ID: 1105543889

View in Genome Browser
Species Human (GRCh38)
Location 13:21337992-21338014
Sequence CTTACACAGCTGTGTGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1195
Summary {0: 3, 1: 3, 2: 23, 3: 195, 4: 971}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105543889_1105543892 0 Left 1105543889 13:21337992-21338014 CCAAGGTCACACAGCTGTGTAAG 0: 3
1: 3
2: 23
3: 195
4: 971
Right 1105543892 13:21338015-21338037 TAGAAGTATGAAGGGAATCCAGG 0: 2
1: 0
2: 1
3: 13
4: 202
1105543889_1105543890 -9 Left 1105543889 13:21337992-21338014 CCAAGGTCACACAGCTGTGTAAG 0: 3
1: 3
2: 23
3: 195
4: 971
Right 1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG 0: 2
1: 0
2: 0
3: 12
4: 156
1105543889_1105543891 -8 Left 1105543889 13:21337992-21338014 CCAAGGTCACACAGCTGTGTAAG 0: 3
1: 3
2: 23
3: 195
4: 971
Right 1105543891 13:21338007-21338029 TGTGTAAGTAGAAGTATGAAGGG 0: 2
1: 0
2: 0
3: 23
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105543889 Original CRISPR CTTACACAGCTGTGTGACCT TGG (reversed) Intergenic
900227194 1:1538872-1538894 CTTCACTAGCTGTGTGACCTTGG + Intronic
900772472 1:4556160-4556182 ACTTCCCAGCTGTGTGACCTTGG - Intergenic
901347762 1:8561959-8561981 CTTACTAAGCTATGTGACTTTGG + Intronic
901759479 1:11461337-11461359 GTTCCAATGCTGTGTGACCTTGG + Intergenic
901781910 1:11599742-11599764 CATGAAGAGCTGTGTGACCTTGG - Intergenic
902116621 1:14126677-14126699 CCTTCAAAGCTGTGTGACATTGG - Intergenic
902219370 1:14955127-14955149 ATTACGTTGCTGTGTGACCTTGG - Intronic
902244828 1:15113966-15113988 ACTTCCCAGCTGTGTGACCTTGG - Intronic
902259202 1:15211613-15211635 CCTTCACAGCTGTGTGACCTCGG - Intronic
902340954 1:15783396-15783418 CAGAACCAGCTGTGTGACCTGGG + Intronic
902440841 1:16428937-16428959 CTTACCCAGCTGTGTGATGTTGG - Intronic
902509672 1:16959373-16959395 CTTAGGTGGCTGTGTGACCTTGG - Intronic
902645400 1:17794269-17794291 ATTTCCTAGCTGTGTGACCTTGG + Intronic
902699488 1:18161870-18161892 CTTGGAGGGCTGTGTGACCTTGG + Intronic
902761085 1:18581203-18581225 ATTAAACAGCTGTGTGACCTTGG - Intergenic
902775678 1:18673140-18673162 CACATATAGCTGTGTGACCTTGG + Intronic
902828822 1:18996455-18996477 CTTACCTCTCTGTGTGACCTAGG - Intergenic
902835185 1:19042760-19042782 CTTACTGAGCTGTGTGCTCTAGG + Intergenic
902943723 1:19818721-19818743 CTTTACCAGCTATGTGACCTTGG + Intergenic
902978767 1:20108523-20108545 ACTTCCCAGCTGTGTGACCTTGG - Intergenic
903004126 1:20287309-20287331 ATTTCCCAGCTGTGTGCCCTTGG - Intergenic
903022689 1:20405092-20405114 GCTTCTCAGCTGTGTGACCTAGG - Intergenic
903064269 1:20689962-20689984 CTTTACCAGCTGTGTGACCATGG + Intronic
903139319 1:21329487-21329509 CTGGCTTAGCTGTGTGACCTTGG + Intronic
903262586 1:22139418-22139440 CCTGCCCAGCTGAGTGACCTTGG - Intronic
903276927 1:22228333-22228355 CTTAACTTGCTGTGTGACCTTGG - Intergenic
903283276 1:22262417-22262439 CTCAGCCTGCTGTGTGACCTGGG - Intergenic
903303021 1:22392335-22392357 CTTTCCTGGCTGTGTGACCTGGG + Intergenic
903378209 1:22879604-22879626 CCTCGCCAGCTGTGTGACCTTGG + Intronic
903378801 1:22883093-22883115 CTTCACCAGCTATGTGACCTTGG + Intronic
903382142 1:22904856-22904878 CCTGCTCAGCTGTGTGACCTTGG - Intronic
903467768 1:23564199-23564221 CTTATCTAGCTATGTGACCTTGG - Intergenic
903757619 1:25673619-25673641 TTTACCCAGCTGTGTGTCTTTGG - Intronic
903930313 1:26858154-26858176 CTTTGCCAGCTGGGTGACCTTGG - Intergenic
903982201 1:27197286-27197308 CCTCAACAGCTCTGTGACCTTGG - Intergenic
904261917 1:29292405-29292427 CTTTCTTAGCTGTGTGACCTGGG + Intronic
904307529 1:29599768-29599790 TCTAAACAACTGTGTGACCTGGG + Intergenic
904400078 1:30250466-30250488 ATTCCCCAGCTGCGTGACCTCGG + Intergenic
904424593 1:30415318-30415340 CTTCCCCAGCTGAGTGAGCTTGG + Intergenic
904558108 1:31378712-31378734 ATACAACAGCTGTGTGACCTCGG + Intergenic
904746770 1:32716284-32716306 CTTTCCCAGCTCTGTGACTTAGG - Intergenic
904771166 1:32882227-32882249 GTAACGCTGCTGTGTGACCTGGG + Intergenic
904828883 1:33294304-33294326 ATTAACCAGCTGGGTGACCTTGG - Intronic
904926889 1:34056502-34056524 CTGGCTCAGCTGTGTGACCTTGG + Intronic
904975714 1:34454722-34454744 CACATACAGTTGTGTGACCTTGG - Intergenic
905092982 1:35444517-35444539 CATAATCAACTGTGTGACCTTGG - Intronic
905176620 1:36140113-36140135 CTTACATAGCTGGGTGACCAGGG + Exonic
905220466 1:36442884-36442906 CATCACCAGCTGTGTGACCTTGG - Intronic
905294492 1:36945795-36945817 ATTCATCAGCTGTGTGACCTTGG - Intronic
905304811 1:37010160-37010182 TCTAGCCAGCTGTGTGACCTTGG + Intronic
905397792 1:37678363-37678385 TTTAGCCAGCTGTGTGATCTTGG - Intergenic
905483312 1:38276420-38276442 CATCCCCAGGTGTGTGACCTGGG - Intergenic
905522483 1:38611032-38611054 ATTTCATATCTGTGTGACCTTGG + Intergenic
905867508 1:41384069-41384091 GTTTGCCAGCTGTGTGACCTCGG + Intergenic
906070242 1:43011114-43011136 CTTGCACCACAGTGTGACCTTGG + Intergenic
906199499 1:43949966-43949988 CGCACACAGCTGGGTGAGCTGGG - Exonic
906201100 1:43960931-43960953 CTCACACAGCTGTGGCACCATGG - Exonic
906475965 1:46169705-46169727 CTTGCTCAGCTGTCTGTCCTTGG - Intronic
906649498 1:47502823-47502845 CTCCCACTGCTGTGTGAACTTGG - Intergenic
906676335 1:47696285-47696307 CTTCCTTAGCTGTGTGACCATGG - Intergenic
906785479 1:48611693-48611715 CTTACTCAGCTGTGTGATCTTGG - Intronic
906856985 1:49318185-49318207 CTTACATAGCTATGTAATCTTGG + Intronic
906882309 1:49605119-49605141 ACTCCACAGCTTTGTGACCTTGG - Intronic
906971757 1:50522316-50522338 TTTACACAGTTGTATTACCTTGG + Intronic
907078920 1:51603561-51603583 ATAACCCAGCTGTGTGACTTAGG - Intronic
907251860 1:53144976-53144998 TTCAACCAGCTGTGTGACCTTGG + Intergenic
907273999 1:53306953-53306975 CTCTGACTGCTGTGTGACCTGGG - Intronic
907290869 1:53412103-53412125 ATTTCCCAGCCGTGTGACCTTGG + Intergenic
907321839 1:53607584-53607606 ATTTCACAGCTGCATGACCTTGG - Intronic
907332539 1:53680447-53680469 CTGACAGAGCTGTGTCACCATGG + Intronic
907443881 1:54495161-54495183 CTTCCACAGCTGTGTGACCTTGG + Intergenic
907458468 1:54591356-54591378 ACTACAGAGCTGTGTGACCTTGG - Intronic
907517197 1:55000298-55000320 CCTGACCAGCTGTGTGACCTTGG - Intronic
907721848 1:56979499-56979521 TTTTAAAAGCTGTGTGACCTTGG - Intergenic
907750896 1:57262243-57262265 CACAGAAAGCTGTGTGACCTTGG - Intronic
907791062 1:57664034-57664056 ACTTCACTGCTGTGTGACCTAGG + Intronic
907813478 1:57895347-57895369 ATTAACTAGCTGTGTGACCTTGG - Intronic
908188255 1:61673485-61673507 CTTAGTGTGCTGTGTGACCTTGG - Intergenic
908250837 1:62264449-62264471 CTGACTCAGCTGTGGGACCTTGG + Intronic
908329421 1:63056040-63056062 ATTTATCAGCTGTGTGACCTTGG + Intergenic
908437812 1:64123476-64123498 CTTAACTAGCTGTGTGATCTTGG + Intronic
908658699 1:66415436-66415458 ACTACTCAGCTGTATGACCTTGG - Intergenic
908861505 1:68495483-68495505 ATCACTTAGCTGTGTGACCTTGG - Intronic
909604931 1:77498513-77498535 CATGTACAGCTGTGTGACCTTGG + Intronic
909741909 1:79039298-79039320 TTTGCACAGGAGTGTGACCTTGG - Intergenic
909964573 1:81892177-81892199 CTTAAAGAGCTCTGTGACATTGG - Intronic
910100688 1:83572606-83572628 CGAATATAGCTGTGTGACCTTGG + Intergenic
910285319 1:85547237-85547259 CTTACACAGCCCTCTGACGTAGG - Intronic
910564492 1:88627916-88627938 GTTTCATAGCTGTGTGACCTAGG + Intergenic
910664448 1:89709430-89709452 CTCACTCAGCTGTGTGCACTTGG - Intronic
910874731 1:91867774-91867796 CTTACCCAGCTGTGTTACATTGG + Intronic
911055714 1:93706566-93706588 CTTACAAAGAGGTGTGCCCTGGG + Intronic
911127586 1:94354792-94354814 CTTAACTAGCTGTGTGACCTGGG - Intergenic
912384540 1:109264683-109264705 CTGGCTCTGCTGTGTGACCTGGG + Intronic
912489090 1:110051604-110051626 GTTAAGCAGCAGTGTGACCTGGG + Intronic
912496971 1:110098120-110098142 CTTACTCAGCTGTGTCCTCTCGG + Intergenic
912566290 1:110589860-110589882 GTTATTTAGCTGTGTGACCTTGG + Intergenic
912642220 1:111358168-111358190 CTTTTCCAGCTATGTGACCTTGG + Intergenic
912680158 1:111724001-111724023 ATTCCACTACTGTGTGACCTTGG + Exonic
912768627 1:112440739-112440761 CTTAATTAGCTTTGTGACCTTGG + Intronic
912838119 1:113014757-113014779 CTTACTTAGCTGTGCGGCCTTGG - Intergenic
913052227 1:115127705-115127727 ACTACTTAGCTGTGTGACCTTGG - Intergenic
913205988 1:116539306-116539328 CTTGGCCTGCTGTGTGACCTGGG + Intronic
913212647 1:116594597-116594619 CTAAGCCAGCTGTGTGACCTTGG - Intronic
913398093 1:118394939-118394961 CATACAAAGCTATGTGACTTTGG + Intergenic
914259511 1:145987169-145987191 TTTAACCAGCTATGTGACCTTGG - Intergenic
914354900 1:146876228-146876250 CTTCCCTAGTTGTGTGACCTTGG + Intergenic
914451127 1:147792582-147792604 CCCACAGAGCTGTGTGACTTTGG - Intergenic
914935527 1:151976080-151976102 CTTAAAAAGTTGTGTGGCCTTGG + Intergenic
915482551 1:156196975-156196997 ATTGACCAGCTGTGTGACCTTGG + Intronic
915532629 1:156511822-156511844 CATTTCCAGCTGTGTGACCTTGG + Intergenic
915730492 1:158050374-158050396 GTTGACCAGCTGTGTGACCTTGG - Intronic
915735927 1:158084972-158084994 CTGTGCCAGCTGTGTGACCTTGG - Intronic
915937240 1:160096694-160096716 CATGCCCAGCTGTGTGGCCTGGG + Intronic
915972735 1:160365815-160365837 CTCTGTCAGCTGTGTGACCTTGG - Intergenic
916082504 1:161243792-161243814 CTTTCACAGCTCTGTCACCCAGG + Intergenic
916184911 1:162121562-162121584 CCTTTACAGCTGTGTGACTTTGG + Intronic
916390426 1:164324791-164324813 AATAAACAGCTGTGTGACCTTGG + Intergenic
916527632 1:165626606-165626628 CTTATTTAGCTGTGTGACTTTGG - Intergenic
917174013 1:172211279-172211301 CTTAGACAGCTGAGTTACCTAGG - Intronic
917263299 1:173192758-173192780 ACTACTTAGCTGTGTGACCTTGG + Intronic
917600429 1:176568448-176568470 CTGCACCAGCTGTGTGACCTTGG - Intronic
917867047 1:179206059-179206081 CTTTCTTAGCTGTGTGACCTTGG - Intronic
918040310 1:180910283-180910305 CTTACCCAGCTGTGGATCCTGGG + Intergenic
918127602 1:181598037-181598059 CCTTAACAGCTGTATGACCTTGG - Intronic
918602385 1:186378694-186378716 CTTACCCAGCTTTGTCACTTTGG + Intronic
918878254 1:190079765-190079787 CTTAAACAGCTGTGTTCCATAGG - Intergenic
919686324 1:200486913-200486935 CTTTCCTAGATGTGTGACCTTGG - Intergenic
919705767 1:200673775-200673797 ACTACCTAGCTGTGTGACCTTGG - Intergenic
919766144 1:201128401-201128423 TTTTCCTAGCTGTGTGACCTTGG - Intergenic
920309186 1:205038558-205038580 CCTCCACTGCTCTGTGACCTTGG + Intergenic
920541718 1:206783788-206783810 CTTTCCCATCTGTGTGACCTTGG + Intergenic
920725533 1:208431281-208431303 GTGACTTAGCTGTGTGACCTAGG - Intergenic
921123933 1:212160308-212160330 TACACACAGCTGTGTGACCTTGG - Intergenic
921217383 1:212949744-212949766 TTTGCTCAGCTGTGTGACCCTGG - Intergenic
921391730 1:214622473-214622495 CTTTCCCAGCTGAGTGACGTTGG + Intronic
921899545 1:220435857-220435879 CCTCCATAGCTGTGTGACCTGGG - Intergenic
922884192 1:229005556-229005578 ATTTAACAGCTGTGTGATCTTGG - Intergenic
923177828 1:231485202-231485224 TTTAAACAGCAATGTGACCTTGG - Intergenic
923208094 1:231777883-231777905 CTTTTACGGCTGTGTGAACTTGG - Intronic
924424660 1:243940351-243940373 CTTTTCCAGCTGTGTGACCTTGG - Intergenic
924703592 1:246479292-246479314 CACTCACAGCTGTGTGACCTGGG + Intronic
924931127 1:248733295-248733317 CCTCCTCGGCTGTGTGACCTTGG + Intronic
1063628284 10:7711602-7711624 CTTGACCAGCAGTGTGACCTTGG + Intronic
1063855837 10:10252632-10252654 ATTTAACAGCTCTGTGACCTTGG - Intergenic
1065305839 10:24367873-24367895 ATTACCTAGCTGTGTGACCTTGG - Intronic
1065832471 10:29627400-29627422 AATAACCAGCTGTGTGACCTTGG - Intronic
1066061750 10:31730080-31730102 ACTAAATAGCTGTGTGACCTTGG - Intergenic
1066223273 10:33356982-33357004 GTTACACATCTTTGTGCCCTGGG + Intergenic
1066289436 10:34000234-34000256 CCCACAGAGCTGTGTGACCTTGG + Intergenic
1066349574 10:34624871-34624893 GTTCCCCAGCAGTGTGACCTGGG - Intronic
1067345929 10:45439307-45439329 GTGACACAGCTGTGTGCTCTGGG + Intronic
1067468980 10:46522776-46522798 CTTTGCCAGCTGTGTAACCTTGG - Intergenic
1068064850 10:52116886-52116908 ACTAATCAGCTGTGTGACCTAGG - Intronic
1069626649 10:69872095-69872117 CTCAACCAGCTGTGTGACCTTGG - Intronic
1069780454 10:70952186-70952208 CTTTCTCTGCTGTGTGAGCTCGG - Intergenic
1069780572 10:70952893-70952915 CTTAGCTAGCTGTGTGACCTTGG - Intergenic
1069807886 10:71137329-71137351 CCTCCACAGCTGTGTGACCTTGG - Intergenic
1070368325 10:75757552-75757574 GTTTGTCAGCTGTGTGACCTTGG + Intronic
1070556486 10:77531838-77531860 CTGACACAGCTGAGTGCCCGTGG - Intronic
1070658720 10:78289543-78289565 ATCCCACAGCTGTGTGACCTTGG - Intergenic
1070695509 10:78560437-78560459 ATTTCCCAGCTATGTGACCTTGG + Intergenic
1070718659 10:78741154-78741176 CCTGCCCAGCTATGTGACCTTGG + Intergenic
1070756721 10:78997924-78997946 CTCACTTGGCTGTGTGACCTTGG - Intergenic
1070789798 10:79182258-79182280 TCTAAACTGCTGTGTGACCTAGG - Intronic
1070790653 10:79187388-79187410 ACTGCCCAGCTGTGTGACCTTGG + Intronic
1070793199 10:79201904-79201926 CCTTCCCAGCTGTGTGACGTTGG + Intronic
1072030842 10:91520816-91520838 CCTTGACAGCTGTGTGACCTTGG - Intergenic
1072069077 10:91899238-91899260 ACTACCCAGCTCTGTGACCTTGG - Intergenic
1072079065 10:92010206-92010228 CTTAATTAGCTGAGTGACCTTGG - Intronic
1072305475 10:94102624-94102646 GATAACCAGCTGTGTGACCTTGG - Intronic
1072308114 10:94127818-94127840 GCTTCCCAGCTGTGTGACCTTGG - Intronic
1072538134 10:96378664-96378686 GTTCCCTAGCTGTGTGACCTTGG - Intronic
1073029348 10:100512903-100512925 CTAATAGAGCTGTGTGACTTGGG - Intronic
1073072163 10:100801552-100801574 ATTCCCCAGTTGTGTGACCTTGG + Intronic
1073344326 10:102770956-102770978 CACAGCCAGCTGTGTGACCTTGG + Intronic
1073360934 10:102898054-102898076 ATGAAACAGTTGTGTGACCTAGG + Intronic
1073507544 10:104012605-104012627 ACTACCCAGGTGTGTGACCTTGG - Intronic
1073760389 10:106622802-106622824 CTTTCCTAGCTGTATGACCTGGG - Intronic
1074258696 10:111830225-111830247 TTCCCACAGCTGTGTGACCTGGG - Intergenic
1074524313 10:114250971-114250993 GCTACATAGCTGTGTGACCTTGG - Intronic
1075009899 10:118858725-118858747 ACTTCACAGCTGTGTGAACTTGG - Intergenic
1075093872 10:119458544-119458566 CAGACACAGCTGTGAGGCCTGGG + Intronic
1075623206 10:123942997-123943019 GTTGTACAGCTGTGTAACCTAGG + Intergenic
1075674044 10:124283510-124283532 CCTAACCAGCTGTGTGACATTGG - Intergenic
1075877560 10:125820734-125820756 CTTACTGTGCTGTGTGACCTGGG - Intronic
1076036537 10:127202816-127202838 CCTTCCTAGCTGTGTGACCTTGG - Intronic
1076222923 10:128749091-128749113 CATTCCCTGCTGTGTGACCTAGG - Intergenic
1076290424 10:129341428-129341450 CGTAATTAGCTGTGTGACCTTGG - Intergenic
1077415486 11:2422568-2422590 CTTGACCTGCTGTGTGACCTGGG + Intronic
1077994952 11:7445131-7445153 CTCACACAGCTCTGTGAGGTAGG - Intronic
1078156595 11:8805117-8805139 CTGACCTTGCTGTGTGACCTTGG - Intronic
1078461008 11:11515386-11515408 CAGTCACAGGTGTGTGACCTAGG - Intronic
1078486076 11:11724654-11724676 CCTAATCAGCTGTGTGACCGAGG - Intergenic
1078667468 11:13338708-13338730 CCTTCTCAGCTGTGTGATCTTGG + Intronic
1078761218 11:14253455-14253477 CTGTTACAGCTGTGTGTCCTTGG - Intronic
1078858917 11:15229481-15229503 ATTTCCCAGCTATGTGACCTTGG + Intronic
1079091340 11:17482363-17482385 CCTGACCAGCTGTGTGACCTTGG + Intergenic
1079091707 11:17485295-17485317 CTTACTGGGCTGTGTGAGCTAGG - Intergenic
1079826235 11:25198817-25198839 CATACACAACTGTATGACTTTGG - Intergenic
1080262687 11:30366613-30366635 ATAACAAAGCTGTGTGACCTTGG - Intergenic
1080461278 11:32457018-32457040 CTTACACTGCTGTGTGTCCTTGG + Intergenic
1080465620 11:32494115-32494137 CTTCACCAGCTGTGTGACTTTGG - Intergenic
1080571292 11:33559423-33559445 CTTTATTAGCTGTGTGACCTCGG + Intronic
1080574142 11:33583172-33583194 CCTCCGCAGCTGTGTGACCTTGG - Intronic
1080574622 11:33586758-33586780 CTTACCCAGCTCTGTGAGCCTGG + Intronic
1080717989 11:34822785-34822807 CTTACCCAGCCATGTAACCTTGG + Intergenic
1080840742 11:35981310-35981332 GTTTCTCAGCTATGTGACCTTGG + Intronic
1080852328 11:36080533-36080555 ATTTTCCAGCTGTGTGACCTTGG + Intronic
1081444098 11:43113165-43113187 ATATCATAGCTGTGTGACCTTGG + Intergenic
1081571667 11:44295266-44295288 CCCACATAGCTGAGTGACCTTGG - Intronic
1081683913 11:45028007-45028029 GTTTCCCAGCTGTGTGACTTTGG - Intergenic
1081740350 11:45435263-45435285 CACTCCCAGCTGTGTGACCTTGG - Intergenic
1081747006 11:45480497-45480519 CTGACACAACTGAGTGGCCTTGG + Intergenic
1081754466 11:45534805-45534827 ACTACCCAGCTGTGTGATCTTGG - Intergenic
1082002030 11:47398527-47398549 CCTGCAAGGCTGTGTGACCTTGG - Intergenic
1082079548 11:48001489-48001511 CTTACTAAGCTGTGTGATCTTGG + Intronic
1083186969 11:61023255-61023277 ATTATTTAGCTGTGTGACCTTGG - Intergenic
1083196314 11:61090700-61090722 CTGACCCAACTGTGTGTCCTCGG - Intergenic
1083339070 11:61946915-61946937 CATTTATAGCTGTGTGACCTTGG + Intergenic
1083660588 11:64250262-64250284 CCTAAGAAGCTGTGTGACCTTGG + Intergenic
1084077557 11:66792846-66792868 CTTTCAAAGCTTTGTAACCTTGG - Intronic
1084199164 11:67543763-67543785 TTTACCCAGCTGTGTGACCTTGG + Intergenic
1084242125 11:67828952-67828974 CTTCCTCAGCTGGGTGACCATGG - Intergenic
1084447087 11:69209879-69209901 CTTTCCCAGCTGCGTGACCCTGG + Intergenic
1084607677 11:70181959-70181981 CTCACATGGCTGTGTGGCCTTGG - Intronic
1084728074 11:70954887-70954909 CTTTAGGAGCTGTGTGACCTGGG + Intronic
1084908945 11:72372121-72372143 ATTACCTAACTGTGTGACCTTGG - Intronic
1085011716 11:73145968-73145990 CTTCACTAGCTGTGTGACCTTGG - Intergenic
1085081134 11:73635103-73635125 CATCCACAGCTGTGTCTCCTTGG - Intergenic
1085274773 11:75291480-75291502 CTTATCCAGCTGGGTGACCATGG - Intronic
1085344641 11:75760403-75760425 CTTCCTAAGCTGTGTGACCTTGG + Intronic
1085521300 11:77140425-77140447 ACAAAACAGCTGTGTGACCTTGG + Intronic
1085786601 11:79457080-79457102 CCAACTTAGCTGTGTGACCTTGG + Intergenic
1085822336 11:79806120-79806142 CTTTAACAGCTGTGTGACTTTGG + Intergenic
1086364641 11:86096234-86096256 GTTACTTAGTTGTGTGACCTTGG + Intergenic
1086379948 11:86242210-86242232 CTTGAACAGCTGTGTGTCTTTGG + Intergenic
1086500204 11:87445065-87445087 CCTTGAGAGCTGTGTGACCTTGG - Intergenic
1086719663 11:90104701-90104723 CTTTTAAAGCTGTGTGTCCTGGG - Intergenic
1087176774 11:95103683-95103705 ATTTATCAGCTGTGTGACCTTGG + Intronic
1088497473 11:110445692-110445714 CTTTTTCAGCTTTGTGACCTTGG + Intronic
1088691957 11:112335926-112335948 TCTAAACAGCTATGTGACCTTGG + Intergenic
1088880193 11:113967473-113967495 CATACATAGCTGAGTGACCTTGG + Intergenic
1089380486 11:118027436-118027458 CATATACAGCTCTGTGAACTGGG - Intergenic
1089584929 11:119504271-119504293 ATTTTCCAGCTGTGTGACCTGGG + Intergenic
1089617656 11:119704101-119704123 TGCACCCAGCTGTGTGACCTTGG - Intronic
1089643037 11:119860144-119860166 ATTTCAAAGCTGTGTGACCTTGG - Intergenic
1089712549 11:120325817-120325839 CAGACACAACTCTGTGACCTTGG - Intronic
1090487429 11:127126606-127126628 ATTACACAGTTGTGTGATCTAGG - Intergenic
1091012138 11:132011688-132011710 CTCACTTAGCTGTGTGACCTAGG - Intronic
1091069118 11:132546651-132546673 ATTTCCCAGCTGTGTGACCTTGG + Intronic
1091140649 11:133231675-133231697 CTTCACCAGCTCTGTGACCTTGG + Intronic
1091615739 12:2050285-2050307 TTTACTCAGCTGGGTGACCCTGG + Intronic
1091888439 12:4033053-4033075 CTAACACAGGGGTGTGACCTTGG + Intergenic
1092146386 12:6217586-6217608 CCTGCACAGCTGTGCCACCTAGG - Intronic
1092295295 12:7192302-7192324 CTGACAAAGCTGTGTAACCTTGG - Intronic
1092443338 12:8528377-8528399 CAGACACAGCTTTTTGACCTTGG + Intergenic
1092527702 12:9319234-9319256 CTTAAAGTGCTGTGTGACCTTGG + Intergenic
1092539555 12:9412523-9412545 CTTAAAGGGCTGTGTGACCTTGG - Intergenic
1092751895 12:11726854-11726876 CTTACACTGCAGTGTGACAGTGG - Intronic
1092942319 12:13421399-13421421 CCTAAATAACTGTGTGACCTTGG - Intergenic
1093135485 12:15444783-15444805 CTTTCACAGCTCTGGGAGCTGGG - Intronic
1094004185 12:25729908-25729930 ATGACAAAGCTGTGTGGCCTTGG - Intergenic
1094040460 12:26115833-26115855 CTTACTGAGCTCTATGACCTTGG + Intergenic
1094066640 12:26368543-26368565 ATTTCCTAGCTGTGTGACCTTGG - Intronic
1094524744 12:31223981-31224003 CTTAAAGGGCTGTGTGACCTTGG + Intergenic
1095847959 12:46767495-46767517 TTTTTACAGCAGTGTGACCTTGG - Intronic
1096393376 12:51247110-51247132 CTTTACTAGCTGTGTGACCTTGG + Intronic
1096546099 12:52341275-52341297 CTGACACAGCTGTGATACCCAGG - Intergenic
1096626253 12:52897814-52897836 TATATATAGCTGTGTGACCTTGG + Intronic
1096818337 12:54215755-54215777 CTGTCCTAGCTGTGTGACCTCGG - Intergenic
1097155322 12:57007801-57007823 CTTGCACAACTGTGAGAGCTGGG - Intergenic
1097393367 12:59042794-59042816 ATTAACTAGCTGTGTGACCTTGG - Intergenic
1097812979 12:64038065-64038087 CTGTGCCAGCTGTGTGACCTTGG + Intronic
1097891719 12:64783301-64783323 CCTTACCAGCTGTGTGACCTTGG + Intronic
1098084794 12:66830750-66830772 ATTTAGCAGCTGTGTGACCTTGG - Intergenic
1098171586 12:67752476-67752498 GTCACACTCCTGTGTGACCTTGG + Intergenic
1098441621 12:70525185-70525207 ATTTCTTAGCTGTGTGACCTTGG - Intronic
1100003347 12:89864093-89864115 TTTACAAAGCTTTGTAACCTTGG - Intergenic
1100015309 12:90003198-90003220 CCCTCATAGCTGTGTGACCTTGG - Intergenic
1100208973 12:92381623-92381645 CTAACTCTGCTGTGTGACCCTGG + Intergenic
1100458695 12:94777290-94777312 CTTAATTAGCTGTGGGACCTTGG - Intergenic
1101001271 12:100360650-100360672 CATTTATAGCTGTGTGACCTTGG - Intronic
1101071945 12:101084864-101084886 ATCACCCAGCAGTGTGACCTTGG - Intronic
1101105374 12:101435285-101435307 CATGTACAGCTGTGTGCCCTTGG + Intergenic
1101214593 12:102567712-102567734 CCTTACCAGCTGTGTGACCTGGG - Intergenic
1101234998 12:102779665-102779687 CTTAACTAGCTATGTGACCTTGG + Intergenic
1101242310 12:102850642-102850664 ACTAACCAGCTGTGTGACCTGGG - Intronic
