ID: 1105543890

View in Genome Browser
Species Human (GRCh38)
Location 13:21338006-21338028
Sequence CTGTGTAAGTAGAAGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105543889_1105543890 -9 Left 1105543889 13:21337992-21338014 CCAAGGTCACACAGCTGTGTAAG 0: 3
1: 3
2: 23
3: 195
4: 971
Right 1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG 0: 2
1: 0
2: 0
3: 12
4: 156
1105543886_1105543890 14 Left 1105543886 13:21337969-21337991 CCCAGAGAAGTTAAGTGACTTGT 0: 2
1: 33
2: 210
3: 754
4: 1992
Right 1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG 0: 2
1: 0
2: 0
3: 12
4: 156
1105543887_1105543890 13 Left 1105543887 13:21337970-21337992 CCAGAGAAGTTAAGTGACTTGTC 0: 1
1: 29
2: 186
3: 772
4: 1956
Right 1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG 0: 2
1: 0
2: 0
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105543890 Original CRISPR CTGTGTAAGTAGAAGTATGA AGG Intergenic
901700219 1:11041321-11041343 ATGGGTAGGTAGAAGGATGATGG + Intronic
902853806 1:19184357-19184379 TTGTGTAAGTAGAATTAGGTGGG - Intronic
906139047 1:43522551-43522573 ATGTGTAACAAGAAGTATAAAGG + Intergenic
907424893 1:54373358-54373380 CTCTGTAACTAGAATCATGAAGG - Intronic
909787098 1:79627620-79627642 CTGTGTGAATAGAACTAGGATGG - Intergenic
910770575 1:90827150-90827172 CTGTGAAAGTTGGAGTTTGAGGG + Intergenic
914797656 1:150934506-150934528 GAGTGAAAGTAGAAGTATGCTGG - Intronic
916432432 1:164744004-164744026 CTAGGTAACTAGAAGTCTGATGG + Intronic
916478910 1:165197550-165197572 CAGTGTAGGTAAAAGTATGGAGG - Intergenic
919335982 1:196234442-196234464 CTATGTAAATAGATTTATGAAGG - Intronic
921952976 1:220951984-220952006 CTGAGTTAGAAGAAGTAAGAAGG + Intergenic
922365594 1:224860530-224860552 CTTTGTTAGTATAAGTGTGATGG - Intergenic
1065509830 10:26467223-26467245 CTTTGAGAATAGAAGTATGAGGG + Intronic
1068303228 10:55173347-55173369 ATGTGTATGTAGAAGGATGGGGG + Intronic
1069259061 10:66371285-66371307 CTGTATATGTAAAAGTATAAAGG - Intronic
1070002386 10:72389569-72389591 CAGTGTAAGTAGAATTGTGCAGG + Intronic
1073584810 10:104699597-104699619 GTGTGGAAGTAGGAATATGATGG + Intronic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1073937953 10:108657523-108657545 CTGTGTATGTAGAAATTTTATGG + Intergenic
1074086664 10:110213381-110213403 CTCTGTAGGTTGAAGTATGGTGG + Intronic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1085325592 11:75604098-75604120 GTGAGGAAGGAGAAGTATGAAGG - Intronic
1087729047 11:101757934-101757956 CCATGTATGTAGAAGCATGATGG - Intronic
1088459956 11:110072229-110072251 CTGTGTAAGTGATACTATGAAGG + Intergenic
1091644498 12:2263532-2263554 CGGTGTTGGTAGAAGTGTGACGG + Intronic
1093662142 12:21769257-21769279 CTCTATAAGTAGAACTATAAAGG + Intronic
1097289509 12:57902585-57902607 CTGTGTAAGTAGGAGCAATAGGG + Intergenic
1100620545 12:96268077-96268099 CTGTGTCAGTATAAGTAAGTTGG + Exonic
