ID: 1105542586

View in Genome Browser
Species Human (GRCh38)
Location 13:21327809-21327831
Sequence CACTGACACCCCAGGCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4418
Summary {0: 2, 1: 0, 2: 4, 3: 145, 4: 4267}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105542586_1105542597 30 Left 1105542586 13:21327809-21327831 CCCAGGAGCCTGGGGTGTCAGTG 0: 2
1: 0
2: 4
3: 145
4: 4267
Right 1105542597 13:21327862-21327884 GGGCTGAAGTGGTAAGAGGCTGG 0: 2
1: 0
2: 4
3: 69
4: 459
1105542586_1105542592 3 Left 1105542586 13:21327809-21327831 CCCAGGAGCCTGGGGTGTCAGTG 0: 2
1: 0
2: 4
3: 145
4: 4267
Right 1105542592 13:21327835-21327857 CGGTAGTGTCTTTGTAGTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 57
1105542586_1105542593 9 Left 1105542586 13:21327809-21327831 CCCAGGAGCCTGGGGTGTCAGTG 0: 2
1: 0
2: 4
3: 145
4: 4267
Right 1105542593 13:21327841-21327863 TGTCTTTGTAGTGGTGGCACAGG 0: 1
1: 1
2: 0
3: 13
4: 168
1105542586_1105542595 19 Left 1105542586 13:21327809-21327831 CCCAGGAGCCTGGGGTGTCAGTG 0: 2
1: 0
2: 4
3: 145
4: 4267
Right 1105542595 13:21327851-21327873 GTGGTGGCACAGGGCTGAAGTGG 0: 2
1: 0
2: 1
3: 56
4: 414
1105542586_1105542594 10 Left 1105542586 13:21327809-21327831 CCCAGGAGCCTGGGGTGTCAGTG 0: 2
1: 0
2: 4
3: 145
4: 4267
Right 1105542594 13:21327842-21327864 GTCTTTGTAGTGGTGGCACAGGG 0: 1
1: 1
2: 0
3: 9
4: 159
1105542586_1105542591 0 Left 1105542586 13:21327809-21327831 CCCAGGAGCCTGGGGTGTCAGTG 0: 2
1: 0
2: 4
3: 145
4: 4267
Right 1105542591 13:21327832-21327854 GTGCGGTAGTGTCTTTGTAGTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1105542586_1105542596 26 Left 1105542586 13:21327809-21327831 CCCAGGAGCCTGGGGTGTCAGTG 0: 2
1: 0
2: 4
3: 145
4: 4267
Right 1105542596 13:21327858-21327880 CACAGGGCTGAAGTGGTAAGAGG 0: 2
1: 0
2: 1
3: 17
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105542586 Original CRISPR CACTGACACCCCAGGCTCCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr