ID: 1105543886

View in Genome Browser
Species Human (GRCh38)
Location 13:21337969-21337991
Sequence ACAAGTCACTTAACTTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2991
Summary {0: 2, 1: 33, 2: 210, 3: 754, 4: 1992}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105543886_1105543891 15 Left 1105543886 13:21337969-21337991 CCCAGAGAAGTTAAGTGACTTGT 0: 2
1: 33
2: 210
3: 754
4: 1992
Right 1105543891 13:21338007-21338029 TGTGTAAGTAGAAGTATGAAGGG 0: 2
1: 0
2: 0
3: 23
4: 310
1105543886_1105543890 14 Left 1105543886 13:21337969-21337991 CCCAGAGAAGTTAAGTGACTTGT 0: 2
1: 33
2: 210
3: 754
4: 1992
Right 1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG 0: 2
1: 0
2: 0
3: 12
4: 156
1105543886_1105543892 23 Left 1105543886 13:21337969-21337991 CCCAGAGAAGTTAAGTGACTTGT 0: 2
1: 33
2: 210
3: 754
4: 1992
Right 1105543892 13:21338015-21338037 TAGAAGTATGAAGGGAATCCAGG 0: 2
1: 0
2: 1
3: 13
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105543886 Original CRISPR ACAAGTCACTTAACTTCTCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr