CAGGGTAAAAAAGCTCCTTCAGG + Intergenic
1101877363 12:108604604-108604626 CTTGGCATGAAACCTCCTCTGGG + Intergenic
1103596982 12:122030115-122030137 CAGGCTGTGTAACCTCCTTTCGG + Intronic
1105539641 13:21304424-21304446 CAGGGTATGAAACCTCCTTTTGG - Intergenic
1105798699 13:23883805-23883827 CAGGGTATGAAACCTCCTTTTGG + Intronic
1109378702 13:61528665-61528687 CAAGGTATGAAACCTTTTGTTGG + Intergenic
1110680855 13:78310120-78310142 CAGGGTTTGAAACTGCCTCTGGG - Intergenic
1113391942 13:109906412-109906434 GGGGGTTTGAAACATCCTTTAGG - Intergenic
1118345287 14:64935705-64935727 CAGTGTATCAAAAGTCCTTTCGG + Intronic
1119041734 14:71280595-71280617 AAGGTTATGATACCTCCTTTTGG + Intergenic
1119499522 14:75112341-75112363 TAAGGTATGAAACCTCCTAGAGG + Intronic
1122313248 14:100810672-100810694 CTGAGAATGAAACCTGCTTTAGG + Intergenic
1122965601 14:105123625-105123647 AAGGGTGTGCAGCCTCCTTTTGG + Intergenic
1125680613 15:41527970-41527992 CAGTGTCTTAAGCCTCCTTTTGG - Exonic
1126173867 15:45717259-45717281 CATGGGATGAATCCTCCTTCAGG + Intergenic
1128672437 15:69584382-69584404 CATGGTATTGAACCTCCTTAGGG - Intergenic
1128890477 15:71327362-71327384 CAGGTTCTGGAACCTCCCTTGGG + Intronic
1135209974 16:20516996-20517018 CAGGTTCTGCAACCTCCTTATGG - Intergenic
1139813860 16:69650095-69650117 CTGGATGTGAAACCTACTTTAGG + Intronic
1141765802 16:86059504-86059526 CAGGGTGTGAGACACCCTTTAGG + Intergenic
1146483923 17:33228197-33228219 ATGGGTATGAAGTCTCCTTTTGG + Intronic
1147038946 17:37702378-37702400 CAGGGGATGAATCCTGCTTCTGG + Intronic
1147570998 17:41571054-41571076 CTGGATGTGGAACCTCCTTTAGG - Intronic
1148800124 17:50219826-50219848 CAGGATATGAAAACTCCTTATGG + Intergenic
1152226073 17:79093444-79093466 CAGGGTATCACACCTCCATCCGG + Intronic
1154555150 18:15742474-15742496 GAGTGTTTGAAACCTGCTTTAGG - Intergenic
1156520603 18:37719731-37719753 TAGGCTATGAAAGCTTCTTTGGG + Intergenic
1157679677 18:49594916-49594938 CAGGCTATGACTCTTCCTTTGGG - Exonic
1161848970 19:6729030-6729052 GAGGGTAAGAAACCTCCTTGAGG - Intronic
1163617379 19:18337512-18337534 CAGGTTATAAAACCTGCCTTTGG + Intergenic
1163771562 19:19194130-19194152 CAGGGTAGGATACCTCCTCTGGG + Exonic
1165428963 19:35761130-35761152 CAGGGTATGAAATGTGATTTTGG - Intronic
1166101230 19:40572530-40572552 CTGGGTTAGGAACCTCCTTTGGG - Intronic
925937890 2:8784905-8784927 AAGGATTTGAAAACTCCTTTGGG - Intronic
926098745 2:10099893-10099915 CAGGGTATGGCACCACCCTTAGG - Intergenic
926232453 2:11014681-11014703 CTGGCCATGAAGCCTCCTTTTGG - Intergenic
926561676 2:14424898-14424920 CAGAGTATGAAACTTTCATTGGG - Intergenic
930299938 2:49602804-49602826 CAGGGAATGAAAATTCCTTGAGG - Intergenic
931050268 2:58406363-58406385 AAGGGAATGAAAGCTCCTTGAGG - Intergenic
934768239 2:96892493-96892515 GAGGCTTTCAAACCTCCTTTAGG + Intronic
936904847 2:117525346-117525368 CAGAGCCTGAAACCTCTTTTTGG - Intergenic
941907841 2:170734312-170734334 CAGTGTCTGGAGCCTCCTTTAGG + Intergenic
944050967 2:195469346-195469368 CAGGGTGTGAAATCTTATTTTGG - Intergenic
948360707 2:237418135-237418157 CAGAGGCTGAAACCTCCGTTTGG - Intergenic
948434383 2:237943429-237943451 TAGGGTATTAAGCCTCCTCTTGG + Intergenic
1169037134 20:2462722-2462744 CCTGGTATGAGACCTCCTATGGG - Exonic
1169600750 20:7258079-7258101 CAGGGTATGTATTCTGCTTTTGG - Intergenic
1170832864 20:19858667-19858689 CAGGAAATGAAACCTCCATTTGG + Intergenic
1176262751 20:64191246-64191268 CAGGGTATAAGATCTCCCTTCGG + Intronic
1178019911 21:28396135-28396157 CAGGGGATGAACCCTCCTCTGGG + Intergenic
1179470690 21:41608136-41608158 CAGGGTCTGAGACGTCCTTGAGG + Intergenic
1179878149 21:44281842-44281864 CAGGGGATGGAACCTCCATCTGG + Intergenic
1182915341 22:34024218-34024240 CAGTGTATGAAACCTAATATGGG + Intergenic
952657276 3:35801540-35801562 CAGGGTGTGACACCCCCTTTGGG - Intergenic
952948045 3:38494356-38494378 CAGGGTAGGAAAACTCCCTCTGG - Intergenic
956348343 3:68305789-68305811 CAGGGTGTGAACCAGCCTTTTGG - Intronic
958055077 3:88399774-88399796 GAGGTTAGGAAACCTCATTTAGG - Intergenic
961656068 3:128442531-128442553 CAGGCTGTGAAATCTCTTTTGGG - Intergenic
963905461 3:150770229-150770251 CAAGGGATTAAACCTCCTCTTGG - Intergenic
964729145 3:159846261-159846283 CTGGGTATGATACCTCAATTGGG - Intronic
965993074 3:174844901-174844923 AGGGGTATGAAGCCTCCCTTAGG + Intronic
966160708 3:176964938-176964960 CAGGAAATGCAATCTCCTTTTGG - Intergenic
968883725 4:3315900-3315922 CAGGCTAAGAAACTTCCTTTCGG - Intronic
970351613 4:15207177-15207199 CAGAGCATGAAAGTTCCTTTTGG + Intergenic
970538404 4:17053235-17053257 CAGGGAATGATACCACCTTAAGG - Intergenic
972757584 4:42064299-42064321 GATGGTATAACACCTCCTTTTGG + Intronic
973243229 4:47981071-47981093 CAGTATATGACACTTCCTTTGGG + Intronic
974076910 4:57175513-57175535 CTGAGTATGAAAACTACTTTAGG - Intergenic
976474451 4:85467801-85467823 CAGAGAATGAGACCACCTTTTGG - Intergenic
977618521 4:99110451-99110473 CAGTGTAGGGAGCCTCCTTTTGG + Intergenic
978118226 4:105048076-105048098 CATAGTATGAACCCTCCTTTAGG - Intergenic
980797699 4:137706224-137706246 TTGGGTATGAAACATCCTTTTGG - Intergenic
981742524 4:148017534-148017556 CAGGGGAAGATACCTACTTTGGG + Intronic
984781759 4:183532864-183532886 CAGGGTGTGGAATCTGCTTTTGG + Intergenic
985882726 5:2652549-2652571 GAGGGCATGAAACGTCCTTCAGG - Intergenic