1105466994 13:20653260-20653282 CTTTCTAAGTAGAAGCCTGATGG - Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1109370080 13:61412342-61412364 CTGTCTAAGGAAAAATATGATGG + Exonic
1109843348 13:67949959-67949981 CTCTAGAAGTAGTAGTATGATGG - Intergenic
1110516637 13:76420483-76420505 CTGTGAAAGGAAAACTATGAAGG - Intergenic
1117400865 14:55357525-55357547 CTGTTTATTAAGAAGTATGAAGG + Intronic
1118107686 14:62678751-62678773 CTGTGTAACTACAAGTATTTTGG - Intergenic
1119534144 14:75387157-75387179 CAGTGAAAGTAGAAATTTGAGGG + Intergenic
1121960085 14:98251527-98251549 ATGTTTAAGTAGGAGTAAGAAGG + Intergenic
1124854104 15:33370389-33370411 CTGTGCCAGTAAAAGTATCAAGG - Intronic
1125143809 15:36442009-36442031 CTGTTTAAGAATAAGTATGCAGG - Intergenic
1126460807 15:48913314-48913336 CTGTGTACCTAGAAGGATTATGG + Intronic
1126744234 15:51809530-51809552 CTGTGAAAGTACAAGTGAGATGG + Exonic
1126837961 15:52686888-52686910 CTGTGCAAGTTGAAATAAGAAGG - Intronic
1130082903 15:80750190-80750212 CTTTGTAAATAGAAGAATAAAGG + Intronic
1131051602 15:89351803-89351825 GTGTGTAAGCAGAACCATGAGGG - Intergenic
1131796629 15:96024320-96024342 CTCTCCAACTAGAAGTATGATGG - Intergenic
1134163214 16:11909207-11909229 CTTTGAAAGTAGAATTATGATGG + Intronic
1135214410 16:20552433-20552455 ATGTTTAAGTATAAGTAGGAAGG + Intronic
1137025057 16:35465742-35465764 CAGTGTAAGTAGTAGTGTCAGGG - Intergenic
1137577101 16:49607425-49607447 CTGTGTATGTTGATGTTTGATGG + Intronic
1140357291 16:74317318-74317340 CTGTGTAAGTATGATTGTGATGG + Intergenic
1141045192 16:80709707-80709729 CTGTGGAAGTAGATGTGAGAAGG - Intronic
1143693444 17:8590702-8590724 CTGTGTAAGTAAATGAATAAAGG - Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146986030 17:37219076-37219098 CTGTGTGATTAGAAGGTTGAGGG + Intronic
1149198803 17:54157798-54157820 GTGTGGAAGTAGAAAAATGAAGG + Intergenic
1151073864 17:71248725-71248747 CTGTGTAAGTTGAAATAGAAGGG + Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1152872731 17:82766645-82766667 CTGTGTAAGTATAACTGTGTTGG + Intronic
1153043593 18:836232-836254 CAGTTTTAGTAGAAGAATGAGGG + Intergenic
1154099028 18:11451488-11451510 CTCTTTAAGTTGAAGTCTGATGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929086835 2:38176414-38176436 CTGTCTAACTAAAATTATGAAGG + Intergenic
932688786 2:73895025-73895047 CCGTGCAGGTAGAAGTAAGAAGG + Intronic
935020214 2:99223065-99223087 CTGTGTAAGTAAAAATAGGATGG - Intronic
936759836 2:115763747-115763769 TTGTGGAAGTGCAAGTATGAGGG - Intronic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937579761 2:123470531-123470553 CTGTGTATGTCAAAGTAAGAGGG + Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
944306467 2:198185431-198185453 CTGTATACCTAGAAGTTTGAAGG + Intronic
945693460 2:213071632-213071654 GTGTGGAAGGAGAAGTATAAAGG + Intronic
948201627 2:236133582-236133604 GTGTGTAAGTGGAGGCATGAGGG - Intergenic
948798165 2:240416865-240416887 TTGTGTAAGTAGAAGAATTCAGG - Intergenic
1169726689 20:8741390-8741412 ATGAGTAAGTAGATGAATGATGG + Intronic
1170329578 20:15193752-15193774 CTGTGAGAGTAGGAGAATGAAGG - Intronic
1172105172 20:32512755-32512777 CTTTGTAAGTAGAATTTTTATGG + Intronic
1172976248 20:38908068-38908090 CTGTATAGGAAGGAGTATGAGGG + Exonic
1173148565 20:40546422-40546444 CTCTGTGAGTACAAGGATGAGGG + Intergenic
1174061172 20:47834035-47834057 CTGTGTCCGTTGAAGTTTGAGGG - Intergenic
1174100495 20:48123065-48123087 CTGTGTTAGTTGAAGTTTGAGGG - Intergenic
1174153446 20:48501938-48501960 CTGTGTCAGTTGAAGTTTGAGGG - Intergenic
1174153534 20:48502445-48502467 GTGTGTCAGTTGAAGTTTGAGGG - Intergenic
1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG + Intronic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
949792712 3:7810667-7810689 CTCTGTCAGTAGAAGCATTAAGG - Intergenic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
955199993 3:56842982-56843004 TTGTATAACTAGAAGTTTGAGGG - Intronic
956454859 3:69410396-69410418 GTGTGTGAGTATGAGTATGAGGG + Intronic
958606691 3:96367048-96367070 CTTTGTACATAGAAATATGATGG - Intergenic
960345764 3:116530360-116530382 CTGTATAGGTAGAAGTTTAAAGG + Intronic
964098170 3:152957817-152957839 CTGTGTAGACAGATGTATGAGGG - Intergenic
964424370 3:156535670-156535692 CTGAGTAACTAGAAGTATATTGG - Intronic
967465943 3:189806251-189806273 CTGTGTAGCTAGAAGCAGGAGGG + Intronic
967874249 3:194256032-194256054 CAGTGTAAGGAGGAGTGTGAGGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
970119907 4:12741965-12741987 CTGAGGAAGTAGAATAATGAAGG - Intergenic
971659161 4:29389810-29389832 CTGTGTAGCTAGAAGCAAGATGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975796644 4:78012922-78012944 CTGTGTACCAAGAAGAATGATGG - Intergenic
976098022 4:81529287-81529309 TTGTGTAAGTGGATGGATGATGG + Intronic
976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG + Intergenic
980087195 4:128403623-128403645 CTGTGTACCTAGAAGGATTATGG + Intergenic
981721142 4:147802661-147802683 CAGTGTAAGTAGAAGTTACAGGG - Intronic
982134712 4:152263767-152263789 CTGTGTAATTGGAAAAATGAAGG - Intergenic
982433414 4:155351066-155351088 CTGTGAAAGAAGAACTATAAAGG + Intronic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
985198380 4:187458447-187458469 TTGGGTAATTAGATGTATGATGG - Intergenic
987295943 5:16551491-16551513 CTGGGCAAGTAGAAATAAGAAGG - Intronic
990315541 5:54579526-54579548 CTCTGTAAATAGATGGATGAAGG - Intergenic
990703629 5:58502306-58502328 CTGTGTATGTAGCAGCAAGAAGG + Intergenic
991386940 5:66101124-66101146 TTGTGTAACCAGGAGTATGATGG - Intergenic
995410955 5:111856493-111856515 CTGTGTTCGAAGCAGTATGATGG + Intronic
996876286 5:128243718-128243740 GTGAGTAAGTAGATGGATGATGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG + Intergenic
1001987868 5:176091018-176091040 ATGTGTATGTGGAAGTATGTTGG + Intronic
1002229004 5:177747123-177747145 ATGTGTATGTGGAAGTATGTTGG - Intronic
1002266342 5:178036660-178036682 ATGTGTATGTGGAAGTATGTTGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003691810 6:8362271-8362293 GTCTGTAAGTGGAAGTGTGATGG - Intergenic
