ID: 1105545429

View in Genome Browser
Species Human (GRCh38)
Location 13:21347510-21347532
Sequence GTGCCTGAAGGTCCGTCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 63}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105545421_1105545429 8 Left 1105545421 13:21347479-21347501 CCCATGCCAGGGAGGTCAGTAGG 0: 1
1: 1
2: 0
3: 13
4: 158
Right 1105545429 13:21347510-21347532 GTGCCTGAAGGTCCGTCCTAAGG 0: 1
1: 1
2: 0
3: 7
4: 63
1105545424_1105545429 2 Left 1105545424 13:21347485-21347507 CCAGGGAGGTCAGTAGGCAGCCT 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1105545429 13:21347510-21347532 GTGCCTGAAGGTCCGTCCTAAGG 0: 1
1: 1
2: 0
3: 7
4: 63
1105545419_1105545429 12 Left 1105545419 13:21347475-21347497 CCCACCCATGCCAGGGAGGTCAG 0: 1
1: 1
2: 1
3: 28
4: 224
Right 1105545429 13:21347510-21347532 GTGCCTGAAGGTCCGTCCTAAGG 0: 1
1: 1
2: 0
3: 7
4: 63
1105545420_1105545429 11 Left 1105545420 13:21347476-21347498 CCACCCATGCCAGGGAGGTCAGT 0: 1
1: 1
2: 3
3: 11
4: 178
Right 1105545429 13:21347510-21347532 GTGCCTGAAGGTCCGTCCTAAGG 0: 1
1: 1
2: 0
3: 7
4: 63
1105545415_1105545429 19 Left 1105545415 13:21347468-21347490 CCCGGTTCCCACCCATGCCAGGG 0: 1
1: 1
2: 6
3: 36
4: 414
Right 1105545429 13:21347510-21347532 GTGCCTGAAGGTCCGTCCTAAGG 0: 1
1: 1
2: 0
3: 7
4: 63
1105545423_1105545429 7 Left 1105545423 13:21347480-21347502 CCATGCCAGGGAGGTCAGTAGGC 0: 1
1: 0
2: 2
3: 15
4: 151
Right 1105545429 13:21347510-21347532 GTGCCTGAAGGTCCGTCCTAAGG 0: 1
1: 1
2: 0
3: 7
4: 63
1105545417_1105545429 18 Left 1105545417 13:21347469-21347491 CCGGTTCCCACCCATGCCAGGGA 0: 1
1: 1
2: 0
3: 29
4: 292
Right 1105545429 13:21347510-21347532 GTGCCTGAAGGTCCGTCCTAAGG 0: 1
1: 1
2: 0
3: 7
4: 63
1105545413_1105545429 29 Left 1105545413 13:21347458-21347480 CCAACGAGCTCCCGGTTCCCACC 0: 2
1: 0
2: 1
3: 3
4: 153
Right 1105545429 13:21347510-21347532 GTGCCTGAAGGTCCGTCCTAAGG 0: 1
1: 1
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105545429 Original CRISPR GTGCCTGAAGGTCCGTCCTA AGG Intergenic
902047327 1:13535549-13535571 ATGCCTGAAGTTCCTTCCTAGGG + Intergenic
903758647 1:25682587-25682609 GTGGCTGAAGGTCTGTGGTATGG + Intronic
906144850 1:43553932-43553954 GTGCTCGAAGGTACGTGCTAGGG + Exonic
911402120 1:97388455-97388477 GTGCCCCCAGGTCAGTCCTAGGG - Intronic
912239130 1:107886425-107886447 GTGCCTGCAGTCCAGTCCTAAGG - Intronic
917194218 1:172449115-172449137 GTGCCTGAAGCAGCGTCCTAAGG + Intronic
921955109 1:220974376-220974398 GTGCCTGAACGTCTCACCTACGG - Intergenic
1067297333 10:44982375-44982397 GTGGCTGATGGTCCTTCCTGAGG + Intronic
1072527626 10:96287554-96287576 GTGCCTGTGGGTCCTTCCAATGG - Intergenic
1073059106 10:100722920-100722942 GTGTCTGCAGGCCTGTCCTAGGG + Intergenic
1080893346 11:36428203-36428225 GTGCCTGAAAATCCCTCCTGGGG + Intronic
1089077407 11:115749379-115749401 AAGCCTGAAGGACTGTCCTAAGG - Intergenic
1098474980 12:70890160-70890182 ATGCCTCAAGGTCAGTACTATGG - Intronic
1104611098 12:130228448-130228470 GGGCCTGAAGGTCTTTCCTGAGG + Intergenic
1105209954 13:18251921-18251943 GTCCCTGAATGTCCTTCCTCAGG + Intergenic
1105545429 13:21347510-21347532 GTGCCTGAAGGTCCGTCCTAAGG + Intergenic
1111632163 13:90855741-90855763 GTGCCTGAAGGGCTGTTTTATGG - Intergenic
1118060236 14:62129499-62129521 GTGTCTGAAGTTTTGTCCTATGG + Intergenic
1119860312 14:77931394-77931416 GTGCCTGAAGCTCCCTCCTGGGG + Intronic
1123025513 14:105421864-105421886 GTGCCCGCAGGCCCGTCCCAGGG + Intronic
1123027935 14:105437351-105437373 GTGGCTGCAGGTGCGTCCTCAGG + Intronic