1101335757 12:103795187-103795209 ATTTACCAGCTGTGTGACCTTGG + Intronic
1101405089 12:104421500-104421522 GATTCACAGCTGTGTGACCCTGG + Intergenic
1101591733 12:106130956-106130978 CCTTGAGAGCTGTGTGACCTTGG - Intronic
1101652631 12:106691339-106691361 CCTAACCAACTGTGTGACCTTGG - Intronic
1101712914 12:107285234-107285256 CTTAGATAGCTGGGTGACCTTGG + Intergenic
1101730113 12:107419899-107419921 CAGACACAGCACTGTGACCTGGG + Intronic
1101748004 12:107558853-107558875 CTAACTTAGCTGTGTGACCTTGG - Intronic
1101819348 12:108171761-108171783 TCTAACCAGCTGTGTGACCTTGG + Intronic
1101822751 12:108196411-108196433 CTTGACAAGCTGTGTGACCTTGG - Intronic
1101825479 12:108217166-108217188 CTTACTTAGCTGTGTGCCATTGG - Intronic
1101831039 12:108256888-108256910 ATTTCCAAGCTGTGTGACCTTGG - Intergenic
1101831199 12:108258001-108258023 TAGACTCAGCTGTGTGACCTAGG + Intergenic
1101852115 12:108411686-108411708 ATTCACCAGCTGTGTGACCTTGG + Intergenic
1102036399 12:109772769-109772791 CATCCTCAGCTGTGTGACTTTGG - Intergenic
1102082540 12:110110013-110110035 AATTAACAGCTGTGTGACCTTGG + Intergenic
1102209766 12:111117799-111117821 CTTCCTCAGCTGTGTGATCTTGG - Intronic
1102219222 12:111183081-111183103 CATTCTTAGCTGTGTGACCTTGG - Intronic
1102224794 12:111220531-111220553 CTAAACCAGCTGTGTGGCCTTGG + Intronic
1102464010 12:113117419-113117441 CTCTAGCAGCTGTGTGACCTTGG - Intronic
1102510775 12:113413941-113413963 GCTACCCTGCTGTGTGACCTTGG + Intronic
1102511539 12:113418754-113418776 CTGCTACTGCTGTGTGACCTTGG + Intronic
1102557166 12:113734688-113734710 ATTTCCAAGCTGTGTGACCTTGG + Intergenic
1102594895 12:113984745-113984767 CTTCCCCAGCTGTGTGACCTTGG + Intergenic
1102624883 12:114226987-114227009 CCTTTCCAGCTGTGTGACCTTGG - Intergenic
1102673434 12:114639318-114639340 CTTAACTAGCTGTGTGACCTAGG + Intergenic
1102708162 12:114900771-114900793 CTTTAAGAGCTGTGTGACCTTGG + Intergenic
1102709057 12:114909254-114909276 GATCCACAGCTGTGTGCCCTTGG + Intergenic
1102780317 12:115558754-115558776 CTTAGAAAGCTGTGTGACGTTGG + Intergenic
1102808485 12:115803096-115803118 TTTACCGAGGTGTGTGACCTTGG - Intergenic
1102817419 12:115879118-115879140 CCTGCACAGCTGTGTGTCCTGGG + Intergenic
1102878106 12:116463575-116463597 CTACTCCAGCTGTGTGACCTTGG + Intergenic
1102894633 12:116588791-116588813 TCTAACCAGCTGTGTGACCTTGG + Intergenic
1103145315 12:118590368-118590390 CTTTCTCCTCTGTGTGACCTTGG + Intergenic
1103164701 12:118760498-118760520 CTATACCAGCTGTGTGACCTTGG + Intergenic
1103204065 12:119114474-119114496 CTTAACTAGCTGTGTGACCTTGG + Intronic
1103778296 12:123382809-123382831 ATTACATTGCTGGGTGACCTTGG + Intergenic
1103894258 12:124262585-124262607 TTTAGCCAGCTGTGTGGCCTTGG + Intronic
1103928331 12:124435850-124435872 ACTTCCCAGCTGTGTGACCTAGG + Intronic
1103941863 12:124505602-124505624 CTTCCACAGCTGTGTGACCTTGG + Intronic
1104065331 12:125300746-125300768 CTTTGCCAGCTGTGTGGCCTCGG - Intronic
1104225531 12:126829170-126829192 CTAACACCACTGTGTGTCCTTGG + Intergenic
1104421382 12:128638604-128638626 CTTTCCAAGCTGTGTGACCAGGG - Intronic
1104558599 12:129824090-129824112 CCTCCATAGCTGTGTGACCTTGG - Intronic
1104715561 12:131013788-131013810 CTTAATCAGCTGTGTGACCTTGG - Intronic
1104854639 12:131895995-131896017 CTTCCCCAGCTGTGAGACCGGGG + Intronic
1105215894 13:18285220-18285242 CTAAGCCAGCTGTGTGACCTTGG - Intergenic
1105543889 13:21337992-21338014 CTTACACAGCTGTGTGACCTTGG - Intergenic
1105755690 13:23461809-23461831 CACTCACAGCTGTGTGACTTGGG - Intergenic
1105905420 13:24805033-24805055 CTTTCAGAGCTGTGTGATCTTGG - Intronic
1105916789 13:24924186-24924208 CTTAAGTAGCTGTGTGATCTCGG - Intergenic
1106070118 13:26402652-26402674 CTCCCACAGCTGTCTGCCCTTGG - Intronic
1106232798 13:27834302-27834324 CACTTACAGCTGTGTGACCTTGG + Intergenic
1106522079 13:30506810-30506832 CCCACACAGCTGTGCAACCTGGG - Intronic
1106554359 13:30797459-30797481 GTCTCACAGCTGTGTGACCTCGG - Intergenic
1107025817 13:35800376-35800398 CTTACTCACCTGTGTGACCTTGG - Intronic
1107157380 13:37184956-37184978 CATACACAGCTGTGTGTCATGGG - Intergenic
1107687581 13:42919295-42919317 CTTACCCAGCTGTGATCCCTAGG + Exonic
1108094166 13:46882976-46882998 CCTTCTAAGCTGTGTGACCTTGG - Intronic
1108715563 13:53074897-53074919 CTTACAAAGCTGTGGGACTTCGG - Intergenic
1108718932 13:53110233-53110255 ATTCCCTAGCTGTGTGACCTTGG - Intergenic
1109734245 13:66460692-66460714 CTGACTCATCTGTGTGACCTTGG - Intronic
1109966407 13:69703790-69703812 CTTATATAGCTTTGTAACCTAGG + Intronic
1110822959 13:79937632-79937654 CTTAATCAACTGTGTGGCCTTGG - Intergenic
1111643727 13:91003566-91003588 CTTTCCCAGCTGTGTGACTTGGG + Intergenic
1111839637 13:93433954-93433976 GGTTCCCAGCTGTGTGACCTTGG + Intronic
1112865711 13:103894658-103894680 CTCAGACAGCTGAGTGACTTAGG - Intergenic
1114471571 14:22966675-22966697 ATTATCCAGCTGTGTGACCTTGG + Intronic
1115025387 14:28739216-28739238 ATTTACCAGCTGTGTGACCTTGG - Intergenic
1115462189 14:33673830-33673852 CCTCCTCAGTTGTGTGACCTTGG - Intronic
1115812499 14:37125137-37125159 CTAAAATAGCTGTGTGACCTCGG + Intronic
1116040191 14:39677115-39677137 CCTACTCAGCTATGTAACCTTGG - Intergenic
1116264411 14:42668279-42668301 CATGCACAGCTGTCTGCCCTGGG - Intergenic
1117699344 14:58397184-58397206 CCTACACGTCTGTGTGATCTGGG + Intronic
1118245930 14:64110730-64110752 ATCACAGAGCTGTGTGACCTTGG + Intronic
1118345312 14:64936137-64936159 CTTCCTAAGCTGTGTGTCCTTGG + Intronic
1118355317 14:65008837-65008859 CTTACACATCTATGTGTACTGGG - Intronic
1118596383 14:67438461-67438483 CCTAGCCAGCTATGTGACCTTGG + Intergenic
1118606811 14:67510302-67510324 CTCACTCACTTGTGTGACCTTGG - Intronic
1118746404 14:68776656-68776678 CTTAAGTAGCTGTGTGACCTTGG + Intergenic
1119033542 14:71211142-71211164 CTTTCCTAGCTGTGTGACCTTGG - Intergenic
1119535077 14:75396233-75396255 CTTAACTAACTGTGTGACCTTGG + Intergenic
1119540594 14:75435607-75435629 CCTCTCCAGCTGTGTGACCTTGG + Intronic
1119651634 14:76388054-76388076 CTTTGTCAGCTGTGTGACCTTGG - Intronic
1119779239 14:77267080-77267102 CTTCATCAGCTGGGTGACCTTGG + Intronic
1120196250 14:81486446-81486468 CTTAAACAACTGTGTGAGGTGGG + Exonic
1120545117 14:85801491-85801513 GTTTAACTGCTGTGTGACCTTGG - Intergenic
1120792720 14:88599849-88599871 CTTTGACAGTTGTGAGACCTCGG + Intronic
1120970305 14:90201568-90201590 GCTTCACAGCTGTGTGGCCTTGG + Intergenic
1121422062 14:93823392-93823414 CTTTCTCAGCTGTGTGACCTGGG - Intergenic
1121538431 14:94707248-94707270 GATAAAAAGCTGTGTGACCTCGG + Intergenic
1121574487 14:94972397-94972419 CCTTCCCAGCTGTGTGATCTTGG + Intergenic
1121618435 14:95329862-95329884 CTCACCCTGCTGTGTGACCTTGG - Intergenic
1121636571 14:95457839-95457861 CTTTCCTAGCTGGGTGACCTTGG - Intronic
1121734963 14:96211728-96211750 CCTCCCCTGCTGTGTGACCTAGG + Intronic
1121790528 14:96696309-96696331 CTCTGACAACTGTGTGACCTTGG - Intergenic
1121879196 14:97484904-97484926 CTCAAAAAGCTGTGTGACCCTGG - Intergenic
1122043773 14:99008934-99008956 ACTTCACAGCTATGTGACCTCGG - Intergenic
1122138198 14:99646433-99646455 CTTCCCCAGCTTCGTGACCTGGG + Intronic
1122925593 14:104898061-104898083 CTTCCACAGCCGTGGGCCCTGGG - Intergenic
1124680992 15:31730689-31730711 ATTTCTCAACTGTGTGACCTTGG + Intronic
1124719042 15:32095948-32095970 TGTACTTAGCTGTGTGACCTAGG + Intronic
1124722215 15:32120175-32120197 CAGACCCAGCTGAGTGACCTCGG - Intronic
1125254902 15:37752390-37752412 CTTCCATACCTGTTTGACCTCGG + Intergenic
1125335875 15:38625769-38625791 CTTAACCAGCTGGTTGACCTTGG + Intergenic
1125410782 15:39404007-39404029 CTTAGGCAGCTGTGTGACCTTGG + Intergenic
1125598273 15:40901181-40901203 CTTACTAAGCTGTGTGACCTTGG + Intronic
1126170281 15:45689880-45689902 CATACATAGCTGTGTGTCCCAGG + Intronic
1126314577 15:47356586-47356608 CTTACAAAGGTGTGTGTCATAGG + Intronic
1126545235 15:49865787-49865809 CTTAACAAGCTGTGTGACTTTGG - Intronic
1126646411 15:50879398-50879420 CTTTATTAGCTGTGTGACCTTGG - Intergenic
1126932506 15:53670618-53670640 CTTTGATAGCTGTGTGGCCTTGG + Intronic
1127345662 15:58095274-58095296 CTTACTTACATGTGTGACCTTGG - Intronic
1127386808 15:58473747-58473769 CCTTCCCAGCTGTGTAACCTTGG - Intronic
1127689387 15:61379916-61379938 CTCCATCAGCTGTGTGACCTTGG - Intergenic
1127861139 15:62995068-62995090 ATTGCACTGCTCTGTGACCTTGG - Intergenic
1127960817 15:63888981-63889003 TCTCCCCAGCTGTGTGACCTGGG + Intergenic
1128027872 15:64453930-64453952 ATTAACTAGCTGTGTGACCTAGG - Intronic
1128158430 15:65407113-65407135 AGTACTAAGCTGTGTGACCTGGG + Intronic
1128185936 15:65643547-65643569 AGTCCACAGCTGTGTGGCCTGGG - Intronic
1128192787 15:65719587-65719609 CTGTCAAAGATGTGTGACCTGGG + Intronic
1128232786 15:66047308-66047330 GTTTCCTAGCTGTGTGACCTGGG + Intronic
1128349477 15:66879591-66879613 ATTACCCTGCTGTGTGACTTTGG + Intergenic
1128361172 15:66962691-66962713 CTTTACTAGCTGTGTGACCTTGG + Intergenic
1128389988 15:67176248-67176270 GTTTCACAGCCGTGTGAGCTGGG + Intronic
1128390357 15:67178571-67178593 CTGATCCTGCTGTGTGACCTTGG - Intronic
1128474057 15:67981994-67982016 TCTACCCAGCTGTGTGACCTTGG + Intergenic
1128679267 15:69636040-69636062 ACTAAAAAGCTGTGTGACCTTGG - Intergenic
1128776686 15:70325715-70325737 ATAAACCAGCTGTGTGACCTTGG - Intergenic
1128780124 15:70353762-70353784 CTTCCACTGCTGGGGGACCTTGG + Intergenic
1129580674 15:76806123-76806145 CATATACATCTTTGTGACCTTGG - Intronic
1129709202 15:77811610-77811632 CCTTCACTGCTATGTGACCTTGG + Intronic
1129713384 15:77832980-77833002 CCTTCTCAGCTGTGTGACCTTGG - Intergenic
1129844524 15:78762155-78762177 CATAGGCAGCTGTCTGACCTTGG - Intronic
1129887445 15:79048422-79048444 AATACTTAGCTGTGTGACCTTGG + Intronic
1129918944 15:79302117-79302139 ACTTCCCAGCTGTGTGACCTTGG - Intergenic
1130078888 15:80713834-80713856 GGTACACAGCTGTATGGCCTGGG + Intronic
1130093504 15:80839970-80839992 CTTTCCCAGCTGGGTGGCCTTGG - Intronic
1130113767 15:80988792-80988814 CTTGCATAGCTGTGGAACCTTGG - Intronic
1130764890 15:86859864-86859886 GTTTATCAGCTGTGTGACCTTGG + Intronic
1131049329 15:89335800-89335822 CCTAATCAGCTGTGTGATCTCGG - Intergenic
1131529340 15:93178860-93178882 CCTAACCAGCTGTGTGACATAGG - Intergenic
1131607716 15:93926440-93926462 ATAAGACACCTGTGTGACCTTGG + Intergenic
1133229965 16:4361744-4361766 CTTACACAGCTGTGTGACCCGGG + Intronic
1133353637 16:5119887-5119909 CTTCCTCAGCTGGGTGACCGTGG - Intergenic
1133401307 16:5489478-5489500 CCTTCCCAGCTGTCTGACCTTGG + Intergenic
1133416385 16:5610417-5610439 CTTTCCTAGCTGTGTGACCTTGG - Intergenic
1133471310 16:6078551-6078573 TCTACCTAGCTGTGTGACCTTGG + Intronic
1133844889 16:9444507-9444529 CTTTACCAGCTGTGTGACCTAGG - Intergenic
1133854553 16:9537323-9537345 CTCATCCAGCTGTGTGACCTTGG - Intergenic
