ID: 1105541333

View in Genome Browser
Species Human (GRCh38)
Location 13:21319761-21319783
Sequence GCCTGTGGCCCGCACCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 1, 2: 3, 3: 40, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105541333_1105541337 13 Left 1105541333 13:21319761-21319783 CCTGCCAGGTGCGGGCCACAGGC 0: 1
1: 1
2: 3
3: 40
4: 270
Right 1105541337 13:21319797-21319819 TCAAGAAGCTAGAAAAAAAGCGG 0: 1
1: 0
2: 6
3: 64
4: 723
1105541333_1105541338 30 Left 1105541333 13:21319761-21319783 CCTGCCAGGTGCGGGCCACAGGC 0: 1
1: 1
2: 3
3: 40
4: 270
Right 1105541338 13:21319814-21319836 AAGCGGATCAAGAAGCAGAAAGG 0: 1
1: 1
2: 0
3: 19
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105541333 Original CRISPR GCCTGTGGCCCGCACCTGGC AGG (reversed) Intergenic
900361185 1:2289837-2289859 CCCTCTGGGCAGCACCTGGCTGG + Intronic
900633170 1:3649564-3649586 TCCTGGGTCCCGCACCTGCCCGG + Intronic
900633197 1:3649640-3649662 GCCTGGGCCCCGCACCTGCTTGG + Intronic
900633208 1:3649670-3649692 GCCTGGGCCCCGCACCTGCTTGG + Intronic
900633230 1:3649730-3649752 TCCTGGGTCCCGCACCTGTCTGG + Intronic
900633246 1:3649790-3649812 GCCCGGGCCCCGCACCTGTCCGG + Intronic
901555401 1:10027991-10028013 GCCTGAGGCCAGCACCAGCCTGG - Intergenic
902920216 1:19661589-19661611 GCATGAGGCCCGCACCTGGCTGG - Intergenic
903318503 1:22527268-22527290 GACTGTGACCAGCACCAGGCAGG + Exonic
905629517 1:39510937-39510959 CCCTGAGCCCTGCACCTGGCTGG - Intronic
905668243 1:39775253-39775275 CCCTGAGCCCCGCAGCTGGCTGG + Intronic
906097996 1:43237026-43237048 GCCTGTGGACTGCAGGTGGCAGG + Intronic
906522698 1:46476816-46476838 GTCTGAGGCCCAGACCTGGCAGG - Intergenic
911231221 1:95363455-95363477 CCATGTGGCCCACACCTGGCAGG - Intergenic
912413389 1:109492646-109492668 GCCTGGGGCCCGGATCTGGAGGG - Exonic
912495078 1:110086288-110086310 GCCTGTTTCCCGTGCCTGGCAGG - Intergenic
916052598 1:161046995-161047017 ACCTGTGGCCCCAGCCTGGCTGG + Exonic
916530577 1:165652697-165652719 GCCTGAGGCAGGCACCTGTCTGG + Intronic
919454169 1:197802661-197802683 GACTATATCCCGCACCTGGCAGG + Intergenic
920854567 1:209652328-209652350 GCATCCGGCCCGCACCAGGCAGG + Intronic
920929861 1:210377094-210377116 GGCTGTGGCCCCCAACAGGCTGG + Intronic
921053018 1:211524599-211524621 GCCGGTGGCAGGCAGCTGGCTGG + Intergenic
921163717 1:212491063-212491085 GCCTCTGCCCGGCTCCTGGCTGG + Intergenic
923000766 1:230004826-230004848 GCCAGTGGCCTGCAATTGGCAGG + Intergenic
923740597 1:236651403-236651425 GCCTTTGGCCCACATTTGGCAGG + Intergenic
924382045 1:243474404-243474426 GCCTGGAGCCCGCACCTGGAGGG - Intronic
1062836300 10:638069-638091 GCCCGAGGCACACACCTGGCCGG - Intronic
1063927714 10:10996838-10996860 GCCTGTGGGCAGCACCTCCCAGG - Intergenic
1063963723 10:11328474-11328496 GCCTGTTGGCCTCACCTGGCTGG + Intronic
1064086385 10:12349292-12349314 GCGTGCGCCCCGCACCTGCCGGG + Intergenic