1132423539 15:101694555-101694577 GTGCCTCAAGGTCCTCCCTGAGG - Intronic
1141768491 16:86074166-86074188 GTGTCTGTAGGTCCCTCCTGGGG + Intergenic
1147162841 17:38578110-38578132 GTGCCTGAGAGTCCATCCTGTGG - Intronic
1151875108 17:76863515-76863537 GTGCCTGAAAATCCCTCCTCTGG - Intergenic
1152470327 17:80487564-80487586 GTGGCTGGAGCTCCGTCCTTTGG - Intergenic
1158606480 18:58900587-58900609 GATCATGAAGCTCCGTCCTAAGG - Intronic
1164551576 19:29216767-29216789 CTGCCTGCAGGTCCCTCCTCTGG - Intergenic
1164720512 19:30428641-30428663 GTGCCAGAAGTTATGTCCTATGG - Intronic
1167229336 19:48271835-48271857 GTGCCTGAGTGTCCGTACTAAGG + Intronic
925425807 2:3748011-3748033 GTGCCTGAGGGTCCCTCTGATGG - Intronic
927113988 2:19884274-19884296 GTGCCTGAAGGTCCTGGCTGTGG + Intergenic
931817210 2:65916422-65916444 GTGCCTGAATATCAGTCCTAGGG + Intergenic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1171291102 20:23983611-23983633 GTCCCTGAATGTCCTTCCTCAGG + Intergenic
1172660348 20:36563870-36563892 GTCCCTGAAGGTGTGTCCTCTGG - Intergenic
1174087519 20:48019679-48019701 GGGCCTGAAGGTCTTTCCAAAGG + Intergenic
1175269054 20:57720978-57721000 GTTACTGAAGGGCCGTTCTATGG - Intergenic
1175650356 20:60716233-60716255 GTGCCTGTAAGTCCATCCTTTGG + Intergenic
1180766305 22:18347482-18347504 GTCCCTGAATGTCCTTCCTCAGG - Intergenic
1180780008 22:18514896-18514918 GTCCCTGAATGTCCTTCCTCAGG + Intergenic
1180812724 22:18772217-18772239 GTCCCTGAATGTCCTTCCTCAGG + Intergenic
1181198882 22:21206465-21206487 GTCCCTGAATGTCCTTCCTCAGG + Intergenic
1181510408 22:23386400-23386422 GTGCCTGATGGTCGGTGCCAAGG - Intergenic
1181529913 22:23511556-23511578 GTGCCTGAAGGTCCCCTCTTGGG + Intergenic
1181648531 22:24246580-24246602 GTCCCTGAATGTCCTTCCTCAGG + Intergenic
1181702839 22:24630422-24630444 GTCCCTGAATGTCCTTCCTCAGG - Intergenic
1203227923 22_KI270731v1_random:88372-88394 GTCCCTGAATGTCCTTCCTCAGG - Intergenic
954791363 3:53135763-53135785 GTGCCTGAAGATCCCACCTCAGG - Intergenic
969598471 4:8161955-8161977 GTGCCTGAAAGCGCGTCCCAGGG - Intergenic
971858726 4:32077562-32077584 CTGCCTGAAGGACCGGCCTGAGG + Intergenic
977473355 4:97471582-97471604 GTGCCTGAGGGACCATCTTAGGG + Intronic
982210849 4:153034549-153034571 GTGCCTGAAGTAAGGTCCTAAGG - Intergenic
983236515 4:165186564-165186586 GTGCCTGAAAGGACTTCCTAAGG + Intronic
990810104 5:59713980-59714002 GTGCCTGAAGGCCTGGCATAGGG + Intronic
992748369 5:79840350-79840372 GAGCCTCAAGGGCTGTCCTATGG + Intergenic
1003406193 6:5828977-5828999 ATGCCTGAAGGTCCGTCCTAAGG - Intergenic
1007414193 6:41682678-41682700 GGGCCTGAAGGACCGGCCTTGGG + Intergenic
1012000929 6:93653995-93654017 GTTCCTGAAGGTCCCTATTATGG + Intergenic
1021907750 7:25352484-25352506 GTGCCTGAGGCTCCCTCCAAAGG + Intergenic
1023612759 7:41988082-41988104 GTGCCTTAAGGGCCCTGCTATGG + Intronic
1027143309 7:75676365-75676387 GAGCCTCAAGGTCAGTCCAAGGG + Intronic
1032548277 7:132761725-132761747 ATGATTGAAGGTCCCTCCTAGGG - Intergenic
1035909739 8:3553251-3553273 GTGCCTGCAGCTCCGAACTATGG - Intronic
1038892158 8:31737753-31737775 GTCCCTTAAGGTCTGTTCTATGG + Intronic
1041798935 8:61776947-61776969 GTCCCTGTAGGTCAGTCCTGAGG + Intergenic
1052995757 9:34550979-34551001 GTGCTAGAAGGTCAGGCCTAGGG - Intergenic
1060962713 9:127692384-127692406 GTGCCTGCGGTTCCGTCCTAAGG - Exonic
1061204064 9:129152925-129152947 GTGTCTGCAGGACCTTCCTAGGG - Intergenic
1197355736 X:125436056-125436078 CAGACTGAAGGTCCTTCCTATGG + Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1199682700 X:150238693-150238715 GTGCCTGAGGGACAGTCCTAAGG + Intergenic