ID: 1105543887

View in Genome Browser
Species Human (GRCh38)
Location 13:21337970-21337992
Sequence GACAAGTCACTTAACTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2944
Summary {0: 1, 1: 29, 2: 186, 3: 772, 4: 1956}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105543887_1105543891 14 Left 1105543887 13:21337970-21337992 CCAGAGAAGTTAAGTGACTTGTC 0: 1
1: 29
2: 186
3: 772
4: 1956
Right 1105543891 13:21338007-21338029 TGTGTAAGTAGAAGTATGAAGGG 0: 2
1: 0
2: 0
3: 23
4: 310
1105543887_1105543892 22 Left 1105543887 13:21337970-21337992 CCAGAGAAGTTAAGTGACTTGTC 0: 1
1: 29
2: 186
3: 772
4: 1956
Right 1105543892 13:21338015-21338037 TAGAAGTATGAAGGGAATCCAGG 0: 2
1: 0
2: 1
3: 13
4: 202
1105543887_1105543890 13 Left 1105543887 13:21337970-21337992 CCAGAGAAGTTAAGTGACTTGTC 0: 1
1: 29
2: 186
3: 772
4: 1956
Right 1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG 0: 2
1: 0
2: 0
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105543887 Original CRISPR GACAAGTCACTTAACTTCTC TGG (reversed) Intergenic
Too many off-targets to display for this crispr