1067225432 10:44373224-44373246 GCCTGGGGCCCTGCCCTGGCAGG + Intronic
1067803930 10:49380350-49380372 GCCTGTGGCCAGCACTTCTCCGG + Intronic
1067947696 10:50700811-50700833 ACCTGTGGCCAGCACGGGGCTGG - Intergenic
1068083498 10:52347336-52347358 GCCTGGGTCCTGCACCTGGGAGG - Intergenic
1069325876 10:67230992-67231014 GACTGTGTCCCGCACCTGGCTGG + Intronic
1070883012 10:79865804-79865826 ACCTGTGGCCAGCACAGGGCTGG - Intergenic
1071649580 10:87382119-87382141 ACCTGTGGCCAGCACAGGGCTGG - Intergenic
1072253582 10:93600690-93600712 GGCTGTGGCGCTCATCTGGCCGG + Exonic
1073302445 10:102479394-102479416 TGCTGTGGCCCACACCTGGCAGG + Exonic
1073379811 10:103069535-103069557 GCCTGTGGCCGGCTCTTGTCTGG + Intronic
1074163031 10:110849754-110849776 ACCTGAGGCCAGCACCAGGCAGG - Intergenic
1075088812 10:119431394-119431416 ACCCGTGGCCCGAACCTGGCAGG - Exonic
1076256017 10:129025477-129025499 GCCTTTTGCCAGCCCCTGGCTGG - Intergenic
1076607036 10:131695817-131695839 CCCTGAGGCCCGCACGTTGCAGG - Intergenic
1076675311 10:132144467-132144489 CCCTCTGGCCGGCACCTGGCAGG + Intronic
1076723495 10:132402951-132402973 TCCTGGCGCCAGCACCTGGCTGG + Intronic
1076793006 10:132786591-132786613 TCCTGTGGCCCCGACCTGCCCGG - Intergenic
1077243298 11:1523252-1523274 GGCTGTGAACCGCTCCTGGCCGG + Intergenic
1077509261 11:2947485-2947507 GCATGTGGCCCACCCCTGCCAGG + Intronic
1077550529 11:3198117-3198139 GCCTGGGGTTCCCACCTGGCAGG - Intergenic
1077564723 11:3290306-3290328 ACTTGTGGCCCGCACCTGTGCGG - Intergenic
1079132177 11:17753472-17753494 GCCTCTGGCCGGCACTAGGCAGG + Intronic
1082830635 11:57614464-57614486 CTCTGTGGCCCGCACCCTGCTGG + Exonic
1084460847 11:69295795-69295817 GGCTGAGCCCCGCACCTGTCTGG - Exonic
1084540061 11:69780844-69780866 GCCTGTCGCCCAGACCTGGCTGG - Intergenic
1084843497 11:71878788-71878810 CCCTGTTGCCCCCACCGGGCTGG - Intronic
1089110676 11:116053395-116053417 TTTTGTGGCCAGCACCTGGCAGG + Intergenic
1089169183 11:116500465-116500487 GACTGTGGCCTGCGCCGGGCCGG - Intergenic
1089171871 11:116517688-116517710 CCCTGTGGCTGGCTCCTGGCCGG - Intergenic
1089526544 11:119100971-119100993 GCCTGTGGCTGGGACCTGGGAGG - Intronic
1089822609 11:121241729-121241751 GCCTGAGTCCTGCACCTGGGAGG + Intergenic
1091593615 12:1860130-1860152 GCCTGTGTCCCTCACCTGAAAGG + Exonic
1091792974 12:3282032-3282054 GCCTGTGGCCAGGCCCAGGCTGG + Intronic
1091997113 12:5002308-5002330 GCCTGTGGTCAGCACGCGGCAGG + Intergenic
1096312422 12:50532925-50532947 TCCTCTGGCCCTCACCGGGCTGG + Intronic
1101745033 12:107533354-107533376 TCCTGTGGGCAGCACCTAGCTGG - Intronic
1101898022 12:108770301-108770323 GCCGCTGGCCCCCACCAGGCTGG + Intergenic
1101898072 12:108770450-108770472 GCCGCTGGCCCCCACCAGGCTGG + Intergenic
1102059541 12:109922435-109922457 GCCTGTGGCCCACACTGGCCCGG + Intronic
1102825358 12:115943953-115943975 ACCTCTGGCTCTCACCTGGCAGG - Intergenic
1103070161 12:117934781-117934803 GACTGTGGCTTGCACCAGGCCGG - Intronic
1103828846 12:123762684-123762706 GCCCGGGGCCTGCACGTGGCGGG - Intronic
1103884641 12:124191389-124191411 GCCTGTGGCCAATACCTGCCTGG + Intronic
1104687161 12:130793966-130793988 TCCTGTGCCCCGGGCCTGGCTGG - Intronic
1105247400 13:18665940-18665962 CCCTGTGACCTGCTCCTGGCCGG - Intergenic
1105541333 13:21319761-21319783 GCCTGTGGCCCGCACCTGGCAGG - Intergenic
1105827727 13:24137296-24137318 GCCAGGGGCCTGCTCCTGGCTGG + Intronic
1110008123 13:70297434-70297456 GCCTGGGTCCTGCACCTGGGAGG - Intergenic
1111975981 13:94967896-94967918 GGCTGCGGGGCGCACCTGGCTGG + Intergenic
1112349719 13:98622808-98622830 GGCTGTGACCCTCAGCTGGCTGG + Intergenic
1113945407 13:114041217-114041239 GCATGAGCCCCGCACCCGGCCGG - Intronic
1116938891 14:50770724-50770746 GCCTGTTGGCCACACCTTGCTGG - Intronic
1118213652 14:63788284-63788306 GCCTGGGTCCTGCACCTGGGAGG + Intergenic
1118257478 14:64217658-64217680 GCCTGTGTTCCTCACCTGGCCGG + Intronic
1119618100 14:76111944-76111966 ACCTGGGTCCTGCACCTGGCAGG - Intergenic
1119910457 14:78345145-78345167 GCCTGTGGCCCACACTTGGGGGG + Intronic
1121885773 14:97541410-97541432 GCCTGTTTCCCCCACCTGCCTGG - Intergenic
1122232904 14:100315976-100315998 ACCTGTGGCCCCAGCCTGGCTGG - Intergenic
1122409941 14:101520754-101520776 GCCTGTGCCCCGCACACAGCAGG + Intergenic
1122898865 14:104773855-104773877 GCCTGTGGGCCGCCCATGGTGGG - Intronic
1122922603 14:104886163-104886185 GCCTGAGGCCCGCCCCGGCCTGG - Intronic
1122987388 14:105218807-105218829 GCCTGTGGCCAGCACGGGGCAGG + Intronic
1123030609 14:105449511-105449533 GCCTGTGCCCTGCGCCCGGCCGG + Intronic
1124343829 15:28908067-28908089 GCCTGTGCCCGTGACCTGGCTGG + Intronic
1124558021 15:30745909-30745931 GCCCGTGGCCCTCCCCTCGCTGG + Intronic
1124964097 15:34420479-34420501 GCCTGTGCCCGTGACCTGGCTGG - Intronic
1124980710 15:34566707-34566729 GCCTGTGCCCGTGACCTGGCTGG - Intronic
1127880898 15:63157687-63157709 GCCTGAGGCCAGAATCTGGCTGG + Exonic
1128830446 15:70763523-70763545 GCCCGGGGCCCGCAGGTGGCAGG - Exonic
1129413510 15:75362348-75362370 GCCTGTGGGGGGCACCTGGGTGG - Exonic
1130297703 15:82658940-82658962 GCCTGGAGGCCCCACCTGGCTGG - Intergenic
1130994155 15:88894955-88894977 GCCTCTGGACCGCAGCTGGCCGG - Intronic
1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG + Exonic
1131258283 15:90875635-90875657 GCCTGTGGCCCGGGGCTGACTGG - Exonic
1132241966 15:100265142-100265164 GCCTGTGGTCGGCACCTGGCAGG - Intronic
1132327825 15:100986492-100986514 GTCTGTGGGACACACCTGGCAGG - Intronic
1132653426 16:1031621-1031643 CCCTGAGTCCAGCACCTGGCCGG - Intergenic
1132694193 16:1194769-1194791 GCCTGGGGCCTGCGCCTGGCCGG - Intronic
1132720630 16:1313932-1313954 GCACGTGGCCCGCAGCAGGCAGG - Intronic
1132728648 16:1349884-1349906 GCCTGTGGCCAGCACCCGGTAGG - Exonic
1132751170 16:1458405-1458427 GCCTGTCACCCGCGCCAGGCTGG - Intronic
1133027229 16:2994018-2994040 GCCTGTCCCCAGCACCTGGTTGG - Intergenic
1133291463 16:4724831-4724853 GACTGTGGCCCACATCTTGCAGG - Exonic
1134720233 16:16376950-16376972 GCCTGAGCCCCACACCTGCCGGG + Intergenic
1134947194 16:18334935-18334957 GCCTGAGCCCCACACCTGCCGGG - Exonic
1136261757 16:29082187-29082209 GCCTGCGGCCCGCGCCCGCCCGG + Intergenic
1137601973 16:49762410-49762432 GCCTGTGGCCAGCCCTTCGCAGG + Intronic
1139799849 16:69513688-69513710 GCCTGTCTCCCTCACCTGCCAGG + Intergenic
1141461678 16:84181649-84181671 CCCTGTAGCCCTCACCTGCCCGG - Exonic
1141983553 16:87565179-87565201 GCCCGTGGCTAGCACCTGCCCGG + Intergenic
1142050057 16:87951933-87951955 GCCTGTCGCTCCCGCCTGGCTGG - Intronic
1142292510 16:89199519-89199541 GCCTGTGGTCAGCACCAGGGAGG + Exonic
1142502218 17:339507-339529 GCCAGTGGCGGGCACCTGGCAGG - Intronic
1143110869 17:4552110-4552132 ACGCGTCGCCCGCACCTGGCTGG + Exonic
1145007157 17:19344400-19344422 GGCTGTGTGCCGCCCCTGGCAGG - Intronic
1145981051 17:29011811-29011833 TCCTGTGGGCTGCCCCTGGCAGG + Intronic
1146184697 17:30717250-30717272 GCTTCTGGCCCTCACCTTGCTGG - Intergenic
1146445218 17:32927906-32927928 GCCTGCGCCCCGCCCCGGGCTGG - Intronic
1146637425 17:34516861-34516883 CCCTGGGGCTGGCACCTGGCAGG - Intergenic
1146692041 17:34883389-34883411 GCCTGGGGGCCCCACCTGACAGG + Intergenic
1147590311 17:41678816-41678838 GCCTGTGCCCCTAACCTGGAAGG - Intergenic
1147816166 17:43212231-43212253 GCCTGGGGCCGGCAACCGGCCGG - Exonic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1151570771 17:74924326-74924348 GCCCGGGGCACCCACCTGGCTGG - Exonic
1151909543 17:77073008-77073030 GCGTGAGCCACGCACCTGGCTGG - Intergenic
1151967598 17:77439537-77439559 CCCTGTGGCCAGCAGCTTGCAGG + Intronic
1152554159 17:81044841-81044863 GCCTGTGGCCAGCACTGAGCTGG - Intronic
1152783550 17:82236886-82236908 GCCGGTGGGCCGCACGTGCCAGG + Intronic
1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG + Intergenic
1157452197 18:47797180-47797202 CCCTGTGGCCTGCTTCTGGCTGG + Intergenic
1157473745 18:48008477-48008499 GCCTCCTCCCCGCACCTGGCCGG + Intergenic
1157483949 18:48073763-48073785 TCCTGTGGCTGGCAGCTGGCAGG + Intronic
1160143621 18:76347422-76347444 CCCTGAGGCTCGCACCTGCCCGG + Intergenic
1160739456 19:679294-679316 GCATGTGGGCCGCACCTGGGCGG - Intronic
1160836190 19:1125720-1125742 GCCTGAGCCACGCACCCGGCGGG - Intronic
1160858431 19:1227608-1227630 GCCTGGCGCGGGCACCTGGCGGG - Exonic
1160922044 19:1525548-1525570 GCCTGTGCCCCGCTGCAGGCGGG + Intronic
1160950766 19:1666138-1666160 GCATGTGCCCTGCACCTGGCCGG + Intergenic
1161264893 19:3359609-3359631 GCCTGCGGCCCCCCCCTCGCCGG + Intronic
1161301010 19:3543327-3543349 GCCTGTGTACCACAGCTGGCCGG - Exonic
1162873066 19:13600329-13600351 CTCTGTGGCCGGCACCTGGGAGG - Intronic
1162974084 19:14198443-14198465 GCTTCTGGCCCCCACCTTGCTGG + Intronic
1163361279 19:16847668-16847690 GCCTGTGGCCTGAAGCTGCCAGG + Intronic
1164759635 19:30719400-30719422 CCCTGTGGGCTGCACCCGGCTGG + Intergenic
1164952192 19:32345894-32345916 GCTTGTGGCTAGCACCGGGCGGG - Intronic
1164989763 19:32675290-32675312 GCCTGAGCCCCGCCCCCGGCTGG - Intronic
1165825575 19:38703878-38703900 GCCTGCGACCCTCAACTGGCTGG - Intronic
1166765986 19:45252174-45252196 GCCTGTGGGCAGCCCCTGGCAGG + Intronic
1168064775 19:53912883-53912905 GCGTGTGGCCTGCTCCTGGTAGG + Exonic
925045995 2:773619-773641 GCCTGGCGCCCCCACCTAGCAGG + Intergenic
925328214 2:3039038-3039060 CCCTGTGGGCCTCACCTGGATGG - Intergenic
925411982 2:3645048-3645070 GCCTGTGACCCACAGCTGGTGGG - Intergenic
925751237 2:7091731-7091753 ACCTGTGGCCAGCTCCAGGCAGG - Intergenic
925918895 2:8625970-8625992 GCCCGTGCCACCCACCTGGCCGG + Intergenic
926384235 2:12320298-12320320 CCCTGTGACTGGCACCTGGCAGG + Intergenic
927255889 2:21040566-21040588 TGCTGTGGCCGGCACATGGCGGG - Intronic
928378510 2:30798638-30798660 GCCTGCGGCCCTCTCCTGGCTGG + Intronic
929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG + Intronic
932823957 2:74923594-74923616 GCTTGTGGCCAGGACCAGGCTGG - Intergenic
935332509 2:101987477-101987499 GCTTCTGGCTAGCACCTGGCAGG - Intergenic
936172316 2:110186655-110186677 TCCTTTGGCCCATACCTGGCAGG - Intronic
936509520 2:113133819-113133841 GCCTGTCTCCCCCACCGGGCTGG + Exonic
938365435 2:130729652-130729674 GGCAGTGGCCCTCATCTGGCTGG + Exonic
938408179 2:131044277-131044299 GGCTGAGGCCAGCATCTGGCAGG + Exonic
940396380 2:153196567-153196589 GCCTGAGTCCTGCACCTGGGAGG + Intergenic
942318109 2:174712973-174712995 GCCTGTGACAGGCTCCTGGCTGG - Intergenic
944584317 2:201160180-201160202 GCCTGTGGCTGGCATCAGGCAGG + Intronic
944801190 2:203239206-203239228 CCCTGCGGCCCGCAGCGGGCAGG - Intronic
946146723 2:217736689-217736711 CCATGTGTCCAGCACCTGGCCGG - Intronic
947605478 2:231483056-231483078 GTGTGCGGCCTGCACCTGGCGGG + Intronic
948197744 2:236107782-236107804 GCCTGGGGCCTGCACCTGCCGGG + Intronic
948437193 2:237961672-237961694 ACCTGGGGCCCTGACCTGGCAGG + Intergenic
948598916 2:239097059-239097081 GCCTGCGCCCCTCAGCTGGCCGG - Intronic
1171175536 20:23048969-23048991 GCCAGTGGCCTGCAGGTGGCTGG + Exonic
1173810636 20:45953092-45953114 GCCCTTGGCCAGCACCTGGGCGG - Intronic
1174116662 20:48230989-48231011 GCCTGTGGGCTGCACCTCCCAGG + Intergenic
1174454817 20:50641653-50641675 GCCTGTGGCCTGGAGGTGGCTGG - Intronic
1175887072 20:62298182-62298204 TCCTGTCGCCCACACCTTGCAGG + Intergenic
1175969325 20:62675853-62675875 CCCTGTGGCCGGCACCTTCCTGG - Intronic
1175978742 20:62726571-62726593 GCCTGTGGCCCCTGCCTGGGAGG + Intronic
1176111095 20:63411156-63411178 GCCTGTGCCGGGCACCTGGCAGG + Intronic
1176210820 20:63920429-63920451 GCCTGAGGCCCCCGCATGGCGGG - Intronic
1176230450 20:64030102-64030124 TGCTGTGCCCCACACCTGGCGGG - Intronic
1176553733 21:8243501-8243523 GACTGTGGCTCGCACCTCTCCGG + Intergenic
1176572655 21:8426525-8426547 GACTGTGGCTCGCACCTCTCCGG + Intergenic
1176580564 21:8471086-8471108 GACTGTGGCTCGCACCTCTCCGG + Intergenic
1176965636 21:15208763-15208785 GCCTGTGGTCCGTGCCTGGCTGG - Intergenic
1177012198 21:15743284-15743306 GGCTGTAACACGCACCTGGCTGG - Intronic
1178427894 21:32493473-32493495 GCCTGTGGCCAGCCCCTGCAGGG + Intronic
1178518179 21:33266267-33266289 GCCTGTGCCCCGCGCCTCGCGGG + Intronic
1179177903 21:39022033-39022055 GCTTCTGACCCACACCTGGCTGG + Intergenic
1180952911 22:19728796-19728818 CCATGTGGCCCCCACCTGTCTGG + Intergenic
1183840754 22:40498737-40498759 GCCTGTGGCCTGCTCCTGAGAGG - Intronic
1184159165 22:42687850-42687872 GGCTGGGGTCCTCACCTGGCCGG - Intergenic
1184466063 22:44669323-44669345 GCCTGTGGCCCCCACCGCTCTGG + Intronic
1203258737 22_KI270733v1_random:160533-160555 GACTGTGGCTCGCACCTCTCCGG + Intergenic
950127184 3:10517168-10517190 GGCTGTGGCCTGCACCGAGCTGG - Intronic
950505765 3:13393562-13393584 GCCAGTGGCCAGCAGCTGGCAGG - Intronic
951571113 3:24064282-24064304 GCCTTTGGCAGGCACCTGGTAGG - Intergenic
954693178 3:52406639-52406661 GCCTGTGGCCTGCTCCTGGGTGG - Intronic
955071770 3:55577709-55577731 ACCTGTGGCCACCACCTAGCAGG - Intronic
956743315 3:72291681-72291703 GCCTGGGGCCCTCAGCTGTCCGG + Intergenic
956798998 3:72739921-72739943 GCCTGTTCCCAGCAGCTGGCTGG - Intergenic
960375840 3:116900410-116900432 GCCTGAGTCCCTCTCCTGGCTGG - Intronic
960456047 3:117873460-117873482 GCCTGTGGCCTGCAGCAGGGTGG - Intergenic
961336807 3:126185273-126185295 GGCTGGTGCCAGCACCTGGCTGG + Intronic
961441570 3:126956534-126956556 GCCGGAGGACAGCACCTGGCTGG + Intronic
964571366 3:158110381-158110403 GCATGCGTCCCGCACCTGGGAGG + Intronic
966832761 3:184024362-184024384 GCATGTGGCCCGCAGCTGTCAGG + Intergenic
968300192 3:197607032-197607054 GACTGTGGCCCTCACCTGACAGG + Intergenic
968488652 4:877631-877653 GCGTGTGGCCAGCACCTCCCAGG - Exonic
968500742 4:948711-948733 GTCTGGGGCCCACACCTGCCTGG + Intronic
968506480 4:973443-973465 GCCCGGGGCCCGCGCCTGGCTGG - Exonic
968641530 4:1717348-1717370 GCCTGTGGCTGCCTCCTGGCAGG + Exonic
968685060 4:1952367-1952389 GCTTGTAGCCCACAGCTGGCAGG + Intronic
968841929 4:3013695-3013717 TCCTGTGGCTCGCACTTGACAGG - Exonic
969476603 4:7425771-7425793 GCCTGGGGTCCCCACCTCGCTGG + Intronic
969670576 4:8587899-8587921 GTCTGTGGTCAGGACCTGGCAGG + Intronic
972373647 4:38449947-38449969 GACTGGCGCCCACACCTGGCAGG + Intergenic
978795764 4:112706049-112706071 GCCTGCGGCCCGCGCCCGCCCGG - Intergenic
979962517 4:127037273-127037295 GACTGTGGCCAACACATGGCTGG - Intergenic
984572874 4:181414563-181414585 GACTATATCCCGCACCTGGCTGG - Intergenic
984839567 4:184055717-184055739 GCCTGTGAGCCTCTCCTGGCTGG + Intergenic
984973402 4:185209864-185209886 GCCTGCGGCCCGCGCGGGGCTGG - Intronic