1134094873 16:11412664-11412686 TTTTTATAGCTGTGTGACCTTGG + Intronic
1134104052 16:11472584-11472606 ACTTCCCAGCTGTGTGACCTTGG + Intronic
1134324389 16:13193741-13193763 CCTACACAGTTGTGTGGACTGGG - Intronic
1134368321 16:13600004-13600026 GTTTCACAGCTGTGTAACTTTGG + Intergenic
1134368540 16:13602190-13602212 CTTACAGAACTGAGTGACTTTGG - Intergenic
1134796389 16:17040903-17040925 CTTTCCTAGCTGTGTGACCTTGG - Intergenic
1134824929 16:17276793-17276815 ACTTCCCAGCTGTGTGACCTAGG + Intronic
1134830705 16:17320451-17320473 TTTCCTTAGCTGTGTGACCTTGG + Intronic
1134860299 16:17554744-17554766 ATTCATCAGCTGTGTGACCTGGG + Intergenic
1134868164 16:17627594-17627616 CGAACTGAGCTGTGTGACCTGGG - Intergenic
1134873083 16:17669407-17669429 CTTTACCAGCTGTGTGATCTTGG - Intergenic
1134906558 16:17984468-17984490 GCTTCCCAGCTGTGTGACCTTGG - Intergenic
1135051281 16:19195034-19195056 ATTTCCCAGCTGTGTGAACTTGG + Intronic
1135132353 16:19863428-19863450 CCTTACCAGCTGTGTGACCTTGG - Intronic
1135343086 16:21665281-21665303 CATGCATAGCTGTGTGACCTTGG + Intergenic
1135458909 16:22624055-22624077 CTGATAAAGCTGTGTGACCTTGG - Intergenic
1135586352 16:23674575-23674597 CTTACTAAGCTGTGTGTGCTGGG - Exonic
1135893976 16:26381802-26381824 ACTACAGAACTGTGTGACCTTGG - Intergenic
1136069722 16:27780664-27780686 CTTCCAAAGCTGTGTGTCCCAGG - Intergenic
1136399039 16:30007858-30007880 CTGAGCCACCTGTGTGACCTTGG + Intronic
1136556114 16:31008771-31008793 CTTTACCAGCTGTGTGACTTTGG + Intronic
1136611926 16:31371634-31371656 CCTCCAAAGCTCTGTGACCTTGG + Exonic
1137423880 16:48360142-48360164 ACTAACCAGCTGTGTGACCTTGG - Intronic
1137433242 16:48435171-48435193 CCCAGGCAGCTGTGTGACCTTGG + Intronic
1137539964 16:49355471-49355493 CTCTCACTGCTGTGTGACCTTGG - Intergenic
1137713232 16:50581787-50581809 CTTACAGAGGAGTGGGACCTGGG + Intronic
1137720508 16:50625019-50625041 CCTCCACAGCTGTGTGACCCTGG - Intronic
1137819730 16:51432574-51432596 ACTAAACAGCTGTGTGACCTTGG - Intergenic
1138086244 16:54136226-54136248 CTCACTAAGCTGTTTGACCTTGG - Intergenic
1138086862 16:54141344-54141366 ACTCCCCAGCTGTGTGACCTTGG + Intergenic
1138205528 16:55121695-55121717 CTTGTTGAGCTGTGTGACCTTGG - Intergenic
1138222494 16:55264833-55264855 CTTAACTGGCTGTGTGACCTCGG - Intergenic
1138226511 16:55300295-55300317 CTTATCAAGCTGTGTGACTTTGG + Intergenic
1138255951 16:55560716-55560738 ATTAACCAGCTGTGTGGCCTTGG - Intronic
1138458924 16:57136599-57136621 CTTTCTTAGCTGTGGGACCTGGG - Intronic
1138497089 16:57415425-57415447 CCTGACCAGCTGTGTGACCTGGG - Intronic
1138600046 16:58048800-58048822 ATTTCCTAGCTGTGTGACCTTGG - Intergenic
1138631102 16:58294819-58294841 GCTTGACAGCTGTGTGACCTTGG - Intronic
1139120982 16:64016759-64016781 CATTAGCAGCTGTGTGACCTGGG - Intergenic
1139244329 16:65426792-65426814 CTTCCCTAGCTGTGTGACCTTGG - Intergenic
1139339523 16:66259012-66259034 ACTTCCCAGCTGTGTGACCTGGG - Intergenic
1139568063 16:67792221-67792243 ATTACAGAGATGAGTGACCTGGG + Intronic
1139693933 16:68659169-68659191 CTTACTTAGCTGTGTGATCTTGG - Intronic
1140231950 16:73124628-73124650 CTAATACAGATGTGTGACCCTGG - Intergenic
1140873491 16:79128508-79128530 CCTTAATAGCTGTGTGACCTTGG - Intronic
1141094137 16:81150723-81150745 TCTTCCCAGCTGTGTGACCTCGG + Intergenic
1141365308 16:83437196-83437218 ATTTATCAGCTGTGTGACCTTGG + Intronic
1141525858 16:84611133-84611155 CTTGCTGTGCTGTGTGACCTTGG - Intronic
1141665793 16:85464521-85464543 CCTCACCAGCTGTGTGACCTTGG + Intergenic
1141670168 16:85487579-85487601 CGTTCTCAGCTGTGTGACCTGGG - Intergenic
1141690259 16:85592743-85592765 CTTTACAAGCTGTGTGACCTTGG + Intergenic
1141799851 16:86299446-86299468 CTTTGTCAGCTGTGTGACTTGGG + Intergenic
1141918635 16:87119836-87119858 ATGACAGAGCCGTGTGACCTTGG + Intronic
1141972637 16:87493440-87493462 ACTGCAAAGCTGTGTGACCTTGG + Intergenic
1142618544 17:1151060-1151082 CCTTACCAGCTGTGTGACCTTGG + Intronic
1143049508 17:4112604-4112626 CTTACAGAGCTGACTGACGTTGG + Exonic
1143101610 17:4507594-4507616 CTTTCTCTGCTGTGTGACCTTGG - Intronic
1143159831 17:4862246-4862268 CTGAAATAGCTGTTTGACCTTGG + Intronic
1143262641 17:5611511-5611533 CTCACATAGCTGTGTGACCTTGG - Intronic
1143269832 17:5667359-5667381 CTTAGGGAGCTGTGTGACTTGGG + Intergenic
1143530902 17:7502841-7502863 CTGAAACAGCTGTGTGACATGGG + Intronic
1143777233 17:9207543-9207565 CTTACAAAGCTGTGTGTCCTTGG - Intronic
1144157255 17:12517903-12517925 ATAACACAGCCGGGTGACCTTGG + Intergenic
1144424773 17:15131666-15131688 CTTCCGCAGCTGAGTGACCCTGG - Intergenic
1144833082 17:18142565-18142587 CTTAATATGCTGTGTGACCTTGG + Intronic
1144890886 17:18493657-18493679 TGTGGACAGCTGTGTGACCTCGG + Intronic
1145043751 17:19596122-19596144 GTTCCCCAACTGTGTGACCTGGG + Intergenic
1145141337 17:20450661-20450683 TGTGGACAGCTGTGTGACCTCGG - Intronic
1145348554 17:22057474-22057496 CATTTCCAGCTGTGTGACCTTGG - Intergenic
1145794578 17:27648267-27648289 TGTAGACAGCTGTGTGACCTCGG + Intronic
1145820334 17:27828916-27828938 TTTCCACCACTGTGTGACCTTGG + Intronic
1145946921 17:28783445-28783467 ATTTACCAGCTGTGTGACCTTGG + Intronic
1145979416 17:29003005-29003027 CCTCCATGGCTGTGTGACCTTGG - Intronic
1146459910 17:33038084-33038106 ATGAGACAGCTGTGTGACTTTGG + Intronic
1146652922 17:34617673-34617695 CTGACATAGCTGTGTGTCCTTGG - Intronic
1146922815 17:36724736-36724758 CGCATCCAGCTGTGTGACCTTGG + Intergenic
1146979135 17:37143124-37143146 CCTACTTAGTTGTGTGACCTCGG - Intronic
1147183401 17:38701136-38701158 CCTAACCAGCAGTGTGACCTTGG - Intergenic
1147242503 17:39099673-39099695 CTTTCATAGCTGTGTGACCAAGG + Intronic
1147327601 17:39677072-39677094 CCTACGCAGCTGTGTGACCTTGG + Intronic
1147767019 17:42844019-42844041 GTTACACAGCTGAGGGAACTGGG + Intergenic
1147983073 17:44286962-44286984 ATTCACCAGCTGTGTGACCTTGG + Intergenic
1148215393 17:45831205-45831227 TTCAAATAGCTGTGTGACCTTGG + Intronic
1148431722 17:47649078-47649100 ACTAACCAGCTGTGTGACCTTGG + Intergenic
1148431736 17:47649150-47649172 ATTAACCAGCTGTGTGACCTTGG + Intergenic
1148859872 17:50599246-50599268 CCCAACCAGCTGTGTGACCTGGG - Intronic
1149418492 17:56485309-56485331 TTTATACAGCTGGGTGATCTGGG + Intronic
1149601159 17:57893740-57893762 CATGCGCTGCTGTGTGACCTTGG + Intronic
1150836982 17:68573211-68573233 CACTCACAGCTGTGTGACCTAGG + Intronic
1150954929 17:69847382-69847404 CTGTAACAGCTGTGTGAACTTGG - Intergenic
1151342366 17:73480184-73480206 GGTACTTAGCTGTGTGACCTGGG - Intronic
1151826009 17:76524788-76524810 CTCTCACTGCTATGTGACCTTGG - Intergenic
1151893940 17:76967691-76967713 CCCACCTAGCTGTGTGACCTTGG - Intergenic
1151943145 17:77305263-77305285 ATTCCGCAGCTGTGCGACCTTGG + Intronic
1152313285 17:79564093-79564115 TTTCCTTAGCTGTGTGACCTTGG - Intergenic
1153833518 18:8943929-8943951 CTTAGCAAGCTGTGTGAACTTGG + Intergenic
1153905224 18:9655098-9655120 CTTACACAGATGTCTGATCACGG - Intergenic
1154327632 18:13403526-13403548 CCCACAACGCTGTGTGACCTTGG + Intronic
1155103144 18:22633658-22633680 ATTTAAGAGCTGTGTGACCTTGG + Intergenic
1155131076 18:22934826-22934848 ATGTCCCAGCTGTGTGACCTTGG + Intronic
1155280903 18:24238635-24238657 ACTAGCCAGCTGTGTGACCTGGG - Intronic
1155440288 18:25855126-25855148 TTTACAATGCTGTGTGACCTTGG + Intergenic
1155566217 18:27137583-27137605 CTCACACAGCTGTGGGCTCTGGG + Intronic
1155790163 18:29957236-29957258 ATTTCCCAGCTATGTGACCTTGG - Intergenic
1155869712 18:31011056-31011078 TTTCCACAGCTGTGTGATCTTGG - Intronic
1156602439 18:38625268-38625290 CTTTACCAGCTGGGTGACCTTGG + Intergenic
1157149226 18:45198652-45198674 CTTACACAGCTTTGTAAGTTAGG + Intergenic
1157451163 18:47790222-47790244 CACCCACAGCTGTGTGGCCTTGG - Intergenic
1157480555 18:48050991-48051013 CTTACACAGTTCTGTGACCTTGG - Intronic
1157531913 18:48428587-48428609 CTAACACAGCTGGGTGATCAGGG - Intergenic
1157710466 18:49846635-49846657 GCTTCCCAGCTGTGTGACCTGGG + Intronic
1158260030 18:55596346-55596368 CATATGCAGCTGTGTAACCTTGG + Intronic
1158272416 18:55731096-55731118 CGTACTTGGCTGTGTGACCTTGG - Intergenic
1158786415 18:60718180-60718202 CTCATACAGCTGTGTAATCTAGG - Intergenic
1159034805 18:63266727-63266749 CCCACAAGGCTGTGTGACCTTGG + Intronic
1159193376 18:65078921-65078943 CTTAAAGAGTTGTGTGACTTTGG + Intergenic
1159200484 18:65177498-65177520 CTTCCATATATGTGTGACCTTGG - Intergenic
1159242146 18:65755236-65755258 AGTACCTAGCTGTGTGACCTTGG + Intronic
1160350731 18:78176143-78176165 CTTACACAAATGTCTGACTTGGG - Intergenic
1160584338 18:79904258-79904280 CTTAGACAGCGGGGAGACCTGGG + Intronic
1161075883 19:2285553-2285575 CTTCCATTGCTGTGTGGCCTGGG - Intronic
1161168103 19:2799446-2799468 CATCCAAAGCTGGGTGACCTCGG - Intronic
1161497601 19:4596181-4596203 CTTGCCCGGCTGTGTGGCCTTGG - Intergenic
1161637321 19:5396983-5397005 CTCACATTGCTGAGTGACCTTGG - Intergenic
1161640829 19:5421741-5421763 CACACACAGCTGTGTGACCCTGG - Intergenic
1161810201 19:6467046-6467068 CCTTCATTGCTGTGTGACCTTGG + Exonic
1161867443 19:6843590-6843612 CTTACCTAGCTGTATGACCTTGG + Intronic
1162003409 19:7762635-7762657 ATTTACCAGCTGTGTGACCTTGG + Intergenic
1162015731 19:7845606-7845628 CTCAACCAGCTGTGTGACCTTGG - Intronic
1162068532 19:8140059-8140081 CTTTTGCAGCTGTGTGACTTTGG - Intronic
1162179518 19:8858427-8858449 ATGACTTAGCTGTGTGACCTTGG + Intronic
1162852432 19:13441185-13441207 GTTTCCAAGCTGTGTGACCTTGG - Intronic
1162956858 19:14103544-14103566 ATCAGCCAGCTGTGTGACCTTGG - Intronic
1163262574 19:16199967-16199989 GCTGCTCAGCTGTGTGACCTGGG + Intronic
1163522191 19:17797987-17798009 CTCAGTCGGCTGTGTGACCTTGG + Intronic
1164465196 19:28481883-28481905 TTGACTCAGCTGTGTGGCCTTGG - Intergenic
1165151422 19:33762822-33762844 CACCCACTGCTGTGTGACCTTGG - Intronic
1165842926 19:38799656-38799678 TGCACAGAGCTGTGTGACCTAGG + Intergenic
1165886614 19:39083807-39083829 CTTTCTGAGCTGTGCGACCTAGG - Intergenic
1165889039 19:39099637-39099659 ACTAGCCAGCTGTGTGACCTGGG + Intronic
1165996106 19:39845443-39845465 CTTAGCCTGCTGTGTGAACTTGG - Intronic
1166289579 19:41853883-41853905 CCTTCTCAGCTCTGTGACCTTGG - Intergenic
1166766355 19:45253835-45253857 CCTCCCTAGCTGTGTGACCTCGG + Intronic
1166972704 19:46580469-46580491 ACTTCCCAGCTGTGTGACCTGGG - Intronic
1166985392 19:46657224-46657246 GCTCCCCAGCTGTGTGACCTTGG + Intronic
1167062545 19:47158796-47158818 CTTCCACAGCTGTGTGGCCTTGG - Intronic
1167267257 19:48489759-48489781 ATTTCTTAGCTGTGTGACCTGGG - Intronic
1167386183 19:49165624-49165646 CTGACGCGGCTGTGTGACTTTGG - Intronic
1167595730 19:50427167-50427189 ATTTTACAGCAGTGTGACCTTGG - Intronic
1167639293 19:50671816-50671838 CCTTCCCAGCTGTGTGAACTGGG - Intronic
1167738137 19:51310154-51310176 CTGACTTGGCTGTGTGACCTTGG - Intergenic
1168073427 19:53965094-53965116 CTTTCTCAGCTAGGTGACCTTGG - Intronic
1168275996 19:55279132-55279154 CATTTCCAGCTGTGTGACCTTGG - Intronic
1168413669 19:56155682-56155704 CTGAACCAGCTGTGTCACCTCGG - Intronic
1168527756 19:57102395-57102417 CTCACACAGCTGTGTCTCCATGG - Intergenic
925021745 2:575189-575211 CTTCCACAGCTGTGAGACCCGGG + Intergenic
925447956 2:3943604-3943626 CTAACACTGCTGTGTGTCTTTGG - Intergenic
926168440 2:10536007-10536029 TCTTCCCAGCTGTGTGACCTTGG - Intergenic
926842051 2:17091772-17091794 CCCACCCAGCTGTGTGACCTTGG - Intergenic
926886871 2:17606086-17606108 GTTTCAATGCTGTGTGACCTTGG - Intronic
927136523 2:20100580-20100602 ACTAACCAGCTGTGTGACCTTGG + Intergenic
927186657 2:20487053-20487075 CTCACTCTGATGTGTGACCTGGG - Intergenic
927429176 2:23012472-23012494 CGTATAAAGCTGTGTGGCCTTGG + Intergenic
927810814 2:26179371-26179393 ACTAGCCAGCTGTGTGACCTTGG - Intronic
929080529 2:38117725-38117747 CTAACCCAACTGTGTGACCTTGG - Intergenic
929243807 2:39680112-39680134 CTTAACTAGCTATGTGACCTTGG + Intronic
929305845 2:40360668-40360690 CCTTTACAGCTATGTGACCTTGG - Intronic
929314103 2:40456552-40456574 CAGATCCAGCTGTGTGACCTTGG + Intronic
929448649 2:42021167-42021189 CTTAACTATCTGTGTGACCTTGG + Intergenic
929591458 2:43150237-43150259 CTTTACTAGCTGTGTGACCTGGG + Intergenic
929646667 2:43635679-43635701 CTGACCTAGCTTTGTGACCTGGG + Intergenic
930045870 2:47172333-47172355 ATTTAATAGCTGTGTGACCTTGG + Intronic
930103525 2:47620917-47620939 CATCACCAGCTGTGTGACCTTGG - Intergenic
930279423 2:49352588-49352610 ATTATACACATGTGTGACCTTGG - Intergenic
930524308 2:52507646-52507668 CTTAAATAGCTGTGTGATCTCGG + Intergenic
930550525 2:52829267-52829289 ATCCCACAGCTGTGTGAACTTGG + Intergenic
930783453 2:55247152-55247174 GTTAATCAGCTGTGTGATCTTGG - Intronic
931082080 2:58784957-58784979 CATTCACAGATGTGTGACCTTGG - Intergenic
931178693 2:59878234-59878256 CTTTCTTAGCTATGTGACCTTGG + Intergenic
931552767 2:63465308-63465330 CTTTCCCAGCTGTGTGACTTTGG - Intronic
931617170 2:64171445-64171467 CTTAATTAGCTGTGTAACCTTGG + Intergenic
931769109 2:65482211-65482233 TTTCCTTAGCTGTGTGACCTTGG - Intergenic
931811706 2:65860598-65860620 CCTACTAAGCTGAGTGACCTTGG - Intergenic
933370149 2:81404761-81404783 CTTAAAGAGCTATGTGACCTAGG + Intergenic
933587135 2:84191442-84191464 CAGATATAGCTGTGTGACCTTGG + Intergenic
933778235 2:85784801-85784823 ATTCAGCAGCTGTGTGACCTTGG - Intronic
933844621 2:86315244-86315266 CTTGCTGAGCTGAGTGACCTTGG - Intronic
933983217 2:87570398-87570420 CTTCCCCAGCTGTGTGGCCTTGG + Intergenic
934084067 2:88494733-88494755 ACTTCCCAGCTGTGTGACCTTGG + Intergenic
934298435 2:91761506-91761528 CTAAGCCAGCTGTGTGACCTTGG + Intergenic
934573783 2:95388043-95388065 ATTCACCAGCTGTGTGACCTTGG + Intergenic
934668874 2:96194976-96194998 CCTACACAGATGTGACACCTCGG - Exonic
934735511 2:96687917-96687939 CGTACACCGCTGTGTCACCCTGG - Intergenic
934967114 2:98732115-98732137 CATTACCAGCTGTGTGACCTTGG - Intergenic
935396317 2:102613165-102613187 CTTGACTAGCTGTGTGACCTTGG + Intergenic
935821296 2:106895511-106895533 CTGAAACAGCTGAGTGACCAGGG - Intergenic
935922832 2:108033849-108033871 ATTTCCCAGCTGTGTGGCCTCGG - Intergenic
936012144 2:108931595-108931617 CTTAAGTAGCTGTGTGACCTGGG - Intronic
936310628 2:111380396-111380418 CTTCCCCAGCTGTGTGGCCTTGG - Intergenic
936504397 2:113093557-113093579 CTTCAATAGCTGTGTGACCCTGG + Intergenic
936628409 2:114173903-114173925 CTTTGCTAGCTGTGTGACCTTGG + Intergenic
936950334 2:117971648-117971670 ATTTCCCAGCTGTGTGACCTCGG - Intronic
936978190 2:118239886-118239908 CTTCCCAGGCTGTGTGACCTTGG + Intergenic
937119359 2:119431408-119431430 CTCACTCTGCGGTGTGACCTTGG - Intronic
937156533 2:119723872-119723894 CTTAACCAGCTGTGTGACTTTGG - Intergenic
937619804 2:123972474-123972496 CTTGCTAAGCTGTGTTACCTTGG - Intergenic
937684878 2:124684592-124684614 GTTTGAAAGCTGTGTGACCTTGG + Intronic
938904505 2:135825688-135825710 CTCAGACAGCTGTGTGCCGTTGG + Intronic
939882062 2:147642062-147642084 CTTGAACAGCTGGGTGAACTTGG + Intergenic
941172223 2:162153203-162153225 ATTGACCAGCTGTGTGACCTTGG + Intergenic
941274277 2:163471053-163471075 ATTAAACAGCTGTTTGACCTTGG - Intergenic
941891236 2:170583792-170583814 ATTTGCCAGCTGTGTGACCTTGG - Intronic
941950820 2:171154601-171154623 ATTAACTAGCTGTGTGACCTTGG - Intronic
942072867 2:172331003-172331025 CTCCCAAAGCTGTGTGACTTTGG + Intergenic
943069720 2:183126060-183126082 TTGACACAGCCGTGTCACCTGGG + Intronic
944109102 2:196112355-196112377 CTAAGACAGCTATGTTACCTTGG + Intergenic
944756859 2:202772212-202772234 GTTTCCCAGCTGTGTGACCATGG - Intergenic
945187984 2:207158945-207158967 GTTAATAAGCTGTGTGACCTTGG + Intronic
945212008 2:207393364-207393386 ATTTGTCAGCTGTGTGACCTTGG - Intergenic
945710776 2:213291779-213291801 CATTCACAGCTGTGTGATCTTGG + Intronic
945922523 2:215770298-215770320 CTTGCTCTGCTGTGTGACCCAGG + Intergenic
946031907 2:216712076-216712098 CTCCCTCAGCTGAGTGACCTTGG + Intergenic
946149686 2:217755889-217755911 ATAATACAGCTCTGTGACCTTGG - Intronic
946396652 2:219446738-219446760 ATTTCCCAGCTGTGTCACCTTGG + Intronic
946449645 2:219768918-219768940 GCTACACAGCTGTGTGACCTTGG - Intergenic
946490972 2:220148541-220148563 CTTACTTAGCTGTTTGATCTTGG + Intergenic
946583014 2:221151035-221151057 ATTTAGCAGCTGTGTGACCTTGG - Intergenic
947065042 2:226214927-226214949 CTTTACCAGCTGTGTGACTTTGG + Intergenic
947782530 2:232781873-232781895 ATGACTCAGCTGTGTGGCCTTGG + Intronic
948203206 2:236144645-236144667 TTCACACAGTTGTGTGGCCTTGG - Intergenic
948587276 2:239027307-239027329 CAAACTCAGCTCTGTGACCTGGG - Intergenic
948695358 2:239730427-239730449 CTCCAACTGCTGTGTGACCTTGG + Intergenic
948695372 2:239730519-239730541 CTCCAACTGCTGTGTGACCTTGG + Intergenic
948695387 2:239730611-239730633 CTCCAACTGCTGTGTGACCTTGG + Intergenic
948695403 2:239730710-239730732 CTCCAACCGCTGTGTGACCTTGG + Intergenic
949055303 2:241924935-241924957 CTGACCCTGCTGTGTGCCCTGGG + Intergenic
1168771248 20:418156-418178 CATTCCCAGCTGTGTGACCTTGG + Intronic
1168804975 20:667051-667073 CATTCCCAGCAGTGTGACCTTGG + Intronic
1168836641 20:881976-881998 CTTACCTGGCTGTGTGCCCTTGG - Intronic
1168873428 20:1151509-1151531 ATTTCACAGATGTGTGACCCAGG - Intronic
1168969886 20:1923755-1923777 CATACTTGGCTGTGTGACCTTGG + Intronic
1169084454 20:2818124-2818146 CTTGCACAGCTGTGTGAGTGGGG + Intronic
1169195136 20:3678740-3678762 CCTAAAGAGCTGTGTGACCATGG + Intronic
1169533978 20:6516940-6516962 CCTAGCTAGCTGTGTGACCTTGG + Intergenic
1169588641 20:7116015-7116037 CTCAGCCTGCTGTGTGACCTTGG - Intergenic
1170411500 20:16096950-16096972 CCCAGTCAGCTGTGTGACCTTGG - Intergenic
1170542166 20:17400375-17400397 CTTCATCATCTGTGTGACCTTGG + Intronic
1170603076 20:17856387-17856409 TCTAACCAGCTGTGTGACCTTGG - Intergenic
1171488626 20:25501185-25501207 CCTGCACAGCCATGTGACCTTGG - Intronic
1171518332 20:25757233-25757255 CATTTCCAGCTGTGTGACCTCGG + Intergenic
1171558526 20:26098973-26098995 CATTTCCAGCTGTGTGACCTCGG - Intergenic
1172122276 20:32605523-32605545 ACTGCCCAGCTGTGTGACCTTGG + Intronic
1172385399 20:34530628-34530650 CATTCACAGCTGGGTGACCTTGG - Intronic
1172450318 20:35018068-35018090 ATTTTATAGCTGTGTGACCTGGG - Intronic
1172573569 20:35989154-35989176 CTTCATCAGCTGTGTGACCTTGG - Intronic
1172640765 20:36439265-36439287 CTTTCTCAGCTGGGTGACCCTGG - Intronic
1172697581 20:36833084-36833106 CCTTCCTAGCTGTGTGACCTTGG - Intronic
1172877343 20:38173321-38173343 CTTTCTGAGCTGTGTGACCTTGG - Intergenic
1172882226 20:38209406-38209428 CTTTCCTGGCTGTGTGACCTTGG + Intergenic
1172942735 20:38665793-38665815 TACTCACAGCTGTGTGACCTTGG - Intergenic
1173032612 20:39376243-39376265 CCTACACAGGTGTGTAGCCTTGG + Intergenic
1173200704 20:40952892-40952914 CTTTAACAGCTGTGTGACCTTGG + Intergenic
1173445514 20:43114346-43114368 CTTACTTAGCTGTGTGCCTTTGG + Intronic
1173576701 20:44116632-44116654 CTTCGACAGCTGTGTGTCTTTGG - Intronic
1173624801 20:44464859-44464881 ACTTCACTGCTGTGTGACCTTGG - Intronic
1173896220 20:46552661-46552683 CTTACTGTGCTGTGTGACCTTGG + Intergenic
1173898175 20:46566553-46566575 CTGGCTCAGATGTGTGACCTTGG - Intronic
1173907423 20:46639126-46639148 TTTAACCAACTGTGTGACCTTGG - Intronic
1173910799 20:46669064-46669086 CTATTTCAGCTGTGTGACCTGGG - Intronic
1173916387 20:46711304-46711326 TCTCCATAGCTGTGTGACCTTGG - Intronic
1173932385 20:46831613-46831635 GTGCCACTGCTGTGTGACCTTGG - Intergenic
1173998845 20:47359690-47359712 ACTTCCCAGCTGTGTGACCTTGG - Intergenic
1174016635 20:47494013-47494035 CTTACAAAGCTGTGTGATAGTGG - Intergenic
1174202590 20:48817556-48817578 CCTCAGCAGCTGTGTGACCTTGG - Intronic
1174399258 20:50267224-50267246 CCAACCCTGCTGTGTGACCTCGG - Intergenic
1174485323 20:50857549-50857571 CCTTCCTAGCTGTGTGACCTTGG - Intronic
1174593704 20:51667062-51667084 CTGACACAGCTGTGTGTTGTGGG - Intronic
1174634895 20:51990517-51990539 GCTTCATAGCTGTGTGACCTTGG + Intergenic
1174773380 20:53322065-53322087 CATTCATAGCTGGGTGACCTTGG + Intronic
1174819566 20:53714720-53714742 GTTGCCTAGCTGTGTGACCTGGG + Intergenic
1175159078 20:56994639-56994661 TTTTTCCAGCTGTGTGACCTTGG + Intergenic
1175267676 20:57712326-57712348 GGGACATAGCTGTGTGACCTCGG + Intergenic
1175338729 20:58214022-58214044 CCTTCCCAGTTGTGTGACCTTGG - Intergenic
1175478511 20:59294401-59294423 CTTGCCTAGCTGTGTGACCTTGG - Intergenic
1175542837 20:59758788-59758810 CTTACTGAGCTGTGGGACCATGG + Intronic
1177902721 21:26936043-26936065 CCATAACAGCTGTGTGACCTTGG - Intronic
1178304868 21:31483010-31483032 ATTTACCAGCTGTGTGACCTGGG - Intronic
1178315975 21:31567160-31567182 CCTTACCAGCTGTGTGACCTTGG + Intergenic
1178334891 21:31733623-31733645 ATGATCCAGCTGTGTGACCTTGG - Intergenic
1178500581 21:33122734-33122756 CTTTTCTAGCTGTGTGACCTTGG - Intergenic
1178592730 21:33924977-33924999 CTTCACCAGCTGTGTGACTTGGG + Intergenic
1178626188 21:34220801-34220823 CTCATACAGCTGTGTGCCCAGGG - Intergenic
1178665498 21:34542951-34542973 ATTTCTTAGCTGTGTGACCTTGG + Intronic
1178672160 21:34601398-34601420 AGTAACCAGCTGTGTGACCTTGG - Intronic
1178723839 21:35034135-35034157 ATTTCCCAGCTGTGTGACCTTGG + Intronic
1179029230 21:37705304-37705326 CTTCACCAGCTGGGTGACCTTGG + Intronic
1179175919 21:39008152-39008174 CCCAATCAGCTGTGTGACCTTGG - Intergenic
1179186233 21:39087237-39087259 CTTGCCCAGCTGTGGGGCCTAGG - Intergenic
1179912795 21:44459303-44459325 CTGACACAGCAGAGTGCCCTGGG + Exonic
1180249008 21:46567248-46567270 CTTAAATAGCTGTGTGACATTGG + Intronic
1180842878 22:18967499-18967521 CCTGCCCAGCTGTGTGACCTCGG - Intergenic
1180864732 22:19110769-19110791 CTTTAAAAGCTGTGTGACTTTGG + Intronic
1181457022 22:23065588-23065610 CTTTCCAATCTGTGTGACCTTGG + Intronic
1181733988 22:24867821-24867843 ATTGATCAGCTGTGTGACCTTGG + Intronic
1181914451 22:26268415-26268437 ATTTAACAGTTGTGTGACCTTGG - Intronic
1181948474 22:26537294-26537316 GTTCCCCAGCTGTGTGGCCTTGG + Intronic
1182002161 22:26928369-26928391 CTTAACTTGCTGTGTGACCTTGG - Intergenic
1182208913 22:28657164-28657186 CCTCCACAACTGTGTGACTTTGG - Intronic
1182532777 22:30973740-30973762 CTTTCACAGCTGTGTCACCTTGG - Intergenic
1182547793 22:31085675-31085697 CTTACACAGCGGTGGGGCCTGGG + Intronic
1182554026 22:31119334-31119356 CAGCCCCAGCTGTGTGACCTTGG + Intronic
1182848418 22:33450757-33450779 TTTACTCATCTGTGTGATCTTGG - Intronic
1182888273 22:33794520-33794542 CTTTTACTGCTGTGTGGCCTTGG + Intronic
1182900537 22:33894700-33894722 CACACACATGTGTGTGACCTTGG - Intronic
1183003707 22:34882766-34882788 CTTTCCCAGCTGTGTGGCCTTGG - Intergenic
1183020052 22:35019552-35019574 CTGGCCCTGCTGTGTGACCTGGG - Intergenic
1183087030 22:35492655-35492677 CCTCCAAAGCTCTGTGACCTTGG + Intergenic
1183105327 22:35611196-35611218 TCTTCCCAGCTGTGTGACCTTGG + Intronic
1183128493 22:35809254-35809276 CCTACTAAACTGTGTGACCTTGG - Intronic
1183238601 22:36639115-36639137 GTTACTCGTCTGTGTGACCTCGG + Intronic
1183352261 22:37340903-37340925 CTTCCTGAGCTGTGTGACCTTGG - Intergenic
1183364962 22:37402025-37402047 CCTCCACAGCTGTGTGACCTTGG + Intronic
1183661315 22:39223171-39223193 CTTAGCCAGCTGTGTGGCCTTGG - Intergenic
1183740899 22:39668011-39668033 ATTATCCAGCTGTGTGATCTTGG - Intronic
1183770498 22:39921239-39921261 GTTTCTCAGCTGTGTGACCTGGG + Intronic
1183907142 22:41050012-41050034 CTAGCCTAGCTGTGTGACCTTGG - Intergenic
1184062107 22:42089779-42089801 CTCAACTAGCTGTGTGACCTTGG - Intronic
1184160533 22:42694722-42694744 CTGAACCGGCTGTGTGACCTGGG + Exonic
1184299714 22:43550249-43550271 CTCATCCAGCTGTGTGACCCTGG - Intronic
1184344690 22:43905971-43905993 CACAGACAGCTCTGTGACCTCGG - Intergenic
1184514768 22:44955237-44955259 ACTCCACAGCTGTGTGACCTTGG + Intronic
1184535579 22:45084557-45084579 ATTCCCCAGCTGTGTGACTTTGG - Intergenic
1184773793 22:46613253-46613275 TGGCCACAGCTGTGTGACCTCGG - Intronic
1185395515 22:50585178-50585200 CTAGCACAGCTGTGTGATCGGGG - Intronic
949202305 3:1394045-1394067 CCTTCATTGCTGTGTGACCTTGG - Intronic
949355738 3:3179077-3179099 CTGACTCTGCTGTGTGACCTTGG + Intronic
949589455 3:5478677-5478699 CTAGGACAGCTCTGTGACCTTGG + Intergenic
949867629 3:8559505-8559527 GGTTCATAGCTGTGTGACCTTGG - Intronic
949877752 3:8637547-8637569 ACTCCACAGCTGTGTGACCTAGG - Intronic
949897053 3:8775789-8775811 CTTTACCAGCTGTGTGGCCTTGG - Intronic
949959727 3:9302172-9302194 CTTACCCAGCAGTGGGCCCTGGG - Intronic
950046556 3:9951817-9951839 TCCACTCAGCTGTGTGACCTTGG - Intronic
950106950 3:10394449-10394471 CACTCACAGCTGTGTGACCCTGG - Intronic
950113425 3:10435080-10435102 CTTTCACAGCTGTGCGACGTGGG + Intronic
950114647 3:10442952-10442974 CTTATCCAGCTGTGGGACGTTGG - Intronic
950160600 3:10757920-10757942 CAGACCCAGCTGTGTGACCCTGG - Intergenic
950180963 3:10912799-10912821 CACACAGAGCTGGGTGACCTTGG - Intronic
950207191 3:11089976-11089998 CTGACAAACCTGTGTGACTTTGG + Intergenic
950298348 3:11851389-11851411 ATTTAATAGCTGTGTGACCTTGG + Intergenic
950354587 3:12395882-12395904 CATACACCGCTGAGTGGCCTAGG - Intronic
950441408 3:13012909-13012931 CTTTCGTAGCTATGTGACCTTGG - Intronic
950446104 3:13039664-13039686 CCTCCACAGCTGTGTAACATGGG - Intronic
950525820 3:13522646-13522668 CCTGCACAGCTGTGTGCCTTTGG + Intergenic
950564791 3:13762157-13762179 CTTATACAGCTGTGTAATATTGG + Intergenic
950638693 3:14333903-14333925 CCTTCCCAGCTGTGTGACCTTGG + Intergenic
950643521 3:14363571-14363593 GCTTCAAAGCTGTGTGACCTTGG - Intergenic
950665321 3:14491771-14491793 CAGCCATAGCTGTGTGACCTTGG - Exonic
950673847 3:14542861-14542883 CCTTACCAGCTGTGTGACCTTGG - Intergenic
950675504 3:14551814-14551836 CTTTCCTAGGTGTGTGACCTTGG + Intergenic
951093855 3:18605612-18605634 CACACACAGTGGTGTGACCTTGG - Intergenic
951251650 3:20400955-20400977 CTTGCATAGCTATTTGACCTTGG + Intergenic
951333842 3:21397782-21397804 CTTTCACAGTAGAGTGACCTAGG - Intergenic
951549219 3:23860155-23860177 CTCTCACAGCTGTCTGTCCTTGG + Intronic
952060595 3:29504184-29504206 CTCAGACATATGTGTGACCTGGG - Intronic
952666749 3:35916068-35916090 CATCCACAGGTGTGTTACCTGGG + Intergenic
953044786 3:39284756-39284778 CTTTTTCAGCTGTGTGGCCTAGG - Intergenic
953215455 3:40913840-40913862 GCTACCTAGCTGTGTGACCTTGG + Intergenic
953381476 3:42475987-42476009 ATTCATCAGCTGTGTGACCTTGG - Intergenic
953773641 3:45797391-45797413 CTGACTTAGCTGTGTGACCTTGG + Intergenic
954331733 3:49894744-49894766 CTCACCAACCTGTGTGACCTTGG - Intronic
954425414 3:50440438-50440460 CATATACAGCTGAGTGACCATGG - Intronic
954436020 3:50496768-50496790 TCTCAACAGCTGTGTGACCTTGG - Intronic
954612328 3:51952157-51952179 AAAACTCAGCTGTGTGACCTGGG + Intergenic
954973673 3:54673138-54673160 CTTTAACAGCTGTGTAATCTGGG + Intronic
955194493 3:56792533-56792555 CATTCCCAGCTGTGTGATCTTGG + Intronic
955340103 3:58118476-58118498 CTTACCAAGGTGTGTGACTTGGG + Intronic
955398629 3:58575223-58575245 CCTTCCCAGCTGTGTTACCTTGG + Intronic
955541415 3:59980565-59980587 CTTACACAGCTTTGTGATCCAGG - Intronic
955819753 3:62883607-62883629 CTTTATTAGCTGTGTGACCTTGG + Intergenic
955986073 3:64575321-64575343 CCTTCCCTGCTGTGTGACCTTGG - Intronic
956089941 3:65655731-65655753 CTTACTAAGCTGTGTGAACTTGG - Intronic
956169939 3:66425118-66425140 GCTTCCCAGCTGTGTGACCTTGG - Intronic
956197957 3:66672498-66672520 CCTTAATAGCTGTGTGACCTTGG - Intergenic
956236168 3:67073398-67073420 ATTAATTAGCTGTGTGACCTTGG + Intergenic
956832029 3:73060408-73060430 GTTTCATAGTTGTGTGACCTTGG + Intronic
956915407 3:73865925-73865947 TCTAGGCAGCTGTGTGACCTAGG + Intergenic
957375996 3:79358098-79358120 CTTACATAGCTATGTGACATTGG + Intronic
958734418 3:97992355-97992377 CCTCTTCAGCTGTGTGACCTTGG + Intronic
959565393 3:107827567-107827589 ATTTCCTAGCTGTGTGACCTTGG + Intergenic
959705996 3:109339313-109339335 CTTCACTAGCTGTGTGACCTGGG + Intergenic
959964600 3:112338921-112338943 ACTTCACAGCTGTGTGACCTTGG + Intronic
960591341 3:119368827-119368849 CTGCCTCTGCTGTGTGACCTTGG - Intronic
960726316 3:120673936-120673958 CTTTTCCAGCTGTGTGGCCTTGG - Intronic
961380733 3:126495015-126495037 TATCCTCAGCTGTGTGACCTGGG - Intronic
961826685 3:129602924-129602946 ACTTCCCAGCTGTGTGACCTTGG - Intronic
962386867 3:134938865-134938887 CAGACCCAGCTGTGTGACCATGG - Intronic
962796261 3:138852168-138852190 CCTTCCCAGCTGTATGACCTTGG - Intergenic
962808042 3:138940535-138940557 CTTTAACAGCTATGTAACCTTGG - Intergenic
962868481 3:139467519-139467541 CCTAGCTAGCTGTGTGACCTTGG + Intronic
962930666 3:140032765-140032787 GTTAGTCATCTGTGTGACCTTGG + Intronic
962970380 3:140395477-140395499 CCTTCTCAGCTGTGTGACCTTGG - Intronic
963436382 3:145272711-145272733 GTAACACAGCTGTGTGGCCTTGG - Intergenic
963949066 3:151178621-151178643 ATTACTTAGCTGAGTGACCTTGG + Intronic
965610265 3:170536067-170536089 TTGACTCTGCTGTGTGACCTTGG + Intronic
966586224 3:181628576-181628598 GTAACCTAGCTGTGTGACCTTGG - Intergenic
966586692 3:181634323-181634345 CTTACACAGCTGTATGGCTATGG - Intergenic
966778561 3:183564096-183564118 CTGACTTACCTGTGTGACCTGGG - Intergenic
966781307 3:183586615-183586637 CCTACACCACTGTGTTACCTGGG - Intergenic
967094649 3:186167148-186167170 CTTACACAGATGTGGGACTGAGG + Intronic
967123502 3:186404838-186404860 CTCCCCCAGCTGTGTGACTTTGG + Intergenic
967242238 3:187451334-187451356 CTTAACCTGCTGTCTGACCTTGG - Intergenic
967425074 3:189317594-189317616 CTCACATAGCTGTGTGACTTTGG - Intronic
967447407 3:189583017-189583039 CTGGCCCAGCTGTGTGACCCTGG - Intergenic
967493886 3:190121702-190121724 GTTTACCAGCTGTGTGACCTTGG + Intronic
967655155 3:192039230-192039252 ATTAAATAGCTGTATGACCTTGG - Intergenic
967768313 3:193306955-193306977 CTTTATCAGTTGTGTGACCTTGG + Intronic
967870979 3:194228875-194228897 CTTTCACAGCTGTGTGCCTGGGG - Intergenic
967905987 3:194500688-194500710 TTTACCCAGCTATGTGACTTTGG - Intergenic
968276514 3:197444541-197444563 CTTAGATAGTTGTGTGACATTGG - Intergenic
969200445 4:5600142-5600164 CTTAACTAGCTGTGTGACCAAGG + Intronic
969309031 4:6341471-6341493 TCTACTTAGCTGTGTGACCTTGG + Intronic
969317710 4:6391867-6391889 CCTGACCAGCTGTGTGACCTTGG + Intronic
969595241 4:8145012-8145034 CTTTACCAGCCGTGTGACCTGGG + Intronic
969686709 4:8679537-8679559 CTAGCTCAGCTGTGTGGCCTTGG - Intergenic
969694041 4:8724949-8724971 CTTGCCCTCCTGTGTGACCTTGG - Intergenic
970003902 4:11392478-11392500 TTTTCACAGCTATGTGACCTTGG - Intergenic
970033959 4:11710757-11710779 CCTACAAAGCTTTATGACCTTGG - Intergenic
970068062 4:12121868-12121890 CCTACAAGGCTGTGTGACCTTGG + Intergenic
970136644 4:12932477-12932499 CTTACAGACCTCTGTGGCCTGGG + Intergenic
970341521 4:15112316-15112338 GTTACCTTGCTGTGTGACCTTGG - Intergenic
970385531 4:15552895-15552917 GCTTCACAGCTTTGTGACCTTGG - Intronic
970411183 4:15809348-15809370 ATTTAACAGCTGTGTGACCTCGG + Intronic
970446257 4:16125631-16125653 CTGAAACAGCTGAGTGACTTGGG - Intergenic
970883495 4:20959814-20959836 ATTTCACAGCTGTGTAACCTTGG + Intronic
971177774 4:24296824-24296846 ATTTACCAGCTGTGTGACCTTGG - Intergenic
971182031 4:24337737-24337759 CTTTCTTAGCTGTGTGATCTGGG - Intergenic
971299134 4:25427768-25427790 CCTCCCTAGCTGTGTGACCTTGG - Intergenic
971364953 4:25970287-25970309 CTTTCACAGCTGAGTGTCCTGGG - Intergenic
971834357 4:31743683-31743705 ATTAACCAGCTTTGTGACCTTGG + Intergenic
972637945 4:40900986-40901008 TCCACAGAGCTGTGTGACCTTGG - Intronic
972786182 4:42328717-42328739 GAGACTCAGCTGTGTGACCTTGG + Intergenic
973344815 4:49043080-49043102 ATTTACCAGCTGTGTGACCTTGG + Intronic
973651839 4:53004580-53004602 ACTACTTAGCTGTGTGACCTTGG - Intronic
973697985 4:53509502-53509524 TTTACATAGCTGGGTGATCTAGG + Intronic
975122777 4:70747152-70747174 CTTCCCTAGCTGTGTGACCTTGG - Intronic
975218470 4:71785069-71785091 CTTTCATAGCTGTGTAACCTTGG + Intronic
975712968 4:77178855-77178877 TGTCCACAGCTGTCTGACCTAGG + Intronic
976137204 4:81951286-81951308 CTTTACTAGCTGTGTGACCTGGG + Intronic
976223836 4:82779670-82779692 CCTTAACAGCTCTGTGACCTTGG + Intronic
976576783 4:86681573-86681595 GTTAAATAGCTGTGTGATCTTGG + Intronic
977214456 4:94263030-94263052 CTTACCCAGCTTTGTGATGTTGG + Intronic
977295021 4:95200466-95200488 ACTTAACAGCTGTGTGACCTAGG + Intronic
977628409 4:99214615-99214637 CCTTCTCAGCTGTGTGAACTTGG + Intronic
977667795 4:99661075-99661097 TATTCATAGCTGTGTGACCTTGG - Intergenic
977873761 4:102124946-102124968 CTTGGATAGCTGAGTGACCTTGG + Intergenic
978560489 4:110028768-110028790 CTTAACTAGCTATGTGACCTTGG + Intergenic
979210903 4:118100753-118100775 CTTAAATAGCTTTGTGACCAAGG + Intronic
981073200 4:140566956-140566978 CCCTCCCAGCTGTGTGACCTTGG + Intronic
981113618 4:140964255-140964277 AGTAACCAGCTGTGTGACCTTGG + Intronic
981497989 4:145415008-145415030 CTTGAGCAGCTGTGTGTCCTGGG - Intergenic
981548250 4:145916344-145916366 CTTCCAAAGCTGTGACACCTGGG + Intronic
981667519 4:147246361-147246383 TTGAAACAGCTGTGTGACCTTGG + Intergenic
982134238 4:152258627-152258649 TCTAACCAGCTGTGTGACCTCGG - Intergenic
983478817 4:168247980-168248002 ATTAACCAGATGTGTGACCTCGG - Intronic
983560544 4:169097221-169097243 CTTACACTGGTGTTTGACATGGG + Intronic
983860473 4:172699444-172699466 CTTTCACAGCTGTGTGGTCTAGG + Intronic
984039188 4:174707795-174707817 ACTTCACAGTTGTGTGACCTTGG + Intronic
984232584 4:177116809-177116831 CCTTCCCAACTGTGTGACCTTGG + Intergenic
984463575 4:180068845-180068867 CATTCAAAGCTGTGTGATCTCGG + Intergenic
984749620 4:183259268-183259290 CTGACACAGATCTGTGACCTGGG - Intronic
985651110 5:1108051-1108073 CTTGCACAGCTGTGTGCTGTGGG - Intronic
985809371 5:2071740-2071762 ATTTCTTAGCTGTGTGACCTTGG + Intergenic
985982225 5:3480254-3480276 CTTATACAGCTGTGCAAACTTGG - Intergenic
986226722 5:5822791-5822813 ATTACCCAGCTGTGTGCTCTGGG + Intergenic
986699139 5:10388588-10388610 GTAAAACAGCTGAGTGACCTAGG - Intronic
986716448 5:10527501-10527523 CTCAACCAGCTGTGTGACTTTGG - Intergenic
987244767 5:16037601-16037623 CTCAACCAGCTGCGTGACCTTGG - Intergenic
988581096 5:32469468-32469490 TTTAAATAGCTGTGTTACCTTGG - Intergenic
988730787 5:33970614-33970636 ACTAACCAGCTGTGTGACCTTGG + Intronic
988853463 5:35202061-35202083 CCTAACTAGCTGTGTGACCTTGG + Intronic
989125311 5:38047064-38047086 CATAACCAGCTGTGTGACCTCGG - Intergenic
990354220 5:54949979-54950001 GTTACACAATTGTGTGATCTAGG - Intergenic
990477162 5:56172793-56172815 ATTTCACAGGTGTGTGACGTTGG - Intronic
990612959 5:57477564-57477586 CTGACACAGGTTTGTTACCTGGG - Intergenic
990867753 5:60398857-60398879 CTTGTTCAGCTGTGTGACTTGGG - Intronic
991636742 5:68713755-68713777 CTTGACCAACTGTGTGACCTTGG - Intergenic
992032732 5:72739230-72739252 CTTACACAGCTGTGTGACCTCGG - Intergenic
992374799 5:76177716-76177738 CTCACACTCCTGTGTGACTTTGG + Intronic
992408343 5:76480788-76480810 CTAAGACAGCTGTGTGCCCAGGG - Intronic
992672822 5:79076613-79076635 CTTACTTAGCTCTGTGATCTTGG + Intronic
992885061 5:81150261-81150283 TTTATTTAGCTGTGTGACCTGGG + Intronic
993364612 5:87020263-87020285 CAGAAACAGCTTTGTGACCTGGG - Intergenic
993620751 5:90164947-90164969 ATTCCCTAGCTGTGTGACCTTGG - Intergenic
994910878 5:105905164-105905186 CTTACCCAAATGTGTGACCTTGG - Intergenic
995651442 5:114373527-114373549 ACTAATCAGCTGTGTGACCTTGG + Intronic
996366102 5:122703021-122703043 CTTTGCCAGCTGTGTGTCCTTGG + Intergenic
996503008 5:124237654-124237676 CTTCACCAGTTGTGTGACCTTGG + Intergenic
996541342 5:124632485-124632507 CTTACACAGTGGTGTGAACTTGG + Intergenic
997193308 5:131960198-131960220 GCTAACCAGCTGTGTGACCTCGG + Intronic
997577861 5:134996728-134996750 ATTGCACCGCTGGGTGACCTTGG - Intronic
997840867 5:137238035-137238057 CCTTTACAGCTGTGTGATCTTGG + Intronic
998394277 5:141808349-141808371 CTTACTTAGCTGTGTGACCATGG + Intergenic
998418646 5:141963968-141963990 CTTACAGAGCCATGTTACCTTGG + Intronic
999056681 5:148585651-148585673 CATTAACTGCTGTGTGACCTAGG - Intronic
999069114 5:148724936-148724958 CTTGTTCATCTGTGTGACCTGGG - Intergenic
999192710 5:149760407-149760429 CTTAACATGCTGTGTGACCTTGG + Intronic
999198308 5:149798119-149798141 CTTAACCAGCTGTGTGGCCCTGG - Intronic
999279044 5:150352724-150352746 CTGGCTCAGCTGTGTGACCTTGG - Intergenic
999295912 5:150459318-150459340 CTGAACCAGCTGAGTGACCTGGG - Intergenic
999309030 5:150539505-150539527 CTGCCTCGGCTGTGTGACCTTGG + Intronic
999325225 5:150639572-150639594 CTTGCTAAGCTGTGAGACCTGGG + Intronic
999332903 5:150689389-150689411 TGTACCCAGCTGTGTGCCCTAGG + Intergenic
999420811 5:151440798-151440820 ATTTCCCAGCTGGGTGACCTGGG - Intronic
999638614 5:153648469-153648491 GTTTGTCAGCTGTGTGACCTTGG + Intronic
999889951 5:155966612-155966634 TTTTACCAGCTGTGTGACCTTGG + Intronic
1000021229 5:157321012-157321034 CCTAGATACCTGTGTGACCTCGG + Intronic
1000083239 5:157867012-157867034 ACCACAGAGCTGTGTGACCTTGG + Intergenic
1000295538 5:159910315-159910337 TTGACCCAGATGTGTGACCTTGG - Intergenic
1001301542 5:170537245-170537267 CTTTGACAATTGTGTGACCTCGG + Intronic
1001403580 5:171460800-171460822 CTTTGCCAGCTGCGTGACCTTGG + Intergenic
1001427754 5:171635227-171635249 CCCACTGAGCTGTGTGACCTTGG - Intergenic
1001519042 5:172377643-172377665 CCTTCCCAGCTGTGTGACCTTGG - Intronic
1001560564 5:172666265-172666287 CTAAACCAGCTGTGTGACTTTGG + Intronic
1001594974 5:172892459-172892481 CTTACGTGACTGTGTGACCTTGG + Intronic
1001607570 5:172973283-172973305 ATTTCCTAGCTGTGTGACCTTGG + Intergenic
1001672322 5:173484286-173484308 GTTCCTCAGCTGTGTGACCTTGG - Intergenic
1001704118 5:173729435-173729457 GTTATTCAGTTGTGTGACCTCGG + Intergenic
1001709527 5:173767149-173767171 CTTCAAAAGCTGTGTGACCTTGG + Intergenic
1001795008 5:174494808-174494830 CTTCCACTGCTGTGTAATCTTGG + Intergenic
1001923106 5:175616319-175616341 CTTTACTAGCTGTGTGACCTTGG - Intergenic
1001931806 5:175678478-175678500 CTGAAATAGCTTTGTGACCTTGG - Intronic
1002185521 5:177453051-177453073 CCTTCTGAGCTGTGTGACCTGGG + Intronic
1002327086 5:178416720-178416742 CCTACTTAACTGTGTGACCTTGG - Intronic
1002540230 5:179902036-179902058 ACTTCCCAGCTGTGTGACCTTGG - Intronic
1002660559 5:180788528-180788550 CTCAACCATCTGTGTGACCTTGG + Intergenic
1002871324 6:1169710-1169732 CCTTCCCAGCTGTGTGACCCGGG - Intergenic
1003265420 6:4561350-4561372 ATTTATCAGCTGTGTGACCTTGG - Intergenic
1003408205 6:5840392-5840414 CTTACACAGCTGTGTGACCTTGG + Intergenic
1003418780 6:5937666-5937688 TTTTCCCAGCTCTGTGACCTGGG - Intergenic
1003454493 6:6269168-6269190 CTAACACTTCTGTGTGATCTCGG + Intronic
1003728422 6:8792466-8792488 GTTTACCAGCTGTGTGACCTTGG - Intergenic
1003830487 6:10004787-10004809 GCTTAACAGCTGTGTGACCTTGG + Intronic
1004884489 6:20038292-20038314 GTGTCACAGCTGTGTGACCTTGG + Intergenic
1005031584 6:21513644-21513666 ACTTCCCAGCTGTGTGACCTTGG - Intergenic
1006399210 6:33806625-33806647 TTTGAATAGCTGTGTGACCTTGG - Intergenic
1006593518 6:35175897-35175919 CCTTACCAGCTGTGTGACCTAGG + Intergenic
1006609491 6:35285569-35285591 TCTTAACAGCTGTGTGACCTTGG - Intronic
1006640492 6:35486874-35486896 TGTTCAGAGCTGTGTGACCTGGG + Intronic
1006717050 6:36127352-36127374 CATTACCAGCTGTGTGACCTTGG - Intergenic
1006790498 6:36698117-36698139 CGTAAATGGCTGTGTGACCTAGG + Intronic
1006901633 6:37506324-37506346 CTTCATCAACTGTGTGACCTTGG + Intergenic
1007220892 6:40277907-40277929 CACTAACAGCTGTGTGACCTTGG - Intergenic
1007235142 6:40385603-40385625 CCTCAATAGCTGTGTGACCTTGG + Intergenic
1007255835 6:40528042-40528064 CTTAATCAGCGGTGTGACCTTGG - Intronic
1008550219 6:52621752-52621774 CTTTCCCAATTGTGTGACCTTGG - Intergenic
1008683482 6:53899356-53899378 CTTACACTGCAGGGTGACCCTGG - Intronic
1009192505 6:60646356-60646378 CTGTAACAGCTGTGTGACCATGG - Intergenic
1010156409 6:72799141-72799163 CTTACACAACTGTGGGGACTGGG + Intronic
1010179394 6:73067528-73067550 CTTTCTTAGTTGTGTGACCTTGG - Intronic
1010766612 6:79782444-79782466 ACTTCATAGCTGTGTGACCTTGG + Intergenic
1010785549 6:79995427-79995449 CTTATCCAGATCTGTGACCTGGG + Intergenic
1010819556 6:80396970-80396992 CATACACAACTGTGAGACTTGGG - Intergenic
1011031263 6:82925922-82925944 CTTAACCACCTGTGTGACCTTGG - Intronic
1011144586 6:84198843-84198865 CTTAACCAGCTTTGTGACATTGG - Intronic
1012569767 6:100709451-100709473 CTTAACTAGCTCTGTGACCTTGG + Intronic
1013636242 6:112032335-112032357 CTTCCACTCCTGTGTGACCTTGG - Intergenic
1013960536 6:115893895-115893917 CTTCTCCAGCTGAGTGACCTTGG - Intergenic
1013975715 6:116075743-116075765 CTTTGCTAGCTGTGTGACCTTGG + Intergenic
1014105470 6:117555954-117555976 CTTAACTAGCTGTGTGACCCTGG + Intronic
1014169785 6:118266144-118266166 CATTTACAGCTATGTGACCTTGG - Intronic
1014711869 6:124815964-124815986 CTTTGCCAGCTATGTGACCTTGG - Intronic
1015841064 6:137477895-137477917 CCAACACAGCTATGTGACCTGGG - Intergenic
1016299632 6:142615988-142616010 TTTAGACAGCTATGGGACCTAGG - Intergenic
1016358358 6:143242045-143242067 AAAACACAGCTGTGTGACTTAGG - Intronic
1017153668 6:151303957-151303979 ATTCCTGAGCTGTGTGACCTGGG + Intronic
1017681688 6:156870807-156870829 TTTAAAAAGCTGTGTGACATTGG + Intronic
1017746224 6:157448989-157449011 GCTTCACAGCAGTGTGACCTTGG - Intronic
1017749598 6:157479154-157479176 ACTAACCAGCTGTGTGACCTTGG + Intronic
1018238312 6:161748021-161748043 ATTACACAGCTTTGAGATCTTGG + Intronic
1018531524 6:164768859-164768881 CTTAGACAACTGTGAGACCCAGG + Intergenic
1019363705 7:619507-619529 ATTCCTTAGCTGTGTGACCTTGG - Intronic
1019478327 7:1254798-1254820 CCTGCCCAGCTGTGTGTCCTCGG - Intergenic
1019567707 7:1692742-1692764 CTGACTCTGCTGTGTGACCTAGG + Intronic
1019689172 7:2400416-2400438 CTTACACAGCTCTGTGTCTCTGG + Intergenic
1020152174 7:5691042-5691064 TTTGCACGGCTGTGTGAGCTGGG - Intronic
1020264831 7:6553407-6553429 ATTCCCCAGCTGGGTGACCTTGG - Intergenic
1020365432 7:7375735-7375757 ATTTATCAGCTGTGTGACCTCGG + Intronic
1020488330 7:8747181-8747203 CTTTAACAGCTGTGTGATGTGGG - Intronic
1020785632 7:12569928-12569950 TTTACAGAGCTCTGTCACCTGGG + Intergenic
1021362022 7:19727038-19727060 GTTACAAAGCTGTTTGACCTGGG - Intronic
1021477061 7:21074062-21074084 CACTCACAGTTGTGTGACCTTGG + Intergenic
1021841272 7:24723648-24723670 GCTTCACAGCTGTGTGACTTTGG - Intronic
1021980407 7:26048659-26048681 CTTTGACAGCAGGGTGACCTTGG - Intergenic
1022205873 7:28163229-28163251 GTTGGACTGCTGTGTGACCTTGG - Intronic
1022573203 7:31473189-31473211 AATTAACAGCTGTGTGACCTGGG - Intergenic
1022637413 7:32150089-32150111 TCTGCAGAGCTGTGTGACCTTGG - Intronic
1023118523 7:36885975-36885997 CCTGTCCAGCTGTGTGACCTTGG - Intronic
1023475089 7:40568910-40568932 ATTTCCTAGCTGTGTGACCTTGG + Intronic
1023996325 7:45161241-45161263 TTTAGATAGCTGTGCGACCTGGG + Intronic
1024603840 7:51009309-51009331 GGAACACAGCTGTGTGACCACGG + Intergenic
1026126985 7:67587684-67587706 CATTCCTAGCTGTGTGACCTTGG + Intergenic
1026389195 7:69882556-69882578 TTTTCATAGCTATGTGACCTTGG + Intronic
1026593128 7:71713261-71713283 CTGACCTAGCTGTGTGGCCTTGG + Exonic
1027497416 7:78905400-78905422 CTTACCTAGTTGTATGACCTTGG + Intronic
1027632992 7:80631003-80631025 ATAACACAGCTGAGAGACCTTGG + Intronic
1028418417 7:90605337-90605359 TTTACAAAGCTGTGTGTCCCTGG + Intronic
1029526344 7:101096470-101096492 ACTAAACAGCTGTGTGATCTTGG + Intergenic
1030550390 7:110951669-110951691 CATACAAAGCTGTGTAACCTTGG - Intronic
