ID: 1105541333

View in Genome Browser
Species Human (GRCh38)
Location 13:21319761-21319783
Sequence GCCTGTGGCCCGCACCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 1, 2: 3, 3: 40, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105541333_1105541337 13 Left 1105541333 13:21319761-21319783 CCTGCCAGGTGCGGGCCACAGGC 0: 1
1: 1
2: 3
3: 40
4: 270
Right 1105541337 13:21319797-21319819 TCAAGAAGCTAGAAAAAAAGCGG 0: 1
1: 0
2: 6
3: 64
4: 723
1105541333_1105541338 30 Left 1105541333 13:21319761-21319783 CCTGCCAGGTGCGGGCCACAGGC 0: 1
1: 1
2: 3
3: 40
4: 270
Right 1105541338 13:21319814-21319836 AAGCGGATCAAGAAGCAGAAAGG 0: 1
1: 1
2: 0
3: 19
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105541333 Original CRISPR GCCTGTGGCCCGCACCTGGC AGG (reversed) Intergenic