1005421379 6:25654922-25654944 TTGTGTAGGTACAAGAATGAAGG - Intronic
1007220950 6:40278311-40278333 CCCTGTAAGGACAAGTATGAGGG + Intergenic
1009983619 6:70756521-70756543 TTGTGTGAGTAAAAGTATGGAGG + Intronic
1010508352 6:76687634-76687656 CTGTGGAATTAGAGGTATTACGG + Intergenic
1014235037 6:118944370-118944392 CTGTGAAAGTAGTACTAAGAGGG + Intergenic
1014603888 6:123448507-123448529 TTGTGTAAGTAGGAGGATTATGG - Intronic
1015509148 6:134020314-134020336 TTGTGTAAATAGAGGTATGAAGG - Intronic
1015627533 6:135195999-135196021 TTCTGTAAGTAGAATTGTGAAGG + Exonic
1016633019 6:146254026-146254048 GTGTGTATGTATAAGTTTGAGGG + Intronic
1018309606 6:162494202-162494224 CTGTGTAAGCTGCAGAATGAAGG - Intronic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1021508250 7:21408615-21408637 ATGAGGAAGTAGAGGTATGAAGG + Intergenic
1025233427 7:57218076-57218098 GTGTGTCAGTTGAAGTTTGATGG + Intergenic
1025233583 7:57218954-57218976 GTGTGTCAGTTGAAGTTTGAGGG + Intergenic
1027418074 7:77993449-77993471 CTCTGTAAGCAGAGGTATGCTGG - Intergenic
1030166641 7:106562191-106562213 CTGTGTAAGTCCCAGTCTGAGGG - Intergenic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1032634669 7:133693552-133693574 CTGTGTAATTAGGAGTGTGATGG - Intronic
1032825160 7:135561582-135561604 CTCTGTGACTAGAAGTCTGAGGG - Intronic
1034717738 7:153259130-153259152 CTAAGTTTGTAGAAGTATGAGGG - Intergenic
1036665851 8:10737636-10737658 CTGTGTAAATATAAGTTTTAAGG + Intronic
1037058023 8:14469207-14469229 CTGTATAGGTAGTAGTAAGATGG - Intronic
1041170439 8:55136481-55136503 TTGAGTAAGTAGTAGTATGTGGG + Intronic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041461694 8:58118632-58118654 CTTTGTAACTAAAAGTGTGAAGG - Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1049119644 8:140723078-140723100 GTGTGTAGGTAGAAATATCAGGG - Intronic
1050756093 9:9005350-9005372 ATGTGTAAGTGGAAGTAGCATGG + Intronic
1056738905 9:89235813-89235835 CTGTGGAAGAAAAAGTCTGATGG - Intergenic
1057933163 9:99213376-99213398 CTTTGGTAGTAGAAGTATTAAGG + Intergenic
1058204656 9:102088241-102088263 CTGTTTCTGTAGAAGTATGCAGG + Intergenic
1060421684 9:123473637-123473659 TTGTGTAGGAAGCAGTATGAGGG + Intronic
1061346865 9:130033428-130033450 CTGTGCAAATAGAAGTACAAGGG + Intronic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1191934617 X:66413034-66413056 CTCTGTAAAAAGAAGTATGTTGG - Intergenic
1195638696 X:107149812-107149834 CTGTGGCAGTAGTAGTAAGAGGG - Intronic
1195718819 X:107845868-107845890 CAGTGTAAGTATAAATATAAGGG + Intronic
1198585693 X:138118280-138118302 CTGTGTTAGCAAAAATATGAAGG - Intergenic
1198873893 X:141202889-141202911 CTGTATAGGTAGAAAGATGAGGG - Intergenic
1201961684 Y:19687885-19687907 CTGTGTAAGTAACAAAATGAAGG - Intergenic
1202253060 Y:22892948-22892970 CTGTGTGAGTCCAAGTATGAGGG + Intergenic
1202406050 Y:24526697-24526719 CTGTGTGAGTCCAAGTATGAGGG + Intergenic
1202464730 Y:25143384-25143406 CTGTGTGAGTCCAAGTATGAGGG - Intergenic