985786324 5:1897128-1897150 CCCTGAGGCCCGCACAAGGCCGG - Intergenic
985915284 5:2913472-2913494 GTGTGTGGCCAGCACCTGTCAGG + Intergenic
990760791 5:59127340-59127362 GCCTCTGTCCAGCACCTGGGTGG + Intronic
993901259 5:93585242-93585264 GGCTCTGGCCCGAACCGGGCGGG - Exonic
996769736 5:127073510-127073532 GCCTGGGGCCGGCGCCTGGTGGG - Intergenic
997601195 5:135139762-135139784 GCCTGTGGCATGCTCCTGGGGGG + Intronic
997806668 5:136924658-136924680 GCCTCTGGCCCCTACCTGCCAGG + Intergenic
997953094 5:138257676-138257698 GCCTGTGGCCCCCAACTGCCTGG - Exonic
999188656 5:149730945-149730967 GCCTTTAGCCGGCAACTGGCAGG - Intronic
999950064 5:156639454-156639476 GCCTGTGCCACGCAGCAGGCTGG + Intronic
1001398594 5:171433514-171433536 TCCTGAGGCCCACACCTGGTGGG - Intronic
1002181563 5:177433543-177433565 ACCTGTGGCCCGCACCTGGCAGG - Exonic
1002182999 5:177441196-177441218 GCCTGTCCCCCACCCCTGGCTGG + Intronic
1002183515 5:177443310-177443332 GCCCGGGGCCCGTACATGGCTGG - Intergenic
1002523351 5:179803276-179803298 GCCTCTGGACAGCCCCTGGCGGG + Intronic
1002594999 5:180316326-180316348 GCCTGTGTCCCTTACCTGACTGG + Exonic
1002632507 5:180590979-180591001 CCCGGGGGCTCGCACCTGGCAGG - Intronic
1002966373 6:1970516-1970538 GCCTGCGGCCTGCTCCTGGTCGG - Intronic
1006063290 6:31441876-31441898 CCCTGTTCCCCGCACCTGGACGG + Intergenic
1006729411 6:36225180-36225202 GCCTGTGGCCTCCACTTGACTGG - Intronic
1006924875 6:37648742-37648764 GGGCGTGGCCCGCACCTGGAGGG + Intronic
1017726925 6:157282733-157282755 ACCTGTGGACCGCACCTTGGGGG + Intergenic
1018841920 6:167523580-167523602 GCCAGTTGCCAGCACATGGCCGG + Intergenic
1019326768 7:442333-442355 GCCTGTGGCAGGCAACAGGCTGG - Intergenic
1019522570 7:1467411-1467433 GCCTGCGGCGGGCACCTGGCAGG - Intergenic
1019567844 7:1693463-1693485 CCCTGCGGCACGCACCTGTCTGG - Exonic
1019665732 7:2251491-2251513 TCCTGTGGACGGGACCTGGCAGG - Intergenic
1019724448 7:2593414-2593436 GGATGTGGCCCACACCTGGGTGG - Intronic
1019786378 7:2980076-2980098 GCCCGTGGCCCCCAGCTGGGTGG - Intronic
1020099778 7:5388471-5388493 GCGTGTGGCCCGCACCGTGGGGG + Exonic
1023765944 7:43510884-43510906 TACTGTGGCCCACACTTGGCTGG + Intronic
1023990097 7:45123727-45123749 GCCTGTTGAGTGCACCTGGCTGG + Intergenic
1024627666 7:51222072-51222094 GCCTGAGGCTCCCAACTGGCTGG - Intronic
1029661701 7:101966688-101966710 GCAGGTGGCCCTCACCTGTCGGG - Intronic
1031406753 7:121396028-121396050 GCCCGGGGCCCGCCCCCGGCCGG + Intronic
1032078805 7:128848596-128848618 GCCGCTGGCCCGCACCTTGCTGG - Exonic
1032080149 7:128854626-128854648 GCCTCCGGCCCGCACCTTGTGGG - Exonic
1033552274 7:142458259-142458281 TCCTGTGCCCTGCACCTGGCAGG - Intergenic
1033554538 7:142477208-142477230 TCCTGTGCCCTGCACCTGGTGGG - Intergenic
1033556815 7:142495313-142495335 TCCTGTGCCCTGCACCTGGCAGG - Intergenic
1033559163 7:142514752-142514774 TCCTGTGCCCTACACCTGGCAGG - Intergenic
