ID: 1105547122

View in Genome Browser
Species Human (GRCh38)
Location 13:21359103-21359125
Sequence GTATCGGAGGGCCCCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 2, 2: 9, 3: 6, 4: 29}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105547116_1105547122 11 Left 1105547116 13:21359069-21359091 CCAAATATGATGGCATGAGAAGA 0: 1
1: 1
2: 12
3: 76
4: 513
Right 1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG 0: 1
1: 2
2: 9
3: 6
4: 29
1105547114_1105547122 28 Left 1105547114 13:21359052-21359074 CCATCTGCAGAAAGCTGCCAAAT 0: 1
1: 2
2: 7
3: 39
4: 286
Right 1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG 0: 1
1: 2
2: 9
3: 6
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105547122 Original CRISPR GTATCGGAGGGCCCCCTCAA GGG Intergenic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913503669 1:119496029-119496051 GAATTGGAAGGCTCCCTCAAGGG - Intergenic
1067090632 10:43264407-43264429 GTATCAGAGGCCCTCCTCTATGG + Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1078665352 11:13320369-13320391 GAAGCTGAGGGCACCCTCAAAGG - Intronic
1082705551 11:56490578-56490600 GTATCTCAGACCCCCCTCAAAGG - Exonic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG + Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1138396783 16:56710487-56710509 GTATCTGAGAGCCTCCTCCAGGG + Intronic
1141612157 16:85187875-85187897 GTAGCTGAGGCCCCACTCAAAGG + Intergenic
1164879018 19:31715186-31715208 GCATCGGTGGAACCCCTCAAAGG - Intergenic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
946963478 2:225010317-225010339 GTGTGGGAGGGCACCCCCAAAGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1173405205 20:42758445-42758467 GTATCCCAGGCCCCCATCAAAGG + Intronic
1175585788 20:60138690-60138712 GGATCGGAGCGGCCGCTCAAAGG + Intergenic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
952963547 3:38607615-38607637 GTCACAGAGGGCCACCTCAAAGG - Intronic
963292196 3:143503461-143503483 GCTTTGGAGGGTCCCCTCAAGGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
979642351 4:123023899-123023921 GCCTCGGAGGGCCCCCAGAACGG - Intronic
984490666 4:180430993-180431015 GTATCCGAGGCCTCCCTAAAAGG - Intergenic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1016560654 6:145392281-145392303 GTCTCCGATGGCCTCCTCAAAGG + Intergenic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1030811321 7:113975630-113975652 GTCACTGAGGGCCCCCACAATGG - Intronic
1040307923 8:46221850-46221872 GTAGCGGAAGGCCCCCACTAGGG + Intergenic
1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1194826925 X:98576007-98576029 GTTTAGGAGGGCCACATCAAGGG + Intergenic
1198380452 X:136078416-136078438 CTTCAGGAGGGCCCCCTCAAGGG + Intergenic