1030635227 7:111940413-111940435 GTCACCTAGCTGTGTGACCTTGG + Intronic
1030884339 7:114920297-114920319 CTCATTCAGCTGTGTGACTTTGG - Intergenic
1031024737 7:116667883-116667905 TTAAGACAGCTGTGTGACTTTGG + Intergenic
1031496407 7:122454337-122454359 ATTTCCCAGCGGTGTGACCTTGG - Intronic
1031835584 7:126677876-126677898 CTTACACGACTGTGGGAGCTTGG - Intronic
1031989784 7:128189974-128189996 CATTGCCAGCTGTGTGACCTTGG + Intergenic
1032433796 7:131883892-131883914 CTTGCCCAGCTTTGTGACCTTGG - Intergenic
1033360981 7:140638988-140639010 CTTACACAGCTCTGTGTGCTAGG - Intronic
1033505718 7:141997711-141997733 CCTAGCCAGCTGTATGACCTTGG - Intronic
1034522345 7:151630567-151630589 CTTATTTAGCTGTGTGACCTTGG - Intronic
1034636966 7:152575310-152575332 ACTAAGCAGCTGTGTGACCTGGG + Intergenic
1035346332 7:158202092-158202114 CTTACACTGTTGTGTGATTTGGG - Intronic
1035649076 8:1250939-1250961 CAAGCACAGTTGTGTGACCTCGG + Intergenic
1035651979 8:1273391-1273413 ATAAGCCAGCTGTGTGACCTGGG - Intergenic
1037568918 8:20141992-20142014 ATTAACTAGCTGTGTGACCTGGG - Intergenic
1037669562 8:21002434-21002456 GTTTCACAGCTGAGTCACCTAGG + Intergenic
1038141263 8:24847949-24847971 TTCTCACAGCTGTATGACCTTGG - Intergenic
1038227731 8:25672443-25672465 CTTTATCAGCTGTGTGACCTTGG - Intergenic
1038436866 8:27542412-27542434 CTTACACAGCTCTGTGAGGGAGG - Intronic
1038481954 8:27908033-27908055 CCAACACTGCTGTGTGACCTTGG - Intronic
1038987270 8:32825694-32825716 CTTAACCAGCTGTGTCATCTTGG - Intergenic
1039215841 8:35269827-35269849 CACACCCATCTGTGTGACCTTGG - Intronic
1039300994 8:36208598-36208620 CTTACAGAACTGTGGGACCAGGG - Intergenic
1039951910 8:42179581-42179603 CTTGCTGAGCTGTGTGACCGTGG - Intronic
1041198170 8:55422586-55422608 CTTGCACTGCTGTGTTCCCTGGG - Intronic
1041688806 8:60669343-60669365 CTTTCACAGCAGGGTGACCTTGG + Intergenic
1041698493 8:60762457-60762479 CTTAGTGAGCTGTGTGGCCTGGG + Intronic
1041797567 8:61761403-61761425 CTTACTCAGCTGTGTGACTCAGG + Intergenic
1042575316 8:70211567-70211589 CTTCAACAGCTATGTAACCTAGG + Intronic
1042848137 8:73188531-73188553 ATTAAACAGCTGTGTGACCTTGG + Intergenic
1042871155 8:73400869-73400891 CTGACTCAGATGTGTGACCTAGG + Intergenic
1043488217 8:80720025-80720047 ATTTAATAGCTGTGTGACCTTGG - Intronic
1044779148 8:95725276-95725298 ATCTAACAGCTGTGTGACCTCGG + Intergenic
1045189358 8:99867594-99867616 ACTTAACAGCTGTGTGACCTTGG + Intronic
1045267480 8:100632062-100632084 CCTCACCAGCTGTGTGACCTTGG - Intronic
1045631672 8:104131144-104131166 CTTACACAACTCTGTGAAGTAGG - Intronic
1045720725 8:105107447-105107469 CCTTAACAGCTGTGTGACCTTGG + Intronic
1045826789 8:106407593-106407615 ATTACCCAGCTATGTGATCTTGG - Intronic
1045835186 8:106512193-106512215 ATTTACCAGCTGTGTGACCTTGG - Intronic
1046687052 8:117239304-117239326 ATCACACAGCTGGGTGACCTTGG + Intergenic
1046744900 8:117866362-117866384 CTTCACCAGCTGTGTCACCTTGG - Intronic
1046755374 8:117967830-117967852 CTTACACACTTGTGTGATCTTGG - Intronic
1047292934 8:123545523-123545545 CCTAAAAAGCTGTGTGATCTTGG + Intergenic
1047418808 8:124688839-124688861 CCTTCCTAGCTGTGTGACCTCGG + Intronic
1047481008 8:125283020-125283042 TCTTGACAGCTGTGTGACCTTGG + Intronic
1047809570 8:128393703-128393725 CTGCAACAGCTGTGTGATCTTGG - Intergenic
1048056061 8:130866752-130866774 ATTACACAGACATGTGACCTGGG + Intronic
1048074427 8:131053644-131053666 CCTTGACAGCTCTGTGACCTTGG + Intergenic
1048076530 8:131077649-131077671 ACTACATAGCTGTGTGGCCTTGG + Intergenic
1048207052 8:132423700-132423722 CACTTACAGCTGTGTGACCTCGG - Intronic
1048352751 8:133629299-133629321 CCTTCCCAGCTGTGTAACCTGGG + Intergenic
1048607109 8:135980716-135980738 CTTTCTTAGCTGTGTGTCCTGGG + Intergenic
1048607979 8:135990100-135990122 CTTACCCTGCTGTGTGCTCTGGG + Intergenic
1048777636 8:137964990-137965012 CTTCACTAGCTGTGTGACCTTGG + Intergenic
1048851032 8:138645692-138645714 CCATCTCAGCTGTGTGACCTTGG - Intronic
1049109296 8:140633772-140633794 CACTCACTGCTGTGTGACCTTGG + Intronic
1049253864 8:141603677-141603699 CCTTCACAGCTGGGTGTCCTTGG + Intergenic
1049332056 8:142059790-142059812 CTTAACCAGCTGTGCGACCTTGG - Intergenic
1049356963 8:142193767-142193789 CCTGGCCAGCTGTGTGACCTAGG - Intergenic
1049603968 8:143520569-143520591 CTTACAAGGCTGGGTGATCTCGG - Intronic
1050289417 9:4138651-4138673 CCTTACCAGCTGTGTGACCTTGG + Intronic
1050318441 9:4426809-4426831 CTTACACAACTCTGTGAAGTGGG - Intergenic
1050771867 9:9211865-9211887 CTGAAACAGTTGTGTAACCTGGG - Intronic
1051108697 9:13610261-13610283 CTTCACTAGCTGTGTGACCTAGG + Intergenic
1051264194 9:15295465-15295487 CTAAGCCAGCTGAGTGACCTCGG + Intronic
1052317006 9:27125600-27125622 ATGTGACAGCTGTGTGACCTTGG + Intronic
1052360136 9:27545738-27545760 CTTTACCAGCTGTGTGACCTTGG + Intergenic
1052495540 9:29219082-29219104 CTTAAGCAGCTATGTGACCTTGG - Intergenic
1052865629 9:33463218-33463240 CCTAAACAGCTGAATGACCTGGG - Intronic
1052979452 9:34437615-34437637 CTTACTAGGTTGTGTGACCTTGG + Intronic
1053410208 9:37911462-37911484 CCTTTCCAGCTGTGTGACCTGGG - Intronic
1054814461 9:69461678-69461700 ACTTCACAGCTGTGTGACCTGGG - Intronic
1054973637 9:71117611-71117633 CCTAACCAGCTGTGTGACCTTGG - Intronic
1056101660 9:83305639-83305661 CTGGCCCAGCTGTGGGACCTTGG - Intronic
1056310368 9:85334663-85334685 CATTAACAGCTGTGTGACCTTGG + Intergenic
1056456636 9:86766849-86766871 ATGACATAGCTGTGTGTCCTTGG - Intergenic
1056529563 9:87474862-87474884 CTATCACAGTTGTGTGACATTGG - Intergenic
1056910579 9:90696557-90696579 ACTAGCCAGCTGTGTGACCTGGG + Intergenic
1057268665 9:93635014-93635036 CTCTTCCAGCTGTGTGACCTTGG - Intronic
1057270423 9:93647275-93647297 CTTCCACAGCTCTGAGAGCTGGG + Intronic
1057712904 9:97463214-97463236 GTTTCACTGCTGTGTTACCTAGG - Intronic
1057836058 9:98446409-98446431 CTCTTAGAGCTGTGTGACCTTGG - Intronic
1058619770 9:106870747-106870769 CTGACACAGTTGTCTCACCTGGG - Intronic
1058703689 9:107621558-107621580 ACAACACAGCTGTGTGACCTGGG - Intergenic
1059332533 9:113544741-113544763 CCTTACCAGCTGTGTGACCTAGG - Intronic
1059362131 9:113753166-113753188 GTTAACCTGCTGTGTGACCTTGG - Intergenic
1059402511 9:114079051-114079073 CACTCACTGCTGTGTGACCTTGG + Intergenic
1059465220 9:114465063-114465085 CTTTCATAGCTGTGTGATCTTGG - Intronic
1059666400 9:116450453-116450475 GTTAGAGAGCTGTGTGACCTTGG - Intronic
1059718446 9:116935315-116935337 TTAAAATAGCTGTGTGACCTTGG + Intronic
1059908974 9:119021464-119021486 CTTACTCAGCTTTGTGACCAAGG - Intergenic
1059937169 9:119322773-119322795 CCTTCAAAGCTGAGTGACCTTGG + Intronic
1059969333 9:119648870-119648892 ATTAACCAGCTGTGTGACCTTGG - Intergenic
1060368886 9:123049955-123049977 CTTACTAATTTGTGTGACCTTGG - Intronic
1060821389 9:126663496-126663518 CTTCCACAGTTGTGTGACCTTGG + Intronic
1060932267 9:127496674-127496696 CTCACTCTGCTGTGTGACCTTGG - Intronic
1060996441 9:127877015-127877037 ATCACTCAGCTGTGTGACCTTGG + Intronic
1061054730 9:128216321-128216343 CCCACTCTGCTGTGTGACCTTGG + Intronic
1061071723 9:128314938-128314960 CTCTGACAGCTGTGTGTCCTTGG - Intronic
1061223105 9:129263878-129263900 CATTACCAGCTGTGTGACCTTGG - Intergenic
1061294901 9:129671780-129671802 CTTTCCCAGCTGTGAGGCCTCGG - Intronic
1061373084 9:130208860-130208882 CACACAGAGCTGTGTGACCTGGG - Intronic
1062434333 9:136540038-136540060 CTGCCACTGCTGTGTGACCCTGG + Intronic
1185785130 X:2884460-2884482 TATACCCAGCTGTGTGACATGGG + Intergenic
1185798303 X:2985783-2985805 GCTTCCCAGCTGTGTGACCTCGG + Intergenic
1185875476 X:3698637-3698659 CATACACAGTGGTGTGATCTCGG + Intronic
1186995205 X:15114244-15114266 CCTACTTAGCTGTGTGACCTTGG - Intergenic
1186998948 X:15155490-15155512 ATTTCACAGCTCTGTGACCTTGG - Intergenic
1187234089 X:17450492-17450514 CTTAACCAGCTGTGTGATCTTGG - Intronic
1187338526 X:18401531-18401553 GCTTCCCAGCTGTGTGACCTTGG - Intergenic
1189245388 X:39559457-39559479 CTTCCACCTCTTTGTGACCTCGG - Intergenic
1189260160 X:39672837-39672859 ATTGAACAGCAGTGTGACCTTGG - Intergenic
1189397102 X:40632740-40632762 CTTAACTAGCTGTGTGACTTTGG + Intronic
1190289391 X:48982248-48982270 ATTTCCTAGCTGTGTGACCTTGG - Intronic
1191713442 X:64177049-64177071 CCTGCTCATCTGTGTGACCTTGG - Intergenic
1191868007 X:65721275-65721297 GTTACTTCGCTGTGTGACCTTGG + Intronic
1192048020 X:67696915-67696937 ATTATCTAGCTGTGTGACCTGGG + Intronic
1192109206 X:68347161-68347183 CATTTACAGCTATGTGACCTTGG + Intronic
1192135374 X:68593605-68593627 TTTACACAGCTGTGTGTTCCAGG - Intergenic
1192144076 X:68669297-68669319 CTTTGCCAGCTGTGTGTCCTTGG + Intronic
1192196663 X:69033331-69033353 CTTTACCAGCTGTGTGAACTTGG - Intergenic
1193168299 X:78306680-78306702 TTCACTTAGCTGTGTGACCTTGG + Intronic
1193974149 X:88097000-88097022 ATTACACAGCACAGTGACCTGGG - Intergenic
1193999938 X:88415683-88415705 CCTATAAAGCTGTGGGACCTTGG - Intergenic
1194237965 X:91408268-91408290 CTTACAAAGCTGATAGACCTCGG - Intergenic
1194458267 X:94131808-94131830 CTCACTTGGCTGTGTGACCTTGG - Intergenic
1194686212 X:96920545-96920567 CTTACACAGCTGGGTGATTTTGG - Intronic
1194970892 X:100342582-100342604 TTTTACCAGCTGTGTGACCTTGG - Intronic
1195343246 X:103925239-103925261 CTTACTTAATTGTGTGACCTTGG - Intronic
1195585488 X:106560560-106560582 CTTACACTGTTTTGTGACATTGG - Intergenic
1195588285 X:106592271-106592293 ACTTCCCAGCTGTGTGACCTGGG + Intergenic
1195688927 X:107608306-107608328 ATTTACCAGCTGTGTGACCTTGG - Intergenic
1195867685 X:109450953-109450975 ATTAAATAGCTGTGTGACCTTGG - Intronic
1195995181 X:110724600-110724622 GTTAAACAGCTGTGTGACATGGG - Intronic
1196050470 X:111298580-111298602 CCCAGCCAGCTGTGTGACCTTGG + Exonic
1196071543 X:111529080-111529102 ATTTGTCAGCTGTGTGACCTGGG - Intergenic
1196376760 X:115041237-115041259 CTTGTATAGCTGTGTGACCTTGG - Intergenic
1196575244 X:117309622-117309644 TTTACTCAGCTGTGTAATCTTGG + Intergenic
1196703520 X:118696998-118697020 TTTACCAAGCTGTGGGACCTTGG + Intergenic
1196897965 X:120356739-120356761 TCTTCATAGCTGTGTGACCTTGG - Intergenic
1197198806 X:123731656-123731678 CTTAAGTAGCTGAGTGACCTTGG - Intronic
1197397646 X:125946887-125946909 GCCACATAGCTGTGTGACCTTGG - Intergenic
1197805882 X:130398154-130398176 ATTTACCAGCTGTGTGACCTAGG + Intergenic
1197848370 X:130829401-130829423 TTTACTTAGCTGTGAGACCTAGG - Intronic
1198431953 X:136576344-136576366 CTCATCCAACTGTGTGACCTTGG + Intergenic
1198505599 X:137298055-137298077 CTTACCTTGCTGTGTGACCTTGG - Intergenic
1198810684 X:140533297-140533319 CTGCCACAGCTGTGTAACCTTGG + Intergenic
1199297158 X:146172284-146172306 CTGCCACAACTGTGGGACCTTGG - Intergenic
1199899799 X:152161891-152161913 CTGTCCCAGCTGTGTGAACTTGG - Intergenic
1200069600 X:153521421-153521443 CCTACTCAGCCATGTGACCTTGG - Intronic