ID: 1105549750

View in Genome Browser
Species Human (GRCh38)
Location 13:21381990-21382012
Sequence TCTAGCTAAAAGATCCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105549750 Original CRISPR TCTAGCTAAAAGATCCAGGG AGG Intronic
903033055 1:20477080-20477102 TCTTCCTAAAACACCCAGGGTGG + Intergenic
912126857 1:106550218-106550240 TCTAGCTAACATGTGCAGGGCGG + Intergenic
915056532 1:153137001-153137023 GCTAGCTAAAATAACCAAGGCGG + Intergenic
920556144 1:206906260-206906282 TCAAGATAAAATTTCCAGGGTGG + Intronic
923116621 1:230946237-230946259 TCTGGCTATAAGGTCCTGGGTGG + Intronic
924426852 1:243959108-243959130 CCAAGTTAAATGATCCAGGGTGG + Intergenic
1063593481 10:7412478-7412500 CCGAGCTGAGAGATCCAGGGCGG + Intergenic
1065635952 10:27734525-27734547 TGGAGCTAAAAGATCCCGAGTGG + Exonic
1066411506 10:35174912-35174934 CCTAGCTAAAGCATCCAGAGAGG - Intronic
1067914505 10:50381971-50381993 TCTAGCTGTAAAATGCAGGGTGG + Intronic
1070066497 10:73040063-73040085 TCTAGCTATACTATCCAGGCTGG + Intronic
1071928126 10:90434960-90434982 TCTATCTAGAAGTTCCAGGAGGG - Intergenic
1072394990 10:95030088-95030110 TCTACTTAAAAGATACAGAGTGG - Intergenic
1074059984 10:109956460-109956482 TCTTGCTAAAAGAACCTAGGTGG - Intergenic
1077593858 11:3514580-3514602 TGTAGCTTTAAGATCGAGGGAGG + Intergenic
1081656107 11:44858607-44858629 CCTAACTAACAGATCCATGGAGG - Intronic
1083304117 11:61753908-61753930 TCTGGCTAGATGTTCCAGGGAGG - Intronic
1084391956 11:68883097-68883119 GTTATCTAAAAGATCCAGGAAGG - Intergenic
1087636307 11:100705187-100705209 TCTGGCTAAAAGAAACAGAGGGG + Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1097768100 12:63548456-63548478 TCTATCTAGAAGAAGCAGGGTGG - Intergenic
1101093594 12:101313306-101313328 TCTAGCAGAATGATCCAGGGAGG + Intronic
1101805855 12:108063109-108063131 TCTATCATAAAGATCCAGTGAGG - Intergenic
1103409012 12:120697467-120697489 GCTGGCTCAGAGATCCAGGGAGG - Exonic
1104391332 12:128392928-128392950 TCTAGCTAAAAGCTGCATGATGG + Intronic
1105549750 13:21381990-21382012 TCTAGCTAAAAGATCCAGGGAGG + Intronic
1106136239 13:26975781-26975803 TCAAGTTAAAAGAACCAGGTGGG + Intergenic
1110340744 13:74387199-74387221 TCCAGTTAAAAGATACAGGAAGG - Intergenic
1112706876 13:102080331-102080353 TTTTGCTGAAAGAACCAGGGTGG + Intronic
1117124557 14:52608066-52608088 TCTAATTAAAAGATACAGAGTGG - Intronic
1117523466 14:56574601-56574623 TCTAGCTAAAAGACCAAGAAAGG + Intronic
1117805924 14:59490628-59490650 CCTACCTAATAAATCCAGGGTGG + Intronic
1124015655 15:25872453-25872475 TCTCGCTAAAATGTCCAGGCTGG - Intergenic
1130628569 15:85541549-85541571 CCTAGCAAAAAGAAACAGGGTGG + Intronic
1134820127 16:17240006-17240028 TTAAACTAAAAGATCCAGGAGGG - Intronic
1141867986 16:86763812-86763834 TGTAGCTAAAAGTTCCAGTGTGG + Intergenic
1146845041 17:36177094-36177116 TCTAGCTAGAGGATCCTGTGGGG + Intronic
1146857348 17:36265029-36265051 TCTAGCTAGAGGATCCTGTGGGG + Intronic
1146863271 17:36323346-36323368 TCTAGCTAGAGGATCCTGTGGGG - Intronic
1146873260 17:36388939-36388961 TCTAGCTAGAGGATCCTGTGGGG + Intronic
1146880615 17:36440025-36440047 TCTAGCTAGAGGATCCTGTGGGG + Intergenic
1147066131 17:37923934-37923956 TCTAGCTAGAGGATCCTGTGGGG - Intergenic
1147076140 17:37989564-37989586 TCTAGCTAGAGGATCCTGTGGGG + Intronic
1147077663 17:38003495-38003517 TCTAGCTAGAGGATCCTGTGGGG - Intronic
1147087665 17:38069110-38069132 TCTAGCTAGAGGATCCTGTGGGG + Intergenic
1147093599 17:38127429-38127451 TCTAGCTAGAGGATCCTGTGGGG - Intergenic
1147103607 17:38193059-38193081 TCTAGCTAGAGGATCCTGTGGGG + Intergenic
1149848185 17:60019580-60019602 TCTAGCTAGAGGATCCTGTGAGG + Intergenic
1149861985 17:60126944-60126966 TCTAGCTAGAGGATCCTGTGGGG - Intergenic
1150581822 17:66481222-66481244 CCAAACTAAAAGCTCCAGGGGGG + Intronic
1152287442 17:79421227-79421249 TACAGCTAAAAGACACAGGGTGG - Intronic
1152973511 18:189151-189173 TCTAGCAAGAAAATCAAGGGAGG - Intronic
1157869086 18:51212938-51212960 TCTAGCTTCTATATCCAGGGAGG - Intronic
1160151355 18:76396869-76396891 TGTAGCTATAATATCCACGGGGG + Intronic
1165601891 19:37060843-37060865 TACAGCCAAAAGATTCAGGGAGG - Intronic
1165733550 19:38161850-38161872 TCTTGCTACAGCATCCAGGGTGG - Intronic
925677952 2:6386095-6386117 TCTAGGTAACAGATCCCTGGTGG + Intergenic
927399755 2:22697290-22697312 TCTAGGAAACAGATCCAGGATGG + Intergenic
928369901 2:30733105-30733127 TCTAGTTATAAGCTCCAGGGAGG + Intronic
928460094 2:31464216-31464238 TCTCTCTGAAAGATCTAGGGAGG - Intergenic
928529086 2:32172407-32172429 TCTTGCTAAATTATCCAGGCTGG + Intronic
930899146 2:56482368-56482390 TCTAGCGGAAGGAGCCAGGGTGG - Intergenic
935833336 2:107023357-107023379 TTTAGATAAAAGGTCCAGGAAGG - Intergenic
940289833 2:152067678-152067700 TCTAGCTCCATGATCCAGAGGGG - Intronic
942498047 2:176560093-176560115 TCCTGCTGAAAGAACCAGGGTGG + Intergenic
944201174 2:197108896-197108918 TCTAGCAAGAATATCCAGGCAGG + Intronic
1169034205 20:2436339-2436361 CAGAGCTAAAAAATCCAGGGGGG - Intergenic
1173152360 20:40578447-40578469 TCTAGCTCAGTGATCCTGGGTGG + Intergenic
1175061971 20:56251877-56251899 GCAAGCTAAAACATACAGGGAGG - Intergenic
1182307677 22:29382240-29382262 TCTCGCTAAATTATCCAGGCTGG + Intronic
950829002 3:15855965-15855987 TCTAGATAAAACAGCCAGTGTGG - Intronic
950925625 3:16738315-16738337 TCTAGCTAATAGACCCAGCTGGG + Intergenic
954673763 3:52304527-52304549 TCTAGATCTAGGATCCAGGGTGG + Intergenic
955452738 3:59087410-59087432 TATAGCGAAAAAATCCAGTGGGG - Intergenic
957506510 3:81127698-81127720 TCTGCTTAAAAGATCCAGGATGG + Intergenic
959757290 3:109913954-109913976 TCTACCTAAAAGATACAGAATGG - Intergenic
962026744 3:131555776-131555798 TCTAGCAAAAAAATTAAGGGAGG - Intronic
962756472 3:138468893-138468915 TGTGGCTAAAAACTCCAGGGAGG + Intronic
985844997 5:2337458-2337480 TCTAACTGAAAGATTCAGTGGGG + Intergenic
987213404 5:15707912-15707934 TCCAGACAAAAGATACAGGGTGG - Intronic
992314244 5:75536444-75536466 TCTGGCTACAAGAGGCAGGGTGG + Intronic
992702951 5:79359297-79359319 CCTAACAAATAGATCCAGGGAGG - Intergenic
998036894 5:138925175-138925197 TCTAGCTGAGTGATTCAGGGAGG + Intronic
1007263106 6:40577444-40577466 TCAAACCAAAAGATCCAGGAGGG + Intronic
1011807119 6:91084573-91084595 TTTAGCTTAAATATCAAGGGAGG - Intergenic
1023250776 7:38258677-38258699 ACTTGCTAAAAGATTTAGGGAGG + Intergenic
1023709069 7:42972770-42972792 TCTAGCCAATAGAACGAGGGTGG - Intergenic
1024061097 7:45699290-45699312 TCTGGACAAAAGATCCAGGGAGG + Intronic
1026771711 7:73205594-73205616 TCTAGCTTAAATATCCGGGAAGG - Intergenic
1027012579 7:74758991-74759013 TCTAGCTTAAATATCCGGGAAGG - Intronic
1027075461 7:75187062-75187084 TCTAGCTTAAATATCCGGGAAGG + Intergenic
1029672696 7:102044871-102044893 TCTGGCTGGAAGATACAGGGAGG + Intronic
1029815416 7:103089616-103089638 TCTAGATAAAAGCTCTAGAGTGG + Intronic
1032999562 7:137488961-137488983 TCTAGCTAAAACGTCAAGTGAGG - Intronic
1033742966 7:144288687-144288709 CCTAGTTAAAAGATCAGGGGAGG - Intergenic
1033750935 7:144360927-144360949 CCTAGTTAAAAGATCAGGGGAGG + Intronic
1036119694 8:6002361-6002383 GGAAGCTAAAAGAGCCAGGGTGG + Intergenic
1037907012 8:22721527-22721549 TTTACCCATAAGATCCAGGGAGG + Intronic
1038395649 8:27243747-27243769 TCTAGCTGAAAGTTACAGAGTGG + Exonic
1038709776 8:29932826-29932848 TATAGGTATAAGATGCAGGGAGG - Intergenic
1038933789 8:32225184-32225206 CCAAGCTAATAGCTCCAGGGAGG - Intronic
1045067656 8:98465230-98465252 TCTAGCTGAGAGACCTAGGGTGG - Intronic
1046847666 8:118936145-118936167 TCTTTCTTAAAGATACAGGGAGG + Intronic
1047406237 8:124587887-124587909 TTTTGATAAAAGAACCAGGGAGG - Intronic
1047517880 8:125570603-125570625 CCTAGCCAAAAGATCCAGCAGGG - Intergenic
1053639664 9:40058998-40059020 TCTAAATAAAAGATCTAGGCCGG + Intergenic
1054545085 9:66317623-66317645 TCTAAATAAAAGATCTAGGCCGG - Intergenic
1059194165 9:112355088-112355110 TCTAGCAAGAAAATCCACGGTGG - Intergenic
1059330317 9:113531104-113531126 TCTAGCTGCAAGATCCTGGGTGG + Intronic
1060279985 9:122209321-122209343 TCAAGCTTTAAGTTCCAGGGAGG - Intronic
1061085362 9:128394956-128394978 TCCAGCTGGAAGCTCCAGGGAGG - Intergenic
1061800090 9:133108987-133109009 TCCAGCTAAAAGAACCAAGGAGG + Intronic
1185746963 X:2581376-2581398 TCTAGCCAAAAGCTCCAAGTGGG + Intergenic
1186561453 X:10618022-10618044 CCTAGCTATAAGATTCAGAGGGG - Intronic
1188313323 X:28644143-28644165 TCTAGCTTCCAGATCCAGGGAGG + Intronic
1190972019 X:55358652-55358674 CCTAACTAAAAGATACAGAGTGG + Intergenic
1198397422 X:136234350-136234372 TCTAACTAAAAGCTGAAGGGTGG + Intronic