989079026 5:37596494-37596516 AAGGGTCTGTAACCTTCTTTCGG - Intronic
991478091 5:67044920-67044942 CATGGTATGAAACATCCTACTGG - Intronic
991657418 5:68917911-68917933 CAAGCTAAGAAACCTGCTTTAGG + Intergenic
993220902 5:85096252-85096274 GAGTGTATGAAAGCTCTTTTGGG - Intergenic
995111375 5:108432415-108432437 CAGGTCATAAAACCTCCTTTGGG - Intergenic
1002770346 6:285302-285324 CATGGTATGAAGCTTCTTTTTGG - Intergenic
1006472373 6:34236170-34236192 CAAGGTATGAAGCCTCCCTTGGG + Intergenic
1006977106 6:38113362-38113384 CAGCATCAGAAACCTCCTTTAGG + Intronic
1011085719 6:83538230-83538252 CAGTGTATGAAACATCTTTGGGG - Intergenic
1013399832 6:109782209-109782231 CTGGGTCAGAAACCTGCTTTGGG - Intronic
1013604644 6:111736533-111736555 CAGGGCATGAAGCCACCCTTGGG - Intronic
1017483691 6:154883106-154883128 CAGGTGATAAAACCTACTTTTGG + Intronic
1018309888 6:162496953-162496975 CATGTTTCGAAACCTCCTTTAGG + Intronic
1019087824 6:169498567-169498589 CCGTTTATGCAACCTCCTTTTGG - Intronic
1021924307 7:25520032-25520054 AAGGTTATGAACCATCCTTTCGG - Intergenic
1022190507 7:28013009-28013031 CATGGTTTGAAACCTCCTGATGG + Intronic
1023193371 7:37607928-37607950 CAGGGCTTGAAATCTTCTTTAGG + Intergenic
1023661904 7:42478759-42478781 CTGGGAAGGAAATCTCCTTTAGG - Intergenic
1028131950 7:87185958-87185980 CAGGGAACGAAACATCCTTATGG - Exonic
1029103885 7:98158158-98158180 CAGTATATGCAAACTCCTTTTGG - Intronic
1031488548 7:122359750-122359772 GAGGGTATGAAGACTTCTTTGGG + Intronic
1031881678 7:127205639-127205661 CAGGGTAAGAAACCTCACCTGGG + Intronic
1032948335 7:136877704-136877726 GCGGGTATGATACCTCCTCTAGG + Intronic
1035554714 8:558106-558128 AAGGGTGTGTAACCTTCTTTAGG - Intergenic
1038653574 8:29428045-29428067 CAGGGGATGAAACCTCCATATGG + Intergenic
1051579530 9:18656055-18656077 CAGGGTATGAGACATTCTGTAGG + Intronic
1052768555 9:32666675-32666697 CAGGTTACCAAACCTCCTCTGGG - Intergenic
1056429532 9:86513639-86513661 CAGGGTAATAAACATCATTTGGG + Intergenic
1058088222 9:100774173-100774195 CTGAGTTTGAAACCTTCTTTTGG - Intergenic
1058652051 9:107184753-107184775 CAGCATATGAAACATTCTTTAGG + Intergenic
1059067822 9:111103774-111103796 CAGGGTATGATACTTTGTTTTGG + Intergenic
1185998437 X:4980137-4980159 GAGGGTATGATACATCCTGTTGG + Intergenic
1186136111 X:6523108-6523130 CATATTATGAAAGCTCCTTTTGG + Intergenic
1192041144 X:67622898-67622920 CAGGCCATGAAAGCTCCTTGAGG + Intronic
1193461967 X:81801660-81801682 GAGGGTCTGAAATCTCCTTGGGG + Intergenic
1195411912 X:104576889-104576911 CATGGTCTAAAACCTCATTTGGG + Intronic
1197199619 X:123736672-123736694 CATGGTATGATGACTCCTTTAGG + Intergenic
1199418743 X:147618644-147618666 CAGGGTTTGATTGCTCCTTTTGG - Intergenic