1033958268 7:146879642-146879664 GCCTGGGTCCAGAACCTGGCAGG + Intronic
1034400580 7:150858994-150859016 GCCTGGGGGCAGCACCTGGTCGG - Exonic
1034466700 7:151233979-151234001 CCCTGGGGCACCCACCTGGCAGG + Exonic
1034998043 7:155590802-155590824 GCCCGTGGCTCGCCTCTGGCGGG + Intergenic
1035727533 8:1834057-1834079 GCCTGGGGCACGCAGCTGTCTGG + Intronic
1036834442 8:12049268-12049290 CCCTGTTGCCCCCACCGGGCTGG + Intergenic
1036856285 8:12295832-12295854 CCCTGTTGCCCCCACCGGGCTGG + Intergenic
1038804338 8:30776618-30776640 TCCTGAGGGCCGCACCTCGCGGG - Intronic
1040280065 8:46036205-46036227 GACTGTGGCTCGCACCTCTCCGG - Intergenic
1047536548 8:125725340-125725362 TCCTGTGGGCTGCACCTGCCAGG - Intergenic
1049453536 8:142675441-142675463 GCCTGTGGGCCCCAGCTGGGTGG + Intronic
1049469782 8:142770158-142770180 GCCTGTGGCCGTCACCTGCCTGG - Intronic
1049725292 8:144142916-144142938 GCCTGGGGCAGGCAGCTGGCTGG + Intergenic
1050350972 9:4741095-4741117 GACTGAGGCCCGCACCGCGCGGG + Exonic
1050364859 9:4864542-4864564 GCATTTGGCCCGTACCTGTCAGG + Intronic
1052241456 9:26278167-26278189 AGCTCTGGCCAGCACCTGGCAGG + Intergenic
1052916767 9:33929078-33929100 TCCTTTGGCCCGCTCCTGGTGGG - Intronic
1053519744 9:38765549-38765571 GCGTGAGCCCCGCGCCTGGCCGG - Intergenic
1056501810 9:87217060-87217082 GCCAGTGGCTTGCTCCTGGCTGG + Intergenic
1057921992 9:99105168-99105190 GCCTGTGGCCCGGCCCGGCCCGG - Exonic
1058161906 9:101579181-101579203 ACCTGTGGCACTCACCTGGCTGG + Exonic
1059348899 9:113650675-113650697 GCCTGTGGGCCACCCCAGGCTGG - Intergenic
1059974296 9:119699266-119699288 GCCTGTGGGCCAGACCTGGCTGG - Intergenic
1060739426 9:126088539-126088561 CCCTGTGGCAGGCACTTGGCAGG - Intergenic
1061922353 9:133789036-133789058 GCCTGTGGCGGGCACCAGGCTGG - Intronic
1061962366 9:133994512-133994534 GCCTGGGTCCCAGACCTGGCTGG - Intergenic
1062444877 9:136589396-136589418 GTCTGAGGACCGGACCTGGCAGG + Intergenic
1062454077 9:136627570-136627592 GCCTGTGTCCTCCACCAGGCGGG - Intergenic
1062552914 9:137098299-137098321 GCCGAAGGCCCGCACCTGGGAGG - Intronic
1062579427 9:137222808-137222830 CCCTGAGGACCGCACCTGCCCGG + Intergenic
1203474927 Un_GL000220v1:142544-142566 GACTGTGGCTCGCACCTCTCCGG + Intergenic
1189350586 X:40272850-40272872 CCCTGTTTCCCGCACCTGGTGGG + Intergenic
1191656309 X:63602869-63602891 GATTGTATCCCGCACCTGGCTGG - Intergenic
1191723143 X:64251477-64251499 GCCTTTGACCCACACCTTGCTGG - Intergenic
1196883757 X:120223822-120223844 GCCCGTGTCCTGCACCTGGGAGG + Intergenic
1197759185 X:130015683-130015705 GCTTGTGGCCTGAAGCTGGCAGG + Exonic
1199991577 X:152990322-152990344 GCCTGTGGCCCCTCCCTGCCTGG + Exonic
1200147279 X:153932769-153932791 GCGTGTGCCCCACACCCGGCAGG - Intronic
1200150939 X:153951150-153951172 GACTGTGGCCCGGTACTGGCGGG + Intronic
1201627078 Y:16026381-16026403 GATTGTGTCCCGCACCTGGCTGG + Intergenic